Zeinab Elmasri1, Vashi Negi2, Richard J Kuhn2,3, Joyce Jose1,4. 1. Department of Biochemistry and Molecular Biology, The Pennsylvania State University, University Park, Pennsylvania, United States of America. 2. Department of Biological Sciences, Purdue University, West Lafayette, Indiana, United States of America. 3. Markey Center for Structural Biology and Purdue Institute of Inflammation, Immunology and Infectious Disease, Purdue University, West Lafayette, Indiana, United States of America. 4. The Huck Institutes of the Life Sciences, The Pennsylvania State University, University Park, Pennsylvania, United States of America.
Abstract
Many viruses encode ion channel proteins that oligomerize to form hydrophilic pores in membranes of virus-infected cells and the viral membrane in some enveloped viruses. Alphavirus 6K, human immunodeficiency virus type 1 Vpu (HIV-Vpu), influenza A virus M2 (IAV-M2), and hepatitis C virus P7 (HCV-P7) are transmembrane ion channel proteins that play essential roles in virus assembly, budding, and entry. While the oligomeric structures and mechanisms of ion channel activity are well-established for M2 and P7, these remain unknown for 6K. Here we investigated the functional role of the ion channel activity of 6K in alphavirus assembly by utilizing a series of Sindbis virus (SINV) ion channel chimeras expressing the ion channel helix from Vpu or M2 or substituting the entire 6K protein with full-length P7, in cis. We demonstrate that the Vpu helix efficiently complements 6K, whereas M2 and P7 are less efficient. Our results indicate that while SINV is primarily insensitive to the M2 ion channel inhibitor amantadine, the Vpu inhibitor 5-N, N-Hexamethylene amiloride (HMA), significantly reduces SINV release, suggesting that the ion channel activity of 6K similar to Vpu, promotes virus budding. Using live-cell imaging of SINV with a miniSOG-tagged 6K and mCherry-tagged E2, we further demonstrate that 6K and E2 colocalize with the Golgi apparatus in the secretory pathway. To contextualize the localization of 6K in the Golgi, we analyzed cells infected with SINV and SINV-ion channel chimeras using transmission electron microscopy. Our results provide evidence for the first time for the functional role of 6K in type II cytopathic vacuoles (CPV-II) formation. We demonstrate that in the absence of 6K, CPV-II, which originates from the Golgi apparatus, is not detected in infected cells, with a concomitant reduction in the glycoprotein transport to the plasma membrane. Substituting a functional ion channel, M2 or Vpu localizing to Golgi, restores CPV-II production, whereas P7, retained in the ER, is inadequate to induce CPV-II formation. Altogether our results indicate that ion channel activity of 6K is required for the formation of CPV-II from the Golgi apparatus, promoting glycoprotein spike transport to the plasma membrane and efficient virus budding.
Many viruses encode ion channel proteins that oligomerize to form hydrophilic pores in membranes of virus-infected cells and the viral membrane in some enveloped viruses. Alphavirus 6K, human immunodeficiency virus type 1 Vpu (HIV-Vpu), influenza A virus M2 (IAV-M2), and hepatitis C virus P7 (HCV-P7) are transmembrane ion channel proteins that play essential roles in virus assembly, budding, and entry. While the oligomeric structures and mechanisms of ion channel activity are well-established for M2 and P7, these remain unknown for 6K. Here we investigated the functional role of the ion channel activity of 6K in alphavirus assembly by utilizing a series of Sindbis virus (SINV) ion channel chimeras expressing the ion channel helix from Vpu or M2 or substituting the entire 6K protein with full-length P7, in cis. We demonstrate that the Vpu helix efficiently complements 6K, whereas M2 and P7 are less efficient. Our results indicate that while SINV is primarily insensitive to the M2 ion channel inhibitor amantadine, the Vpu inhibitor 5-N, N-Hexamethylene amiloride (HMA), significantly reduces SINV release, suggesting that the ion channel activity of 6K similar to Vpu, promotes virus budding. Using live-cell imaging of SINV with a miniSOG-tagged 6K and mCherry-tagged E2, we further demonstrate that 6K and E2 colocalize with the Golgi apparatus in the secretory pathway. To contextualize the localization of 6K in the Golgi, we analyzed cells infected with SINV and SINV-ion channel chimeras using transmission electron microscopy. Our results provide evidence for the first time for the functional role of 6K in type II cytopathic vacuoles (CPV-II) formation. We demonstrate that in the absence of 6K, CPV-II, which originates from the Golgi apparatus, is not detected in infected cells, with a concomitant reduction in the glycoprotein transport to the plasma membrane. Substituting a functional ion channel, M2 or Vpu localizing to Golgi, restores CPV-II production, whereas P7, retained in the ER, is inadequate to induce CPV-II formation. Altogether our results indicate that ion channel activity of 6K is required for the formation of CPV-II from the Golgi apparatus, promoting glycoprotein spike transport to the plasma membrane and efficient virus budding.
Sindbis virus (SINV) is an enveloped, mosquito-borne alphavirus belonging to the family Togaviridae. Alphaviruses cause debilitating acute polyarthritis and encephalitis in humans and pose a significant risk to global health due to their wide geographic distribution and their ability to cause severe diseases in humans and other animals [1,2]. Reemerging alphaviruses such as chikungunya virus (CHIKV) and Mayaro virus (MAYV) have become a significant health problem in Central and South America, causing debilitating long-term arthritis [3-6]. Venezuelan equine encephalitis virus (VEEV) and Eastern equine encephalitis virus (EEEV) can cause severe and sometimes fatal encephalitis in humans [7,8]. Currently, there are no treatments or vaccines licensed for use against alphavirus infections.Alphavirus virions are spherical with a diameter of approximately 70 nm. The 11.7 Kb positive-sense single-stranded RNA genome is packaged into a nucleocapsid core (NC) surrounded by a host-derived lipid bilayer [9]. The 5’ two-thirds of the genome encodes four non-structural proteins (nsP1-4) that, along with host proteins and viral RNA, form the membrane-associated alphavirus replication complex (RC) [10,11]. The 3’ one-third of the genome encodes the structural proteins capsid (CP), E3, E2, 6K, Trans frame (TF), and E1 that are translated from a subgenomic RNA. Trimers of the E1/E2 heterodimers form 80 trimeric spikes on the surface of the virion [1]. Alphavirus budding in mammalian cells occurs at the plasma membrane following specific interactions of the NC and the cytoplasmic domain of E2 (cdE2) [12-14]. In mosquito cells, virus budding occurs at the plasma membrane as well as at the membranes of large cytoplasmic vesicles [15]. Electron microscopy (EM) analyses of alphavirus-infected mammalian cells have revealed two types of virus-induced structures called cytopathic vacuoles type 1 (CPV-Is) and type II (CPV-IIs) [16]. CPV-Is are larger and associated with replication complexes (RC) [15,17,18]. CPV-IIs are assembly structures with a diameter of 0.5–1 μm and are derived from the trans-Golgi network [19,20]. Electron tomography studies have shown that NCs are attached to the cytoplasmic side of CPV-IIs. E1 and E2 are found within these vacuoles arranged in hexagonal arrays similar to their arrangement on the virion envelope [21]. The near-atomic structure of the CHIKV RNA replicase and the subnanometer-resolution cellular architecture of the RCs have been resolved recently utilizing in vitro reconstitution and in situ electron cryotomography [22]. Similarly, recent innovative TEM techniques have revealed the presence of four different morphological classes of CPV-IIs, with class 1 originating directly from swelling of the Golgi, and classes 2, 3, and 4 originating from fragmentation and bending of the Golgi cisternae [20]. However, the precise mechanisms through which NCs attach to the CPV-II and how NCs arrive at the plasma membrane are yet to be determined. The clustering of CPV-IIs near the plasma membrane suggests that these vacuoles might play a role in delivering NCs to the plasma membrane for budding.The structures of several alphaviruses such as SINV [23,24], Semliki forest virus (SFV) [25], EEEV [26], and more recently MAYV and VEEV [27,28], were resolved using cryo-electron microscopy (cryo-EM) and have provided considerable knowledge about the functions of E1 and E2 in the alphavirus life cycle. The 6K and TF have been reported to be incorporated into the virions in substoichiometric amounts [29,30]. The recent 3.0 Å resolution VEEV virus-like particles (VLPs) [28] and high-resolution cryo-EM maps of alphaviruses have not revealed the density corresponding to either 6K or TF. The alphavirus 6K is a small hydrophobic protein predicted to have two transmembrane helices, with the second helix serving as a translocation signal for E1 [31]. During translation, the presence of a slippery codon motif in the 6K gene can result in ribosomal frameshifting leading to the production of TF while hindering E1 translation [32]. Although 6K and TF have the same N-terminal transmembrane helix, the two proteins differ in that TF has a unique cytoplasmic C-terminal domain which is conserved among alphaviruses, while 6K has a second transmembrane helix [32]. In the context of the SFV life cycle, the role of 6K has been shown to be dispensable for virus entry, replication, and glycoprotein trafficking to the plasma membrane, but is essential for virus budding [33,34]. However, a partial deletion of SINV 6K and a complete deletion of Salmonid alphavirus (SAV) 6K both have resulted in aberrant glycoprotein processing and trafficking in addition to budding defects [35,36].Bacterial expression of 6K protein has been found to alter E. coli membrane permeability, a characteristic that primarily led to the classification of 6K as a viral ion channel or viroporin [37-39]. Furthermore, mutations of the interfacial domains of 6K have indicated the presence of an oligomeric channel that selectively transports divalent cations [40]. Viral ion channels play essential roles in the life cycles of RNA viruses [41,42]. Influenza A virus (IAV) M2 ion channel is a proton channel that regulates the pH during virus entry and glycoprotein trafficking during exit [43,44]. Human immunodeficiency virus type 1 (HIV-1) Vpu promotes virus budding while also important for counteracting human tetherin [45-47]. Hepatitis C (HCV) P7 orchestrates virus assembly and regulates the pH maturation process of HCV particles [48,49]. The key roles played by viral ion channels also make them attractive therapeutic targets. Amantadine and amiloride analogs that inhibit ion channels have showed efficacy as antiviral drugs against multiple viruses such as IAV, HIV-1, and HCV [50-52]. Previously, Vpu expression in trans has been shown to complement the membrane permeabilization capacity and virus particle production of SINV 6K with a partial deletion [53] while also suggesting that 6K is functionally analogous to Vpu.In this study, we demonstrate the functional role of the ion channel activity of 6K in alphavirus glycoprotein trafficking and budding. By incorporating a miniSOG tag [54], we determined the real-time localization of 6K for the first time by live imaging in SINV infected cells. We show that 6K and E2 colocalize on Golgi in the secretory pathway, which is unaffected by the deletion of TF. We observed a similar 6K and E2 colocalization in virus-infected mosquito cells. By using SINV with 6K deletion (SINV Δ6K) we found that 6K is critical for biogenesis of CPV-IIs and efficient glycoprotein trafficking to the plasma membrane. To investigate whether these defects are due to the absence of a functional ion channel, we first generated recombinant SINV expressing full-length P7 in place of 6K. Although the full-length P7 substitution improved the rate of virus budding compared to the 6K deletion, it was still defective compared to wild-type virus and failed to rescue the CPV-II formation. We reasoned that the defect is due to the site of action as HCV assembly and budding occur in association with the ER membrane, unlike alphaviruses that bud from the plasma membrane [55]. Using Flag-tagged 6K and P7 viruses, we compared the subcellular localization of P7 with that of 6K and found that in the context of SINV chimera, the P7 is retained in the ER, whereas 6K localizes to ER and Golgi. Subsequently, we generated chimeric SINV using ion channels M2 and Vpu encoded by enveloped viruses IAV and HIV-1 respectively, that bud from the plasma membrane. We constructed these chimeras by substituting the ion channel transmembrane helix of 6K with that of HIV-1 Vpu, and IAV M2. Since M2 and Vpu are Class I viroporins with a single membrane-spanning domain [42], to ensure the correct membrane topology of the structural polyprotein, we retained the C-terminal helix of 6K in both M2 and Vpu chimera. Confocal imaging and EM analysis of cells infected with the chimeric M2 SINV and Vpu SINV show that glycoprotein trafficking and CPV-II formation are comparable to that of WT SINV. Immunostaining analysis of cells infected with the Flag-tagged chimeric viruses indicate that 6K, M2, and Vpu localize to the Golgi apparatus, unlike P7, which is retained in the ER. Our results demonstrate that CPV-II formation and efficient glycoprotein trafficking require the ion channel activity of 6K in the late secretory pathway since they were complemented by Vpu and M2. Our study attributes specific functions to 6K in regulating virus assembly, which can be inhibited by channel blockers, thus presenting 6K as an antiviral target for alphavirus drug development.
Materials and methods
Viruses and cells
BHK-15 (baby hamster kidney) cells were maintained at 37°C and 5% CO2 in Eagle’s minimum essential medium (ThermoFisher) supplemented with 10% fetal bovine serum (FBS, Seradigm #1500–500), nonessential amino acids (Gibco, #11140–050), 1X Penicillin-Streptomycin solution (Corning Inc). C6/36 mosquito (Aedes albopictus) cells (ATCC) were maintained at 30°C in the presence of 5% CO2 in MEM supplemented with 2 mM l-glutamine, 0.1 mM nonessential amino acids, 25 mM HEPES, and 10% heat-inactivated FBS. Huh-7.5 (human hepatoma) cells were maintained at 37°C, and 5% CO2 in Dulbecco’s modified Eagle’s medium (ThermoFisher) supplemented with 10% FBS, 1X Penicillin-Streptomycin solution, l-glutamine, and nonessential amino acids. Wild type and mutant SINV were generated from a full-length cDNA clone pToto64 [56].
Plasmids and cloning
Alphavirus 6K sequence were analyzed and multiple sequence alignment were generated using Clustal omega [57]. Alignments were viewed using Jalview [58]. (S1 Fig). The 6K mutations were generated in pToto64 by standard overlap PCR mutagenesis procedures. Overlap PCR products were digested with BssHII and BsiWI and cloned into pToto64. Sequences corresponding to influenza M2 transmembrane helix, HIV Vpu transmembrane helix, and full-length HCV-P7 were synthesized as oligonucleotide primers for overlap extension PCR (S1 Table). A FLAG (DYKDDDDK) epitope tag was inserted after the N-terminal signalase cleavage site on 6K and other ion channel chimeras by overlap PCR. Sequence corresponding to the fluorescent protein miniSOG [54] was amplified and cloned at the N-terminus of 6K after the signalase cleavage site by overlap PCR. Deletion of 6K was also introduced into a previously described fluorescent protein (FP) tagged SINV construct where the mCherry was inserted as an N-terminal tag of E2 after the E3-E2 furin cleavage site [59]. The dual-labeled miniSOG-6K/mCherry-E2 construct was generated by subcloning a BssHII-BsiWI insert from the miniSOG-6K plasmid into the mCherry-E2 plasmid. ΔTF construct was generated using primers (S1 Table) as previously described [37]. For the construction of mammalian expression plasmids, the mCherry-tagged structural polyproteins E3-mCherry-E2-6K-E1, CP-E3-mCherry-E2-6K-E1, and E3-mCherry-E2-E1 were amplified from full-length SINV cDNA clones of mCherry-E2 and Δ6K mCherry-E2 by PCR and subcloned into pcDNA3.1 plasmid for mammalian expression. S1 Table lists all the oligonucleotide primers used in this study.
In vitro transcription and transfection
Full-length infectious RNA of the wild-type (WT) and mutant SINV were generated by in vitro transcription using the WT and mutant pToto64 cDNA clones. The cDNA clones were linearized with SacI followed by in vitro transcription with SP6 RNA polymerase as previously described [60]. BHK-15 cells were electroporated with 10 μg of in vitro transcribed RNA. Virus-containing media were harvested at 24 hours post-electroporation and the virus titers (plaque-forming units per ml) were determined by titration on BHK-15 cells monolayers. The presence of mutation in each virus was confirmed by sequencing the reverse transcription (RT)-PCR products corresponding to the 6K coding region from RNA purified from the cytoplasmic extracts of infected BHK-15 cells.
Plaque assay
Plaque assays were performed on BHK cells, and the number of plaques was determined after staining the plaques with either neutral red or crystal violet. For neutral red staining, virus stocks were serially diluted in PBS supplemented with 1% FBS and 1 mM each of CaCl2 and MgCl2. From the virus stocks, 250 μL were added to each well of BHK-15 cell monolayers grown on six-well plates and incubated at room temperature for 1 h with rocking. The cells were subsequently overlaid with 3 ml of 1% agarose in MEM and incubated at 37°C with 5% CO2. After 48 hours, virus titers were determined by staining the plates with neutral red (MilliporeSigma, #N2889) and counting the number of plaques. For crystal violet staining, serially diluted virus stocks were added to each well of a BHK-15 monolayer of cells grown on a 24-well plate and rocked for 1 hour at room temperature. Subsequently, the cells were overlaid with MEM containing 2% FBS, 2% cellulose, and 2% 20 mM HEPES buffer pH: 7.4. Plates were incubated for 48 h at 37°C in the presence of 5% CO2. Plaques were counted after fixing the cells for 2 h with a mixture of 10% formaldehyde and 2% methanol (v/v in water) and staining with 0.1% crystal violet prepared in 20% ethanol. All experiments were performed in triplicates.
Growth kinetic analyses
Growth kinetics of wild-type and mutant SINV were determined by one-step growth curve analysis as previously described [15]. Briefly, BHK-15 cells on 6 well plates were infected with WT and mutant viruses at a multiplicity of infection (MOI) of 2 and rocked for 1 hour at room temperature. After infecting the cells for 1 hour at 37°C virus inoculum was removed, and cells were washed twice with PBS supplemented with 1% FBS and 1 mM each of CaCl2 and MgCl2. Cells were then incubated at 37°C in MEM supplemented with 5% FBS. Supernatants were collected from infected cells and the medium over cells was replaced with fresh medium every 1 hour for 12 hours post-infection (hpi). Virus titers at different time points post-infection were determined by plaque assays using a monolayer of BHK-15 cells. All experiments were performed in triplicates.
qRT-PCR and specific infectivity
A quantitative real-time PCR assay was performed to determine the number of virus particles released at different time points post-infection, as previously described [15]. Briefly, RNA was extracted from the culture supernatant using RNeasy kit (Qiagen, Valencia, CA, USA) according to the manufacturer’s instructions. SuperScript III Platinum SYBR green one-step qRT-PCR kit (Invitrogen, Grand Island, NY) was used to perform qRT-PCR in triplicate in 25-μl sample volumes that contained a 5-μl aliquot of purified viral RNA. SINV-specific primers 5′ TTCCCTGTGTGCACGTACAT 3′ and 5′ TGAGCCCAACCAGAAGTTTT 3′, which bind nucleotides 1044 to 1063 and nucleotides 1130 to 1149 of the SINV genome, respectively were used for the assay. Experiments were performed in triplicate. The standard curve of the cycle threshold (C) used to determine the viral RNA copy number was generated using in vitro transcribed genomic RNA. The cycling parameters were 4 min at 50°C and 5 min at 95°C, followed by 40 cycles of 5 s at 95°C and 1 min at 60°C. All experiments were performed in triplicates.Specific infectivity of WT and chimeric viruses was determined by calculating the ratio of the average number of viral RNA molecules per milliliter divided by the average number of PFU per milliliter as previously described [61-63]
Thin-section TEM
BHK-15 cells infected with WT or mutant SINV at an MOI of 2 were fixed at 6- or 12-hours post-infection. Samples were fixed with 2% glutaraldehyde–0.1 M cacodylate buffer (0.1 M Na-cacodylate, 2 mM MgCl2, 2 mM CaCl2, and 0.5% NaCl at pH 7.4) for 3 days, washed in cacodylate buffer followed by water, embedded in 2% agarose, postfixed for 90 min in buffered 1% osmium tetroxide containing 0.8% potassium ferricyanide, and stained for 45 min in 2% uranyl acetate. Following that, the samples were dehydrated with a graded series of ethanol, embedded in EMbed-812 resin, and cell sections were cut using Reichert-Jung Ultracut E ultramicrotome. Images of samples stained with uranyl acetate and lead citrate were then obtained in an FEI Tecnai G2 20 electron microscope equipped with a LaB6 source and operated at 100 keV (Life Science Microscopy Facility, Purdue University). A minimum of 50 frames were collected for each condition.
Immunofluorescence (IF) Analysis
IF was performed after growing BHK-15 cells or Huh-7.5 cells on glass coverslips. Briefly, cells were either transfected with mEmerald-SEC61B-C1 (Addgene plasmid# 90992) and infected with Flag-6K SINV, or Flag-tagged chimeric SINV, or infected with WT SINV, Δ6K SINV, or Chimeric SINV. Cells were then fixed for 15 min at room temperature with 4% paraformaldehyde in phosphate-buffered saline (PBS) at 6 or 12 hpi. The fixed cells were permeabilized with 0.1% Triton-X100 in PBS for 5 min. a mouse monoclonal anti-E2 antibody and a rabbit polyclonal anti-CP antibody were used to detect E2 and CP. A mouse monoclonal anti-FLAG antibody (Sigma) was used to detect the FLAG tag. A rabbit polyclonal anti-Giantin antibody (Abcam, ab80864) was used to image the Golgi apparatus. The secondary antibodies used were fluorescein isothiocyanate (FITC) or tetramethylrhodamine isothiocyanate (TRITC)-conjugated goat anti-rabbit and goat anti-mouse antibodies (Thermo Fisher Scientific). Nuclei were stained with Hoechst stain (Invitrogen), and images were acquired using a Nikon AIR confocal microscope with a 60X oil objective. The NIS Elements software (Nikon) was used for processing images.
Western blot analysis
BHK-15 cells were infected with P2 (second passage) stock of viruses recovered from cells electroporated with in-vitro transcribed RNA of wild-type SINV, Δ6K SINV, and miniSOG-6K SINV. Infected cells were lysed using a lysis buffer [25mM Tris-HCl pH 7.5, 150 mM NaCl, 1% Triton-X 100, 5mM 2-mercaptoethanol, 1mM PMSF] at 12 hpi. Lysates were separated on a 4–20% precast SDS-PAGE gel (Bio-Rad). Proteins were transferred onto a nitrocellulose membrane and probed with mouse monoclonal anti-actin antibody and rabbit polyclonal antibodies against SINV E2 and Capsid proteins. Infrared labeled secondary antibodies (goat anti-mouse 680 and goat anti-rabbit 800) were used for detection. Blots were imaged using Odyssey CLx Near-Infrared Imaging System and analyzed using Licor Image Studio software.
Flow cytometry analysis
Flow cytometry analysis was performed as previously described [64]. BHK-15 cells were seeded on 35mm dishes and infected with WT or mutant SINV with an MOI of 2. Infected cells were then trypsinized at 6, or 12 hpi and resuspended with MEM containing 5% FBS. Cells were incubated for an hour on ice with a 1 to 50 dilution of a monoclonal mouse anti-E2 antibody and subsequently washed 3 times with PBS. A goat anti-mouse FITC secondary antibody was then used to stain the cells. Flow analysis was performed on a Beckman Coulter FC500 flow cytometer and with the FlowJo software package. Experiments were performed in duplicates.
SINV infection and drug treatment
BHK-15 cells seeded in a 96-well plate were treated with different concentrations of Amantadine or HMA for 12 hours. Cells were then infected with the viruses at an MOI of 0.1 and incubated at 37°C in 5% CO2. Supernatants were collected at 8 hpi and virus titers were determined using plaque assay conducted on a monolayer of BHK-15 cells followed by crystal violet staining. Experiments were performed in triplicates.
Cytotoxicity assay
BHK-15 cells were seeded into 96-well plates (Thermo Fisher Scientific) and treated with the indicated different concentrations of Amantadine or Hexamethylene amiloride (HMA) after 24 hours. Cells were then incubated with compounds at 37°C in 5% CO2 for 24 hours. For HMA, DMSO-treated cells were used as controls. Cytotoxicity was determined using alamarBlue cell viability reagent (BIO-RAD) according to the manufacturer’s instructions. In short, alamarBlue was added to the 96-well plates in an amount equal to 10% of the volume in the well. The plates were then incubated at 37°C in 5% CO2 for 3 hours. Absorbance at 570 nm and 600 nm was determined using an ELISA plate reader (SpectraMax iD3). Data analysis was performed using PRISM 9 software.
Live-cell imaging
BHK-15 cells seeded in a 4-well chamber (Ibidi) were infected with 6K-miniSOG or mCherry-E2 virus and imaged. For imaging using cellular markers, BHK-15 cells were transfected with the fluorescent-protein tagged mammalian expression plasmid YFP-membrane [65] using Lipofectamine 2000 (Thermo Fisher Scientific) according to the manufacturer’s instructions. The mammalian expression constructs of E3-mCherry-E2-6K-E1 and E3-mCherry-E2-E1 were transfected using lipofectamine and subjected to imaging. For the live-cell imaging of fluorescent-protein tagged SINV, BHK-15 cells were electroporated with the in vitro transcribed RNA corresponding to the mCherry-E2 SINV and Δ6K-mCherry-E2 SINV and plated on a 4-well chamber and imaged at indicated time-points. For detecting the subcellular localization of 6K, transfected cells expressing the fluorescent protein-tagged cellular markers mCherry-SEC61B-C1 (Addgene plasmid# 90994) or mTagBFP2-SiT-N-15 (Addgene plasmid# 55325) and infected with miniSOG-6K at an MOI of 5 and imaged at 12 hpi. Nikon AIR confocal microscope was used for live imaging using a growth chamber (Tokai Hit, Fujinomiya, Shizuoka Prefecture, Japan) supplied with 5% CO2 at 37°C using a 60X oil objective with 1.4 numerical aperture (NA). A Resonance scanner was used for miniSOG imaging. The lasers and emission band-passes used for imaging were as follows: blue, excitation of 405 nm and emission of 425 to 475 nm; green, excitation of 488 nm and emission of 500 to 550 nm; red, excitation of 561 nm and emission of 570 to 620 nm.
Results
6K exerts its functional role during alphavirus release that in part can be complemented in cis by ion channels from enveloped viruses
To assess the role of 6K in Sindbis virus assembly, we constructed a SINV with complete 6K deletion (Δ6K SINV) (Fig 1A). The Δ6K SINV exhibited a small plaque phenotype compared to the large plaque phenotype of the WT SINV (Fig 1B and 1C). We next generated IAV M2 and HIV-1 Vpu ion channel chimeras to investigate whether the ion channel activity from other viral ion channels could functionally complement the ion channel activity of 6K in cis (Fig 1A). We generated these ion channel chimeras by substituting the conserved 6K transmembrane (TM) helix (S1 Fig) with ion channel TM helix from HIV-1 Vpu, and IAV M2 transmembrane helix, in cis. In the TM helix chimeras, the C-terminal signal sequence of 6K was retained for maintaining the polyprotein topology required for the precise E1 translocation. The slippery codon responsible for the translation of TF protein was removed from all the 6K mutants to inhibit TF production. Since HCV P7 and 6K have the same membrane topology as Class II viroporins with two transmembrane helices that span the membrane with their N and C termini in the ER lumen, we generated a full-length P7 chimera substituting the 6K sequence, except for the N and C terminal signalase cleavage sites (Fig 1A). Chimeric SINV produced plaques with morphology ranging from small to large (Fig 1B and 1C). We next assessed the one-step growth kinetics of WT and mutant SINV. We found that the deletion of 6K has a significant effect on virus release as it resulted in an approximately 4-log reduction in virus titer compared to WT SINV (Fig 1D). Vpu SINV exhibited a two-log increase in titer compared to Δ6K SINV followed by M2 SINV and P7 SINV (~1 log) (Fig 1D). Our results from P7 SINV indicate that a full-length viral ion channel with a similar membrane topology can partially substitute for 6K in cis. To ascertain whether these reductions in virus titers of the mutants are due to the presence of several noninfectious particles released into the media, we quantified the number of viral RNA molecules released into the media using qRT-PCR, and the particle/PFU ratio was calculated at the indicated time points (Fig 1E and 1F). The specific infectivity of the Δ6K SINV was reduced by ~2.8 folds compared to that of WT SINV. Among the chimeric viruses, the specific infectivity of P7 SINV was reduced by ~3.4 folds compared to WT SINV. On the other hand, M2 SINV and Vpu SINV exhibited specific infectivity comparable to the WT (Fig 1F) suggesting that the reduction in titer is not due to an excessive number of noninfectious particles with defects in the virus attachment or entry.
Fig 1
Generation and characterization of 6K mutants.
(A). The amino-acid sequence of the 6K region from WT SINV, Δ6K SINV, p7 SINV, M2 SINV, and Vpu SINV. (B). Plaque morphologies of WT and 6K mutant viruses. Viruses were collected from electroporated BHK-15 cells 24 h post-electroporation, and plaques were visualized by staining BHK-15 cells 48 hpi. (C). Mean plaque diameters of the virus plaques in BHK-15 cells measured on day 2 pi. Plaque size was determined by random selection of 10 plaques and values are expressed as the mean with standard error (SEM). Significance was determined using Dunnett’s multiple comparisons test as part of one-way ANOVA with a 95% confidence interval. p Values were considered significant when p < 0.05 (*), p < 0.01 (**), p < 0.001(***), and p < 0.0001(****). ns indicates “not significant”. (D). One-step growth curve analysis of WT and 6K mutant viruses from BHK-15 cells. BHK-15 cells were infected with WT or 6K mutant viruses at an MOI of 5, medium was harvested and replaced every hour for 12 h, and the rate of virus release (plaque-forming unit (pfu) per ml per hour) was determined using standard plaque assays. Data shown are from three independent experiments. Error bars indicate standard error of mean (SEM). (E). Quantification of the number of virus particles released into the medium for WT and 6K mutant viruses at 12 hpi. The total number of viral genomic RNA molecules was determined by qRT-PCR using a standard curve of a known amount of in vitro-transcribed SINV RNA molecules. The pfu in these samples were determined by standard plaque assays of the virus supernatant collected at 12 hpi from infected BHK-15 cells. Data shown are from three independent experiments. The error bars indicate the standard error of mean (SEM). (F) Specific infectivity of WT and chimeric viruses.
Generation and characterization of 6K mutants.
(A). The amino-acid sequence of the 6K region from WT SINV, Δ6K SINV, p7 SINV, M2 SINV, and Vpu SINV. (B). Plaque morphologies of WT and 6K mutant viruses. Viruses were collected from electroporated BHK-15 cells 24 h post-electroporation, and plaques were visualized by staining BHK-15 cells 48 hpi. (C). Mean plaque diameters of the virus plaques in BHK-15 cells measured on day 2 pi. Plaque size was determined by random selection of 10 plaques and values are expressed as the mean with standard error (SEM). Significance was determined using Dunnett’s multiple comparisons test as part of one-way ANOVA with a 95% confidence interval. p Values were considered significant when p < 0.05 (*), p < 0.01 (**), p < 0.001(***), and p < 0.0001(****). ns indicates “not significant”. (D). One-step growth curve analysis of WT and 6K mutant viruses from BHK-15 cells. BHK-15 cells were infected with WT or 6K mutant viruses at an MOI of 5, medium was harvested and replaced every hour for 12 h, and the rate of virus release (plaque-forming unit (pfu) per ml per hour) was determined using standard plaque assays. Data shown are from three independent experiments. Error bars indicate standard error of mean (SEM). (E). Quantification of the number of virus particles released into the medium for WT and 6K mutant viruses at 12 hpi. The total number of viral genomic RNA molecules was determined by qRT-PCR using a standard curve of a known amount of in vitro-transcribed SINV RNA molecules. The pfu in these samples were determined by standard plaque assays of the virus supernatant collected at 12 hpi from infected BHK-15 cells. Data shown are from three independent experiments. The error bars indicate the standard error of mean (SEM). (F) Specific infectivity of WT and chimeric viruses.
Glycoprotein E2 cell-surface expression is reduced in the absence of 6K and is restored by an efficient ion channel chimera
To determine the role of an ion channel in alphavirus glycoprotein transport to the plasma membrane, we performed IF analysis using antibodies against E2 and CP on BHK-15 cells infected with WT SINV, Δ6K SINV, M2 SINV, Vpu SINV, and P7 SINV with an MOI of 1 at 6 or 12 hpi (Fig 2A). E2 was detected at the plasma membrane at 6 hpi in cells infected with WT SINV with increased accumulation at 12 hpi. In the absence of 6K, E2 was not detected at the plasma membrane at 6 hpi. Instead, E2 accumulated in the ER membrane localizing to the perinuclear region (Fig 2A). Vpu SINV and M2 SINV exhibited E2 expression at the plasma membrane at 6 hpi, with Vpu SINV exhibiting WT-like E2 distribution (Fig 2A). To further validate the E2 expression at the plasma membrane, we used permeabilized and non-permeabilized BHK-15 cells infected with WT and mutant SINV in IF analysis. We quantified the cell-surface expression of E2 using IF analysis of permeabilized and non-permeabilized cells using an anti-E2 antibody (Fig 2B and 2D). The analysis supported the data obtained from the IF analysis depicting the low surface expression of E2 in Δ6K SINV. All three chimeric viruses showed increased E2 surface expression compared to Δ6K SINV, with Vpu SINV the most efficient. We next quantified the cell surface expression of E2 in WT and mutant SINV at 6 and 12 hpi with flow cytometry, using an anti-E2 antibody (Figs 2C and S2) Comparable to the results obtained from the IF analysis, Δ6K SINV showed defective E2 transport to the cell surface. The plasma membrane expression of E2 in Vpu SINV was equivalent to WT SINV. Together, these results show that alphavirus glycoprotein transport to the cell surface is restricted in the absence of an ion channel activity, and substituting a functional ion channel enhances the E2 surface expression.
Fig 2
Functional complementation of 6K by other viral ion channels.
(A) IF analysis of permeabilized BHK-15 cells infected with WT SINV, Δ6K SINV, M2 SINV, Vpu SINV, or P7 SINV at 6 or 12 hpi using antibodies against E2 (Green) and CP (Red). (B) IF analysis of glycoprotein trafficking to the plasma membrane under permeabilized or non-permeabilized conditions. BHK-15 cells were electroporated with RNA corresponding to WT or 6K mutant viruses and fixed at 12 h post-electroporation Anti-E2 monoclonal antibody was used to detect glycoproteins. Nuclei were stained with Hoechst stain. (C) Flow cytometry analysis of cells infected with WT or 6K mutant viruses at an MOI of 5. Cells were incubated with a monoclonal anti-E2 antibody followed by staining with FITC secondary antibody. Results are shown as a log10 of the geometric mean of the region of the curve measuring the amount of E2 fluorescence at the plasma membrane. Data shown are from two independent experiments. Error bars indicate standard error of mean (SEM). Significance was determined using Dunnett’s multiple comparisons test as part of two-way ANOVA with a 95% confidence interval. p Values were considered significant when p < 0.05 (*), p < 0.01 (**), p < 0.001(***), and p < 0.0001(****). ns indicates “not significant”. (D) Quantification of glycoprotein trafficking to the plasma membrane from (B). The number of cells expressing E2 (green) relative to the total number of cells (blue) was determined using the NIS Elements software. Cells from 10 independent frames per condition were counted. Error bars indicate standard error of mean (SEM). Significance was determined by multiple unpaired t-tests of data. p Values were considered significant when p < 0.05 (*), p < 0.01 (**), p < 0.001(***), and p < 0.0001(****). ns indicates “not significant”.
Functional complementation of 6K by other viral ion channels.
(A) IF analysis of permeabilized BHK-15 cells infected with WT SINV, Δ6K SINV, M2 SINV, Vpu SINV, or P7 SINV at 6 or 12 hpi using antibodies against E2 (Green) and CP (Red). (B) IF analysis of glycoprotein trafficking to the plasma membrane under permeabilized or non-permeabilized conditions. BHK-15 cells were electroporated with RNA corresponding to WT or 6K mutant viruses and fixed at 12 h post-electroporation Anti-E2 monoclonal antibody was used to detect glycoproteins. Nuclei were stained with Hoechst stain. (C) Flow cytometry analysis of cells infected with WT or 6K mutant viruses at an MOI of 5. Cells were incubated with a monoclonal anti-E2 antibody followed by staining with FITC secondary antibody. Results are shown as a log10 of the geometric mean of the region of the curve measuring the amount of E2 fluorescence at the plasma membrane. Data shown are from two independent experiments. Error bars indicate standard error of mean (SEM). Significance was determined using Dunnett’s multiple comparisons test as part of two-way ANOVA with a 95% confidence interval. p Values were considered significant when p < 0.05 (*), p < 0.01 (**), p < 0.001(***), and p < 0.0001(****). ns indicates “not significant”. (D) Quantification of glycoprotein trafficking to the plasma membrane from (B). The number of cells expressing E2 (green) relative to the total number of cells (blue) was determined using the NIS Elements software. Cells from 10 independent frames per condition were counted. Error bars indicate standard error of mean (SEM). Significance was determined by multiple unpaired t-tests of data. p Values were considered significant when p < 0.05 (*), p < 0.01 (**), p < 0.001(***), and p < 0.0001(****). ns indicates “not significant”.
Live-cell imaging of E2 trafficking to the plasma membrane indicates that in the absence of 6K, E2 accumulates on internal membranes of the secretory pathway
As a first step to examine the alphavirus spike transport in live cells in the absence of virus replication and assembly, we co-expressed a YFP-tagged plasma membrane marker with a SINV envelope glycoprotein construct containing an mCherry tag on E2 (E3-mCherry-E2-6K/TF-E1) or a Δ6K mutant (E3-mCherry-E2-E1) (Fig 3A and 3B). Whereas mCherry-E2 localized to the plasma membrane (Fig 3A and S1 Video) in the WT construct, E2 accumulated on large cytoplasmic vesicles in the Δ6K mutant (Fig 3B and S2 Video). Since E2 cell surface expression occurs as an E2/E1 complex in the spike form, these results indicate that 6K exerts its functional role in alphavirus spike transport independent of virus replication, nonstructural proteins, and capsid. To corroborate these results in the context of live virus, we analyzed the cell-surface expression levels of E2 in live cells infected with mCherry-E2 tagged WT or Δ6K SINV. Cells were electroporated with RNA corresponding to these mCherry-E2 expressing SINV and Δ6K SINV and imaged at 6, 8, and 12 h post-electroporation (Fig 3D). Confirming the IF results and glycoprotein expression of WT and Δ6K mutant SINV, in live-cell imaging, mCherry-E2 was detected on filopodial extensions on the plasma membrane at 6 h post-electroporation of mCherry-E2 SINV, whereas mCherry-E2 accumulated in the perinuclear region in mCherry-E2 Δ6K SINV. Comparably, C6/36 cells infected with the mCherry-E2 tagged WT, or Δ6K SINV exhibited E2 accumulation on the cell surface, and E2 accumulated on large cytoplasmic vesicles in the absence of 6K at 24 hpi (S3 Fig). To verify whether the trafficking defect of E2 in Δ6K SINV is due to glycoprotein processing, we performed a western blot analysis of cell lysates using an anti-E2 antibody (Fig 3C). We observed the processing of E3 and E2 in both WT and Δ6K SINV, although there was a delay in the furin cleavage of E3-E2 unsurprisingly due to the delayed glycoprotein trafficking in Δ6K mutant as this cleavage occurs in late Golgi. Thus, it is evident that the delay in glycoprotein trafficking to the plasma membrane is not due to a polyprotein processing defect in Δ6K SINV.
Fig 3
6K is required for glycoprotein trafficking to the plasma membrane.
(A-B). Representative images of BHK-15 cells co-transfected with YFP-membrane (green) and E3-mCherry-E2-6K/TF-E1 (red) (A) or E3-mCherry-E2-E1 (red) (B). Images were collected at 12 h post-transfection. Images correspond to videos (S1 and S2 Videos). (C) Western blot analysis of cell lysates from BHK-15 cells infected with WT SINV or Δ6K SINV. The blot was probed with an anti-E2 primary antibody to detect the structural polyprotein-processing intermediates. (D) Images of BHK-15 cells transfected with YFP-membrane (green) and RNA corresponding to mCherry-E2 SINV (red) or Δ6K mCherry-E2 SINV (red). Images were collected at the indicated time points post-electroporation. Regions of interest are marked and represented as zoomed to the right in separate channels.
6K is required for glycoprotein trafficking to the plasma membrane.
(A-B). Representative images of BHK-15 cells co-transfected with YFP-membrane (green) and E3-mCherry-E2-6K/TF-E1 (red) (A) or E3-mCherry-E2-E1 (red) (B). Images were collected at 12 h post-transfection. Images correspond to videos (S1 and S2 Videos). (C) Western blot analysis of cell lysates from BHK-15 cells infected with WT SINV or Δ6K SINV. The blot was probed with an anti-E2 primary antibody to detect the structural polyprotein-processing intermediates. (D) Images of BHK-15 cells transfected with YFP-membrane (green) and RNA corresponding to mCherry-E2 SINV (red) or Δ6K mCherry-E2 SINV (red). Images were collected at the indicated time points post-electroporation. Regions of interest are marked and represented as zoomed to the right in separate channels.
Spatio-temporal analysis of 6K exhibits its localization to the ER, secretory vesicles, and the Golgi apparatus
To visualize the spatiotemporal organization of 6K and E2 in the secretory pathway, we investigated the subcellular localization of fluorescently tagged 6K and E2 using live-cell imaging. As a first step to identifying 6K localization, we constructed a fluorescent SINV expressing a miniSOG tag at the N-terminus of 6K (Fig 4A). The miniSOG-6K SINV resulted in a medium plaque phenotype (Fig 1B and 1C) with a 3-log reduction in virus titer compared to WT SINV (Fig 1D), similar to what was previously reported for mCherry tagged-E2 SINV [15,59] and several other fluorescent protein-tagged alphavirus mutants [66-69]. Western blot analysis using an anti-E2 antibody confirmed that although the insertion of the miniSOG-tag causes a delay in glycoprotein processing, a characteristic of alphavirus with fluorescent-protein tags in the structural proteins, the tag did not inhibit E3-E2 cleavage (Fig 4B) suggesting that the miniSOG-6K SINV is suitable for live imaging. Furthermore, the insertion of miniSOG-6K tag was stably retained in SINV for five passages. Thus, we performed live imaging of cells transiently transfected with the ER marker mCherry-SEC61B-C1 (Fig 4C), the trans-Golgi network (TGN) marker mTagBFP2-SiT-N-15 (Fig 4D), or the envelope glycoproteins CP-E3-mCherry-E2-6K/TF-E1 (Fig 4E), and infected with miniSOG-6K SINV at 12 hpi. From the image analysis, miniSOG-6K was detected localizing predominantly to the ER (S3 Video) and post-Golgi vesicles (S4 Video) colocalizing with E2 in the secretory pathway. However, we did not detect any quantifiable colocalization of miniSOG-6K and E2 on the plasma membrane (S5 Video). To further evaluate the localization of 6K and E2 when processed from the same structural polyprotein, we generated a dual-labeled mCherry-E2/miniSOG-6K SINV. Live-imaging of cells electroporated with RNA corresponding to the dual-labeled virus confirmed the colocalization of 6K and E2 in the secretory pathway (Fig 4F and S6 Video). Furthermore, this colocalization was unaffected by the deletion of TF (Fig 4G and S7 Video), suggesting that beyond the ER, 6K is transported along with E2 to the Golgi apparatus. Similar results confirming the colocalization of 6K and E2 were obtained from C6/36 cells infected with the WT or the ΔTF dual-labeled virus and imaged at 24 hpi (S3 Fig). We next tested whether the localization of 6K and the ion channel chimeras could be confirmed by IF analysis using an epitope tag. To investigate the localization of 6K and the ion channel chimeras, we inserted a Flag tag at the N-termini of 6K, Vpu, M2, and P7 SINV. The addition of a Flag tag to WT SINV, M2 SINV, Vpu SINV, or P7 SINV did not significantly affect virus titer, quantified by plaque assays (S4 Fig). We performed IF analysis on Flag-tagged 6K, Vpu, M2, and P7 SINV to determine the subcellular localization of 6K and ion channel chimeras in infected cells. Due to the availability of tools, we used anti-Giantin antibody and anti-Flag antibody in human hepatoma cells to determine the localization of 6K and other ion channels. Our analysis revealed that all the ion channel chimeras localized to the ER (S4 Fig); however, only 6K (Fig 5A), M2 (Fig 5C), and Vpu (Fig 5B) localize to the Golgi apparatus. The P7 chimera did not localize to Golgi and was retained in the ER (Figs 5D and S4). Furthermore, the localization of Flag-6K in the IF analysis was akin to the miniSOG-6K localization detected by live imaging, confirming that 6K, Vpu, and M2 channels localize to the Golgi apparatus.
Fig 4
Subcellular localization of 6K in infected cells.
(A) Schematic of the miniSOG-6K SINV construct. The sequence encoding the fluorescent protein miniSOG was cloned into WT toto64 after Thr2 of 6K as an N-terminal fusion. (B) Western blot analysis of the cell lysates from BHK-15 cells infected with WT SINV or miniSOG-6K SINV. The blot was probed with an anti-E2 primary antibody to detect the structural polyprotein processing intermediates. (C-E) Representative images of BHK-15 cells transfected with mCherry-SEC61B-C1 (red) (C), mTagBFP2-SiT-N-15 (blue) (D), or CP-E3-mCherry-E2-6K/TF-E1 (red) (E), and infected with miniSOG-6K SINV (green). Imaging was performed at 12 hpi. Regions of interest are marked and enlarged to the right as separate channels. Images correspond to videos (S3–S5 Videos) (F-G) Representative images of BHK-15 cells electroporated with RNA corresponding to the dual-labeled mCherry-E2/miniSOG SINV (mCherry-E2 is red and miniSOG-6K is green) (F) or ΔTF mCherry-E2/miniSOG SINV (mCherry-E2 is red and miniSOG-6K is green) (G) and imaged at 12 hpi Images correspond to videos (S6 and S7 Videos).
Fig 5
Localization of 6K and the ion channel chimeras.
(A-D) IF analysis using anti-FLAG (red) and anti-Giantin (green) antibodies of permeabilized huh-7.5 cells infected with an MOI of 5 of (A) FLAG-6K SINV, (B) FLAG-Vpu SINV, (C) FLAG-M2 SINV, or (D) FLAG-P7 SINV. Cells were fixed at 12 hpi. Regions of interest are marked and enlarged to the right as separate channels. Fluorescent profiles of the lined areas are displayed at the bottom. Distance is in μm and intensity is in arbitrary fluorescence units (AFU).
Subcellular localization of 6K in infected cells.
(A) Schematic of the miniSOG-6K SINV construct. The sequence encoding the fluorescent protein miniSOG was cloned into WT toto64 after Thr2 of 6K as an N-terminal fusion. (B) Western blot analysis of the cell lysates from BHK-15 cells infected with WT SINV or miniSOG-6K SINV. The blot was probed with an anti-E2 primary antibody to detect the structural polyprotein processing intermediates. (C-E) Representative images of BHK-15 cells transfected with mCherry-SEC61B-C1 (red) (C), mTagBFP2-SiT-N-15 (blue) (D), or CP-E3-mCherry-E2-6K/TF-E1 (red) (E), and infected with miniSOG-6K SINV (green). Imaging was performed at 12 hpi. Regions of interest are marked and enlarged to the right as separate channels. Images correspond to videos (S3–S5 Videos) (F-G) Representative images of BHK-15 cells electroporated with RNA corresponding to the dual-labeled mCherry-E2/miniSOG SINV (mCherry-E2 is red and miniSOG-6K is green) (F) or ΔTF mCherry-E2/miniSOG SINV (mCherry-E2 is red and miniSOG-6K is green) (G) and imaged at 12 hpi Images correspond to videos (S6 and S7 Videos).
Localization of 6K and the ion channel chimeras.
(A-D) IF analysis using anti-FLAG (red) and anti-Giantin (green) antibodies of permeabilized huh-7.5 cells infected with an MOI of 5 of (A) FLAG-6K SINV, (B) FLAG-Vpu SINV, (C) FLAG-M2 SINV, or (D) FLAG-P7 SINV. Cells were fixed at 12 hpi. Regions of interest are marked and enlarged to the right as separate channels. Fluorescent profiles of the lined areas are displayed at the bottom. Distance is in μm and intensity is in arbitrary fluorescence units (AFU).
Ion channel activity of 6K is critical for the biogenesis of virus-induced CPV-II structures
To determine the functional role of ion channel activity in the virus-infected cells, we performed TEM analyses of WT and mutant SINV infected cells at 12 hpi (Fig 6). Given the functional role of 6K in the secretory pathway, we hypothesized that 6K might be involved in the formation of virus-induced structures, particularly originating from the Golgi apparatus. We detected replication structures CPV-Is and budding viruses in all the tested samples (Figs 6 and S5). The type II cytopathic vacuoles CPV-IIs with single- and double-membrane were observed in cells infected with WT, Vpu SINV, and M2 SINV (Fig 6A, 6C and 6D). However, we did not detect CPV-II structures in cells infected with Δ6K SINV or P7 SINV in multiple images screened (n = 60) (Fig 6B and 6E). We also confirmed that the absence of CPV-IIs was not due to the lack of TF, as none of the ion channel chimeras is producing TF proteins. Together, our TEM analyses reveal a unique molecular role of 6K in the biogenesis of CPV-IIs in SINV infected cells, which correlated with a functional ion channel in the Golgi apparatus.
Fig 6
Ion channel activity of 6K is required for the biogenesis of CPV-IIs.
TEM analysis of BHK-15 cells. Cells were infected with WT SINV (A), Δ6K SINV (B), M2 SINV (C), Vpu SINV (D), or P7 SINV (E), and fixed at 12 hpi. Uninfected cells (F) were used as a control. Black arrowheads indicate CPV-Is, and white arrowheads indicate CPV-IIs. The scale bars are shown in each panel of the figure.
Ion channel activity of 6K is required for the biogenesis of CPV-IIs.
TEM analysis of BHK-15 cells. Cells were infected with WT SINV (A), Δ6K SINV (B), M2 SINV (C), Vpu SINV (D), or P7 SINV (E), and fixed at 12 hpi. Uninfected cells (F) were used as a control. Black arrowheads indicate CPV-Is, and white arrowheads indicate CPV-IIs. The scale bars are shown in each panel of the figure.
Inhibition of 6K and ion channel chimeras using channel blocking drugs
Given that the ion channel activity is required for alphavirus glycoprotein trafficking and virus release, we next investigated whether inhibiting the ion channel activity using established channel blockers will reduce virus titers from WT and ion channel chimeras. Since P7 was not localizing to the Golgi, we proceeded with M2 and Vpu chimeras for the channel blocking experiments. We tested amantadine and hydroxy methylene amiloride (HMA), channel blockers inhibiting influenza M2 and HIV Vpu, respectively. Cytotoxicity of these drugs at different concentrations was determined using alamarBLUE (Fig 7A and 7B). Our observations presented here suggest that amantadine reduces M2 SINV virus titer by 1-log at 0.5 mM concentration, whereas at the same concentration, amantadine treatment resulted in less than a log reduction in WT and Vpu SINV titers (Fig 7C). HMA effectively reduced the WT SINV and Vpu SINV in a concentration-dependent manner, resulting in a 2-log reduction for WT SINV and a 1.2-log reduction for Vpu SINV at a 40 μM concentration. On the contrary, M2 SINV was not significantly inhibited by HMA treatment resulting only in a less than a half-log reduction when treated with a 40 μM of the drug (Fig 7D). This demonstrates a strict correlation between the type of ion channel and their specific inhibitor in the SINV chimera and that 6K is functionally analogous to the ion channel Vpu than M2 suggesting 6K as a potential antiviral target.
Fig 7
Effect of HMA and amantadine on virus release from SINV and ion channel chimeras.
(A-B). Cytotoxicity of Amantadine (A) and HMA (B) was calculated using alamarBLUE reagent (C-D). BHK-15 cells were pretreated with the corresponding concentrations of HMA and Amantadine for 24 h and then infected with WT or 6K mutant viruses at an MOI of 0.1. Viral titers were determined using the supernatants collected at 12 hpi. Data shown are from three independent experiments. Error bars indicate standard error of mean (SEM). Significance was determined using Dunnett’s multiple comparisons test as part of one-way ANOVA with a 95% confidence interval. p Values were considered significant when p < 0.05 (*), p < 0.01 (**), p < 0.001(***), and p < 0.0001(****). ns indicates “not significant”.
Effect of HMA and amantadine on virus release from SINV and ion channel chimeras.
(A-B). Cytotoxicity of Amantadine (A) and HMA (B) was calculated using alamarBLUE reagent (C-D). BHK-15 cells were pretreated with the corresponding concentrations of HMA and Amantadine for 24 h and then infected with WT or 6K mutant viruses at an MOI of 0.1. Viral titers were determined using the supernatants collected at 12 hpi. Data shown are from three independent experiments. Error bars indicate standard error of mean (SEM). Significance was determined using Dunnett’s multiple comparisons test as part of one-way ANOVA with a 95% confidence interval. p Values were considered significant when p < 0.05 (*), p < 0.01 (**), p < 0.001(***), and p < 0.0001(****). ns indicates “not significant”.
Discussion
Viral ion channels contribute to different stages in the virus life cycle, including entry, genome replication, and assembly; however, their primary role is to participate in virion morphogenesis and release from infected cells [42]. The structure and function of integral oligomeric bundles formed by the ion channels encoded by several clinically important enveloped viruses, including influenza A virus matrix protein 2 (M2) [70], hepatitis C virus p7 [71], HIV-1 viral protein U (Vpu) [72], and SARS-CoV-2 envelope protein E (E) [73] have been characterized. Alphavirus 6K has been shown to have weak ion selectivity and the ability to induce leakage of solutes into and out of the cell across a sealed membrane similar to the hexameric ion channel of HCV p7 [71] and the pentameric channel of SARS-CoV-2 envelope small membrane protein (E) [73]. Although 6K has been shown to modulate the intracellular membrane permeability and interact with spike proteins to promote spike maturation, the three-dimensional structure and the mechanism by which it imparts a significant role in the alphavirus life cycle remain unknown [74]. Furthermore, the TF protein produced by a (−1) programmed ribosomal frameshifting in a heptanucleotide slip site in the 6K coding region is incorporated into the virion [37,75,76]. Although TF has been shown to be incorporated into purified SINV particles [30], its structural organization in the virion has not been resolved even in the 3.5 Å cryo-EM structure of SINV [24], presumably due to its low stoichiometric packaging [32,77].To characterize the mechanism by which 6K exerts its function on the alphavirus lifecycle, we generated a mutant SINV, Δ6K SINV, containing an in-frame deletion of 6K and TF (Fig 1A). Comparable to what has been reported for RRV and SFV, the absence of 6K negatively affected the production of SINV (Fig 1D) [31,78]. Previously, using pulse-chase experiments and surface biotinylation, SFV 6K has been shown to be dispensable for the heterodimerization of the pE2 (E3-E2) and E1, spike membrane protein transport to the cell surface, and virus production [79]. By contrast, we quantitatively show that the Δ6K SINV is defective in glycoprotein transport to the plasma membrane in BHK-15 and C6/36 cells using live-imaging and IF analyses (Figs 2 and S3). These spike glycoproteins that are defective in transport to the cell surface also accumulate on large cytoplasmic vesicles in the perinuclear regions in the Δ6K SINV infected cells. Thus, our glycoprotein trafficking results agree with previous reports that showed impaired glycoprotein trafficking in two SINV 6K mutants when 15 amino acids were inserted at position 29 of or 24–45 amino acids were deleted [36,80]. As previously observed for 6K deletions in other alphaviruses, our observations presented here suggest that the furin cleavage of pE2 into E3 and E2 was not inhibited in Δ6K SINV (Fig 3C). However, the cleavage is delayed presumably due to defects in glycoprotein trafficking to the Trans-Golgi network where the furin cleavage occurs [81,82]. These results suggest that the delay in glycoprotein trafficking to the plasma membrane in Δ6K SINV is not due to the defects in envelope glycoprotein processing but due to the lack of an essential function carried out by 6K in the secretory pathway.The ion channel activity of bacterially expressed 6K and recombinant 6K have been studied previously. 6K has been shown to form cation-selective ion channels when inserted into planar lipid bilayers [38,39], by a conserved transmembrane helix (S1 Fig) which is shared between both 6K and TF [32]. To investigate whether the defects caused by the absence of 6K are due to the lack of a functional ion channel, we generated a P7 SINV chimera expressing full-length P7 in place of 6K. We chose P7 since the membrane topologies of 6K, and P7 are similar, with their N and C termini oriented towards the ER lumen [83,84]. Although P7 SINV showed a 10-fold higher titer compared to Δ6K SINV, it formed small plaques, and virus titers were ~1000 fold reduced compared to the WT virus, suggesting that HCV P7 is not adequate to replace 6K functionally (Fig 1D). We next substituted the ion channel TM helix of 6K with the TM helix of HIV Vpu and Inf M2. Unlike 6K, the C-termini of both M2 and Vpu orient to the cytoplasmic side. Although more efficient than P7 SINV, the M2 SINV was not as effective in rescuing the defects in virus growth kinetics and titer compared to Vpu SINV. Comparing the results from all the viral ion channels tested indicates that Vpu is the most efficient in restoring WT-like growth kinetics (Fig 1D). As evidenced from the flow cytometry and IF analyses, M2 and P7 are not as efficient as Vpu in complementing glycoprotein trafficking defects observed in the absence of 6K. A full-length Vpu expressed in trans under a double subgenomic promoter in SINV has previously been shown to partly rescue the defects caused by a partial deletion of 6K [36]. Corroborating these findings, our results also demonstrate that the Vpu ion channel TM helix alone in cis is sufficient to rescue glycoprotein transport to the plasma membrane and SINV release, also indicating that the ion channel activity of 6K is functionally analogous to Vpu. Interestingly, recent biochemical and computational studies proposed a novel topological model for the alphavirus structural polyprotein in which 6K has a single pass transmembrane helix similar to Vpu [85,86]. The inability of Vpu to completely restore virus budding could be due to the absence of TF from the chimeric virus as previous studies showed that TF is essential for SINV infectious particle release [37]. Additionally, the absence of 6K could also be affecting virus budding since studies showed that 6K mediates E2-CP interactions during alphavirus budding [87].Given that a functional ion channel activity is critical for promoting SINV release, we pursued to determine the subcellular localization of 6K in live cells during virus infection. Previously, IF analyses of RRV infected cells [78] and studies using 6K expression constructs have shown that 6K mainly localizes to the ER [37,88]. Here, we show the colocalization of Flag-tagged 6K with the Golgi marker Giantin. Both Vpu and M2 displayed similar colocalization to Giantin, whereas P7 did not colocalize with Giantin, and was primarily localized to ER (Figs 5 and S4). The ER retention of P7 possibly explains its deficiency in functional complementation compared to Vpu and M2. Subsequently, we inserted a pH tolerant small fluorescent miniSOG tag at the N-terminus of 6K for real-time imaging [54]. Utilizing the miniSOG-6K SINV along with cellular markers in real-time live-cell imaging we identified that in addition to being present in the ER, 6K traffics to the late secretory pathway localizing to dynamic vesicles (Fig 5). To evaluate the colocalization of 6K and E2 in the secretory pathway specifically on the dynamic vesicles that contain 6K, we generated a dually labeled mCherry-E2 and miniSOG-6K SINV. Upon infection of BHK cells, we found that 6K colocalizes with E2 on ER, Golgi, and highly dynamic vesicles in the secretory pathway using live imaging (Fig 5). CHIKV 6K protein expression studies have shown the colocalization of 6K and E2 in the secretory pathway and the trafficking of 6K is influenced by the presence of E2 [88].We next tested whether the localization of Flag 6K and miniSOG 6K in the TGN is exclusively due to the presence of TF protein which has been reported to be packaged into virions. We mutated the ribosome slip site from the mCherry-E2/miniSOG-6K SINV to stop the production of TF protein. 6K localized to E2-positive post-Golgi vesicles in the absence of TF, indicating that 6K traffics to the TGN along with E2 (Fig 5). Furthermore, we detected the localization of 6K along with E2 on the limiting membranes of large E2-positive vacuoles in C6/36 cells infected with the dual-labeled SINV (S3 Fig). These static vacuoles that are intermediates of CPV-Is and CPV-IIs observed in mammalian cells are also the site of virus budding in mosquito cells [15]. MiniSOG-6K was also detected in smaller E2-positive dynamic vesicles presumably containing internally budded virions trafficking to the plasma membrane. Although we have not tested TF localization in the absence of 6K, our findings do not exclude the possibility that TF can also be localizing to post-Golgi vesicles since both TF and 6K were detected on the plasma membranes of cells infected with SFV [32]. Despite this very compelling evidence for localization of 6K on the internal membranes in the secretory pathway, our live-imaging data did not reveal an accumulation of 6K on the plasma membrane. This discrepancy could be due to the possibility that 6K is present in very few copies at substoichiometric level compared to E2 at the plasma membrane [29].We set out to identify the existence of virus-induced structures and sites of virus budding in BHK cells infected with WT and mutant SINV using TEM. Whereas CPV-Is and budding viruses were detected in all samples analyzed, CPV-IIs were not detected in some of the mutant viruses. Vpu SINV, and M2 SINV showed the presence of CPV-II. However, these structures were not found in cells infected with Δ6K SINV and P7 SINV (Fig 6). The absence of CPV-II observed for Δ6K SINV, and P7 SINV demonstrates a strict correlation between CPV-II formation and the presence of an ion channel in the TGN. In the case of P7, this could be due to its restricted localization to the ER membrane where the replication and assembly of HCV occur [89,90]. Furthermore, it may be because p7 activity is regulated by its specific interaction with HCV non-structural protein 2 (NS2), which is absent in our system [91]. Additionally, unlike P7, 6K traffics to the TGN from the ER membrane and reaches the late secretory pathway, where it has a functional role in inducing the production of CPV-IIs. [89,92]. Since CPV-IIs originate from the medial/trans-Golgi [19], Golgi fragmentation may contribute to the formation of CPV-IIs [20]. Virus-induced Golgi fragmentation was previously reported for positive-sense RNA viruses such as picornaviruses and coronaviruses [93-95]. Interestingly, in the case of coronaviruses, Golgi fragmentation is induced by the accessory protein open reading frame 3a (ORF3a) which assembles into tetrameric ion channels [96-98]. Additionally, disruption of the pH gradient in the secretory pathway and the increase in intracellular calcium levels can affect the integrity of the Golgi apparatus [99-101]. Collectively, our results demonstrate that the ion channel activity of 6K or the presence of a functional ion channel at the TGN is required for the biogenesis of CPV-IIs.HCV p7 and IAV M2 have been shown to reduce the acidification of intracellular vesicles and cellular organelles [43,102]. A significant role of M2 is to protect influenza virus envelope protein hemagglutinin (HA) from premature conformational changes as it transits through the low-pH compartments in the exocytic pathway to the plasma membrane [103]. M2 plays a subtle role in regulating the pH of the transport pathway as it can increase the vesicular pH by as much as 0.8 pH units to protect the structural integrity of HA [104]. It has been proposed that the ion channel activity of M2 regulates the pH balance between the acidic lumen of TGN and the pH of the cytoplasm to protect HA from premature low-pH-induced conformational changes in the TGN [103]. Our results strongly support attributing a similar function to 6K, where after the furin cleavage of pE2 in the TGN, the ion channel activity of 6K protects the glycoprotein spikes from a low pH mediated rearrangement of E1, leading to premature fusion in TGN [105,106]. Similarly, Vpu, a multimer in the native state, affects membrane conductance by modulation of endogenous ion channels [107]. Furthermore, HIV-1 Vpu modifies the activity of cellular K+ channel TASK-1 to promote virus release [108]. Thus far, alphavirus 6K has not been shown to regulate the activity of any host ion channels; it remains a possible mechanism of 6K function. However, viroporins can induce efflux of ions, such as H+ and Ca2+, that move from their intracellular stores in the ER and the Golgi apparatus into the cytoplasm following a strong electrochemical gradient, altering the pH and calcium homeostasis in ER and Golgi [109]. Since Ca2+ is required for membrane fusion events, its leakage can cause inhibition of anterograde vesicle trafficking [110]. The viral ion channel enterovirus 2B protein has been shown to reduce the ER and Golgi complex Ca (2+) levels and inhibit protein trafficking through the Golgi complex, presumably by forming transmembrane pores [109]. Therefore, ion channel activity of 6K might lead to reduced Ca(2+) levels in the ER and Golgi complex, causing the inhibition of CPV-II formation and glycoprotein transport as observed in Δ6K SINV.Amantadine and HMA are effective pharmacological inhibitors that significantly reduce the production of virions by inhibiting the viral ion channel activity. Amantadine, a drug that targets the ion channel activity binds M2 protein at the N-terminal lumen of the channel blocking ion conductance [50,92,111]. Previous studies showed that Amantadine can inhibit the release of CHIKV particles [88]. HMA has been shown to inhibit HIV-1 by binding and blocking the Vpu channel activity [52,112-114]. We hypothesized that the ion channel chimeras would be sensitive to their specific channel inhibitors, blocking the channel activity and reducing virus titers. Therefore, we tested amantadine and HMA in virus inhibition studies. We found that HMA can inhibit virus release from BHK cells infected with WT SINV or the chimeric Vpu SINV, whereas M2 SINV was not significantly inhibited by HMA treatment (Fig 7). Based on the WT-like growth kinetics of Vpu SINV and inhibition of virus release by channel blocking drug HMA, we propose that the oligomeric state of 6K and its ion channel conductance are similar to that of HIV-1 Vpu. Our results also indicate that the oligomeric state of 6K may be different from the tetrameric M2 ion channels structurally a less favorable oligomeric arrangement for 6K.In this study, we provide the spatial and temporal organization of 6K and attribute the functional significance of the ion channel activity of 6K to virus assembly. We show that efficient glycoprotein trafficking to the plasma membrane and CPV-II formation are dependent on the presence of a functional ion channel in the TGN. CPV-IIs are also associated with glycoprotein trafficking to the plasma membrane; thus, investigating the functional role of ion channels in the reorganization of the secretory pathway in cells infected with alphaviruses can shed more light on the role of CPV-IIs in alphavirus assembly and budding. We also show that 6K localizes to the TGN, which colocalizes with E2. Our observations suggest that 6K is functionally similar to the HIV-1 Vpu, and its ion channel activity can be inhibited by HMA, an effective drug against Vpu. These findings open new avenues for therapeutic intervention strategies based on rational drug design of 6K ion channel inhibitors. Virus release was only partially rescued by the other ion channels used in this study, indicating that 6K may have other functions, such as interaction with other viral and host proteins. Determining the monomeric and oligomeric structures of 6K will facilitate our understanding of the mechanism of ion channel activity and the other possible functions of this essential protein.
Multiple sequence alignment of 6K protein from alphaviruses.
Alignment files were generated using CLUSTAL omega and sequence alignments were viewed using Jalview.(JPG)Click here for additional data file.
Flow plot of flow cytometry.
Representative flow charts of cells infected with WT or 6K mutant viruses at an MOI of 5. Cells were incubated with a monoclonal anti-E2 antibody followed by staining with FITC secondary antibody.(JPG)Click here for additional data file.
Live-cell imaging of C6/36 cells.
(A-B). Representative images of C6/36 cells infected with mCherry-E2 SINV (red) or Δ6K mCherry-E2 SINV (red) and imaged at 24 hpi. (C-D). Representative images of C6/36 cells infected with the dual-labeled mCherry-E2/miniSOG SINV (red and green) (C) or the ΔTF mCherry-E2/miniSOG SINV (red and green) (D) and imaged at 24 hpi.(JPG)Click here for additional data file.IF analysis using anti-FLAG antibody of permeabilized BHK-15 cells transfected with mEmerald-SEC61B-C1 and infected with (A) FLAG-6K SINV, (B) FLAG-Vpu SINV, (C) FLAG-M2 SINV, or (D) FLAG-P7 SINV. Cells were fixed at 12 hpi. (E) Plaque assays of WT and Flag-tagged viruses. Data shown are from three independent experiments. Error bars indicate standard error of mean (SEM). Significance was determined by multiple unpaired t-tests of data. p Values were considered significant when p < 0.05 (*), p < 0.01 (**), p < 0.001(***), and p < 0.0001(****). ns indicates “not significant”.(JPG)Click here for additional data file.
Virus budding occurs in cells infected with WT or chimeric viruses.
TEM analysis of BHK-15 cells. Cells were infected with WT SINV (A), Δ6K SINV (B), M2 SINV (C), Vpu SINV (D), P7 SINV (E), or miniSOG-6K SINV (F), and fixed at 12 hpi. White arrowheads indicate budding viruses.(JPG)Click here for additional data file.
Live-cell imaging of BHK-15 cells co-transfected with YFP-membrane (green) and E3-mCherry-E2-6K/TF-E1 (red).
(MP4)Click here for additional data file.Live-cell imaging of BHK-15 cells co-transfected with YFP-membrane (green) and E3-mCherry-E2-E1 (red).(MP4)Click here for additional data file.Live-cell imaging of BHK-15 cells transfected with mCherry-SEC61B-C1 (red) and infected with miniSOG-6K SINV (green). Imaging was performed at 12 hpi.(MP4)Click here for additional data file.Live-cell imaging of BHK-15 cells transfected with mTagBFP2-SiT-N-15 (blue) and infected with miniSOG-6K SINV (green). Imaging was performed at 12 hpi.(MP4)Click here for additional data file.Live-cell imaging of BHK-15 cells transfected with CP-E3-mCherry-E2-6K/TF-E1 (red) and infected with miniSOG-6K SINV (green). Imaging was performed at 12 hpi.(MP4)Click here for additional data file.Live-cell imaging of BHK-15 cells electroporated with RNA corresponding to the dual-labeled mCherry-E2/miniSOG SINV (red and green) and imaged at 12 hours post-electroporation.(MP4)Click here for additional data file.Live-cell imaging of BHK-15 cells electroporated with RNA corresponding to the dual-labeled ΔTF mCherry-E2/miniSOG SINV (red and green) and imaged at 12 hours post-electroporation.(MP4)Click here for additional data file.
List of primers used for mutagenesis and cloning.
(DOCX)Click here for additional data file.21 Jun 2022Dear Dr. Jose,Thank you very much for submitting your manuscript "Requirement of a functional ion channel for alphavirus glycoprotein transport, CPV-II formation, and efficient virus budding." for consideration at PLOS Pathogens. As with all papers reviewed by the journal, your manuscript was reviewed by members of the editorial board and by several independent reviewers. In light of the reviews (below this email), we would like to invite the resubmission of a significantly-revised version that takes into account the reviewers' comments.Elmasri et al find the 6K protein in Sindbis can be replaced by the Vpu protein from HIV, and less so by M2 and p7 from Influenza and HCV, respectively. They go on to propose that 6K and E2 colocalize in the Golgi and these proteins together are responsible for CPV II formation, promoting E2-E1 glycoprotein transport. Finally, they conclude that the ion channel activity of 6K is what is driving CPV II formation and glycoprotein transport. Very little work has been done on 6K and its role as an ion channel, the scientific impact of this research is high. However, as both the reviewers and myself point out, there are some concerns with the conclusions drawn from the results.The major issues addressed by more than one reviewer:1. A majority of the conclusions are based on correlation and no evidence of a direct interaction between 6K and E2. Some suggestions include complementation experiments--will expression of E2 and 6K be enough to form CPV II? Do the chimera viruses also form CPV IIs? Any ideas how ionic flux is mediating CPV II formation and why are these vesicle more likely to transport glycoproteins to the plasma membrane? More suggestions are in the reviewer comments. In addition, better images including more quantification, for both IF colocalization and TEM CPV II formation would strengthen the manuscript.2. Figure 3 is not clear. nor is it complete The text, figure, and legend indicated different constructs being used making drawing conclusons difficult. More analysis on the trafficking of E2 to the plasma membrane is necessary. For example, is E1 produced? does it transit to the plasma membrane? The western blot doesn't show if E1 is produced (side note: The western is with anti-E2 yet Capsid os on the blot).3. Why is Vpu able to replace 6K so efficiently and M2 and p7 cannot? Some further discussion is warranted, even structural predictions of the different putative ion channel proteins. It should also be addressed that recent work has shown 6K might not be two transmembrane helices but rather a single pass TM helix, similar to Vpu. Does the coronavirus E protein substitute for 6K?We cannot make any decision about publication until we have seen the revised manuscript and your response to the reviewers' comments. Your revised manuscript is also likely to be sent to reviewers for further evaluation.When you are ready to resubmit, please upload the following:[1] A letter containing a detailed list of your responses to the review comments and a description of the changes you have made in the manuscript. Please note while forming your response, if your article is accepted, you may have the opportunity to make the peer review history publicly available. The record will include editor decision letters (with reviews) and your responses to reviewer comments. If eligible, we will contact you to opt in or out.[2] Two versions of the revised manuscript: one with either highlights or tracked changes denoting where the text has been changed; the other a clean version (uploaded as the manuscript file).Important additional instructions are given below your reviewer comments.Please prepare and submit your revised manuscript within 60 days. If you anticipate any delay, please let us know the expected resubmission date by replying to this email. Please note that revised manuscripts received after the 60-day due date may require evaluation and peer review similar to newly submitted manuscripts.Thank you again for your submission. We hope that our editorial process has been constructive so far, and we welcome your feedback at any time. Please don't hesitate to contact us if you have any questions or comments.Sincerely,Suchetana MukhopadhyayGuest EditorPLOS PathogensSara CherrySection EditorPLOS PathogensKasturi HaldarEditor-in-ChiefPLOS Pathogensorcid.org/0000-0001-5065-158XMichael MalimEditor-in-ChiefPLOS Pathogens
orcid.org/0000-0002-7699-2064
***********************Elmasri et al find the 6K protein in Sindbis can be replaced by the Vpu protein from HIV, and less so by M2 and p7 from Influenza and HCV, respectively. They go on to propose that 6K and E2 colocalize in the Golgi and these proteins together are responsible for CPV II formation, promoting E2-E1 glycoprotein transport. Finally, they conclude that the ion channel activity of 6K is what is driving CPV II formation and glycoprotein transport. Very little work has been done on 6K and its role as an ion channel, the scientific impact of this research is high. However, as both the reviewers and myself point out, there are some concerns with the conclusions drawn from the results.The major issues addressed by more than one reviewer:1. A majority of the conclusions are based on correlation and no evidence of a direct interaction between 6K and E2. Some suggestions include complementation experiments--will expression of E2 and 6K be enough to form CPV II? Do the chimera viruses also form CPV IIs? Any ideas how ionic flux is mediating CPV II formation and why are these vesicle more likely to transport glycoproteins to the plasma membrane? More suggestions are in the reviewer comments. In addition, better images including more quantification, for both IF colocalization and TEM CPV II formation would strengthen the manuscript.2. Figure 3 is not clear. nor is it complete The text, figure, and legend indicated different constructs being used making drawing conclusons difficult. More analysis on the trafficking of E2 to the plasma membrane is necessary. For example, is E1 produced? does it transit to the plasma membrane? The western blot doesn't show if E1 is produced (side note: The western is with anti-E2 yet Capsid os on the blot).3. Why is Vpu able to replace 6K so efficiently and M2 and p7 cannot? Some further discussion is warranted, even structural predictions of the different putative ion channel proteins. It should also be addressed that recent work has shown 6K might not be two transmembrane helices but rather a single pass TM helix, similar to Vpu. Does the coronavirus E protein substitute for 6K?Reviewer's Responses to QuestionsPart I - SummaryPlease use this section to discuss strengths/weaknesses of study, novelty/significance, general execution and scholarship.Reviewer #1: In this study, Elmarsi et al., look to understand the function of the Sindbis virus (SINV) 6K ion channel. They generate a SINV 6K deletion as well as chimeric viruses with known viral ion channels (very cool!). They show that 6K is required for virion production and glycoprotein trafficking to the plasma membrane. In addition, they found that Vpu can rescue virion production and E2 trafficking. Using live cell imaging, they show that the SINV E2 accumulates in the secretory pathway when 6K is absent, and that 6K localizes to the secretory pathway. TEM experiments show differences in CPV structures. Finally, they show that SINV is sensitive to the known Vpu inhibitor HMA suggesting that 6K is similar to Vpu and an antiviral target.Together, this is a well-written study that provides new insight into SINV biology and begins to elucidate the role of 6K in SINV infection. However, there are several concerns regarding the study including experiments and the conclusions drawn.Reviewer #2: The manuscript by Elmasri et al. analyzes a prominent member of the viroporin family – the 6K protein from alphaviruses. While the importance of 6K in the life cycle of alphaviruses is somewhat well established, the exact requirement for the ion channel activity is not understood. The authors have generated several chimeras by combining or replacing 6K in SINV by viroporins from other families like HCV p7, Influenza M2 and HIV Vpu, and tested their effect on virus particle production and infectivity, glycoprotein trafficking and other cellular phenomenon like formation of Type II CPVs. The comments and concerns regarding this work are as follows:Major points:1) The main findings of the study are a correlation between the availability of an effective ion channel activity, and the formation of type-II cytopathic vacuoles, which in turn correlates with spatiotemporally correct glycoprotein trafficking and virus particle release. The primary results are correlation based, and no direct interactions/effects are shown in the manuscript, which is a major flaw. For example, is there any direct interaction between the glycoprotein E2 and 6K/6K substitutes during infection or under in vitro conditions? This appears a very important point to establish the role of 6K in promoting glycoprotein trafficking.2) Also, what about the transport of E1? Do the constructs used in the study - E3-mCherry-E2-E1 and E3-mCherry-E2-6K/TF-E1 - have a cleavage site before E1? If so, the live cell imaging panel cannot ascertain where E1 is ending up since the tag is on E2.3) The authors find that Vpu closely mimics the functionality of 6K, followed by M2, and finally p7, which does not appear to be functionally close to 6K even though its membrane topology is closest to that of 6K. This anamoly is not probed further. In terms of sequence or predicted secondary or tertiary structural elements, is 6K closer to Vpu/M2 compared to p7?4) Does overexpression of 6K or 6K+E2 in cells result in the formation of CPV-II, or does it only happen during SINV infection – this may point to the involvement of other viral proteins/RNA in the process?5) The manuscript mentions the differences in virus titre and specific infectivity of virus particles generated upon 6K deletion or 6K replacement with chimeric components. It will be great if this information is provided on the same scale (log vs fold decrease). A 2.8 fold decrease in specific infectivity of particles without 6K suggests that the defect is not only in release, but also in the assembled particles themselves. In this context, it is important to morphologically characterize SINV particles without 6K, or those containing 6K chimeras, in comparison to WT particles. This will add important information to the study.6) Finally, there appears to be some difference in the behavior of alphaviruses with 6K deleted, as well as the susceptibility of 6K from different alphaviruses to drugs/inhibitors. How similar are the alphavirus 6K proteins in terms of sequence or structure?7) Along the same lines, it will be helpful to include the established roles of M2/Vpu/p7 in the life cycles of the respective viruses in the Introduction/Discussion for purposes of comparison to 6K.Minor point:The manuscript includes substantial experimental details in the Discussion section. The Results and Discussion sections should be reorganized for clarity.Reviewer #3: The manuscript: Requirement of a functional ion channel for alphavirus glycoprotein transport, CPV-II formation, and efficient virus budding, but Elmasri, Negi, Kuhn, and Jose, uses a variety of imaging and chimeric virus methodologies to provide an in depth characterization of the functional role of the viral 6K protein's ion pore activity in virion maturation and budding. While the pore forming activity of the alphavirus 6K protein, and its potential as an antiviral target has been well recognized within the alphavirus field, the specific stages in the viral lifecycle where ion channel activity acts have not been well characterized. Therefore, the study is important, and in general, the manuscript is well written, the experiments are well done, and the authors' conclusions are supported by the data. However, as noted below, there are some concerns that should be addressed to provide further support for the authors' conclusions, clarify discrepancies in the manuscript, or make it easier for the reader to follow.**********Part II – Major Issues: Key Experiments Required for AcceptancePlease use this section to detail the key new experiments or modifications of existing experiments that should be absolutely required to validate study conclusions.Generally, there should be no more than 3 such required experiments or major modifications for a "Major Revision" recommendation. If more than 3 experiments are necessary to validate the study conclusions, then you are encouraged to recommend "Reject".Reviewer #1: 1. A major concern is that, as the authors state throughout the paper, functional studies of 6K have been completed in SFV. The authors have nicely compared their work to these previous works and shown that SINV is different than SFV. This finding is very cool and a comparative analysis of SFV in this paper would have been interesting. Nonetheless, as written, this paper is SINV specific and the authors should replace “alphavirus” throughout the paper, including the title, with SINV.2. Figure 1D shows a 1-step growth curve yet the y-axis is a “rate of virus release”. Can the authors also show the actual growth curve titers over time in the figure? I think it would be much easier to interpret this way. From the current figure, even the 6K deletion is pumping out 10K viruses/ml/hr. That seems like a lot still. Moreover, when comparing Figure 1 to Figure 7, WT, Vpu, and M2 viruses grow similarly in Figure 7 at MOI 0.1 (no drug) yet there are very different in Figure 1 (MOI = 5). Can the authors comment on these differences?3. Figure 3. A few points: A) The text states that these experiments are in the absence of capsid (Line 368-369) yet the figure and figure legend states that capsid is present. Can you confirm which is correct? These are important for your conclusion on line 373.B) It is hard to see differences in Figure 3C. Can you use the membrane marker to make this clearer? Also, are there less filopodia in the delta6K virus? Could this be a phenotype?C) The protein processing is interesting. However, to conclude that the phenotype is not due to processing, I think showing complementation would strengthen your argument. Can you express 6K in trans (as you can with Vpu) and show that processing is restored? Or use the Vpu chimera virus?4. All of your BHK experiments are completed in 12 hours. Could timing be an issue for the 6K mutant? Throughout the manuscript you use the word “Delayed” which implies time. If you waited longer, do you get more processing of the proteins in Figure 3D?5. Figure 4: Here you use two tagged viruses that seem to behave very differently. In Figure 4E, the 6K and E2 are punctate and then in Figure 4F 6K and E2 are diffuse and seem to be on filopodia. While I don’t doubt 6K is in the secretory pathway, you may have different results for E2 (different compartments) depending on the system? Can you use the dual tagged virus with ER or golgi markers? Also, what does the protein processing or virion production look like in the dual tagged virus? Is it restored?6. The conclusion about CPV formation is interesting but I think more work needs to be done on this section. The TEM images are hard to see and interpret. I suggest zooming in and using some of your trans systems to prove your point. Regardless, this needs significant work for this submission.7. Your inhibitor experiment is awesome and an amazing tool to dissect the function of 6K in the absence of a deletion (which could have bigger issues). I think looking at protein processing, E2 trafficking, and CPV formation in the presence of HMA would add significantly to your conclusions.Reviewer #2: 1) Analysis of direct binding of 6K to E2, under in vitro conditions or during co-expression in cells/infection2) Same for 6K and E13) Formation of CPV-II in cells during overexpression of 6K/co-expression of 6K with viral proteins4) Bioinformatics based comparative study of viroporins used in the manuscript5) Morphological analysis of SINV particles with 6K deleted/6K chimerasReviewer #3: 1) If ion channel activity is the driver of CPV-II formation, HMA (or amantadine) treatment would be expected to inhibit CPV-II, but not CPV-I formation. This should be tested and the data included in the study, or if the results are negative, discussed.2) The electron microscope data from Fig. 6 should be quantified (e.g. total number of CPV-I and CPV-II per number of fields) for each virus/mutant.3) Given that several of the constructs show delays in processing, the authors may want to soften some of their language ruling out any effect of processing kinetics on their phenotypes, or more clearly lay out why this is not an issue.**********Part III – Minor Issues: Editorial and Data Presentation ModificationsPlease use this section for editorial suggestions as well as relatively minor modifications of existing data that would enhance clarity.Reviewer #1: (No Response)Reviewer #2: A thorough discussion of the sequential/structural differences between 6K proteins from different alphavirusesComparison of the roles of M2/Vpu/p7 in the respective viral life cyclesReorganisation of the Discussion sectionReviewer #3: a) The authors should consider moving Supplemental Table 2 into Figure 1 to make the data more accessible to the reader.b) For Fig. 2A, please clarify which fluorophore (green vs red) is used for E2 vs CP to make is easier for non-expert readers to follow.c) For Fig. 2c, representative flow plots should be included as supplemental data.d) Please check the label on the image for Fig. 3B for accuracy. Based on the text it should be CP-E3-mCherryE2-E1, but on the image it is CP-E3-mCherryE2-6K/TF-E1.e) When discussing ion channel inhibitors as antivirals, please include discussion of reference 77 (Dey, et al), since that study evaluated amantadine's effects on chikungunya virus.**********PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.If you choose “no”, your identity will remain anonymous but your review may still be made public.Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.Reviewer #1: NoReviewer #2: NoReviewer #3: NoFigure Files:While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, . PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email us at .Data Requirements:Please note that, as a condition of publication, PLOS' data policy requires that you make available all data used to draw the conclusions outlined in your manuscript. Data must be deposited in an appropriate repository, included within the body of the manuscript, or uploaded as supporting information. This includes all numerical values that were used to generate graphs, histograms etc.. For an example see here on PLOS Biology: http://www.plosbiology.org/article/info%3Adoi%2F10.1371%2Fjournal.pbio.1001908#s5.Reproducibility:To enhance the reproducibility of your results, we recommend that you deposit your laboratory protocols in protocols.io, where a protocol can be assigned its own identifier (DOI) such that it can be cited independently in the future. Additionally, PLOS ONE offers an option to publish peer-reviewed clinical study protocols. Read more information on sharing protocols at https://plos.org/protocols?utm_medium=editorial-email&utm_source=authorletters&utm_campaign=protocols8 Aug 2022Submitted filename: Cover letter with response-8-8.docxClick here for additional data file.21 Sep 2022Dear Dr. Jose,We are pleased to inform you that your manuscript 'Requirement of a functional ion channel for Sindbis virus glycoprotein transport, CPV-II formation, and efficient virus budding' has been provisionally accepted for publication in PLOS Pathogens.Before your manuscript can be formally accepted you will need to complete some formatting changes, which you will receive in a follow up email. A member of our team will be in touch with a set of requests.Please note that your manuscript will not be scheduled for publication until you have made the required changes, so a swift response is appreciated.IMPORTANT: The editorial review process is now complete. PLOS will only permit corrections to spelling, formatting or significant scientific errors from this point onwards. Requests for major changes, or any which affect the scientific understanding of your work, will cause delays to the publication date of your manuscript.Should you, your institution's press office or the journal office choose to press release your paper, you will automatically be opted out of early publication. We ask that you notify us now if you or your institution is planning to press release the article. All press must be co-ordinated with PLOS.Thank you again for supporting Open Access publishing; we are looking forward to publishing your work in PLOS Pathogens.Best regards,Suchetana MukhopadhyayGuest EditorPLOS PathogensSara CherrySection EditorPLOS PathogensKasturi HaldarEditor-in-ChiefPLOS Pathogensorcid.org/0000-0001-5065-158XMichael MalimEditor-in-ChiefPLOS Pathogens
orcid.org/0000-0002-7699-2064
***********************************************************The authors have sufficiently addressed the points raised by the reviewers.Reviewer Comments (if any, and for reference):29 Sep 2022Dear Dr. Jose,We are delighted to inform you that your manuscript, "Requirement of a functional ion channel for Sindbis virus glycoprotein transport, CPV-II formation, and efficient virus budding," has been formally accepted for publication in PLOS Pathogens.We have now passed your article onto the PLOS Production Department who will complete the rest of the pre-publication process. All authors will receive a confirmation email upon publication.The corresponding author will soon be receiving a typeset proof for review, to ensure errors have not been introduced during production. Please review the PDF proof of your manuscript carefully, as this is the last chance to correct any scientific or type-setting errors. Please note that major changes, or those which affect the scientific understanding of the work, will likely cause delays to the publication date of your manuscript. Note: Proofs for Front Matter articles (Pearls, Reviews, Opinions, etc...) are generated on a different schedule and may not be made available as quickly.Soon after your final files are uploaded, the early version of your manuscript, if you opted to have an early version of your article, will be published online. The date of the early version will be your article's publication date. The final article will be published to the same URL, and all versions of the paper will be accessible to readers.Thank you again for supporting open-access publishing; we are looking forward to publishing your work in PLOS Pathogens.Best regards,Kasturi HaldarEditor-in-ChiefPLOS Pathogensorcid.org/0000-0001-5065-158XMichael MalimEditor-in-ChiefPLOS Pathogensorcid.org/0000-0002-7699-2064
Authors: Thomas E Morrison; Lauren Oko; Stephanie A Montgomery; Alan C Whitmore; Alina R Lotstein; Bronwyn M Gunn; Susan A Elmore; Mark T Heise Journal: Am J Pathol Date: 2010-12-23 Impact factor: 4.307
Authors: Haley R Harrington; Matthew H Zimmer; Laura M Chamness; Veronica Nash; Wesley D Penn; Thomas F Miller; Suchetana Mukhopadhyay; Jonathan P Schlebach Journal: J Biol Chem Date: 2020-03-13 Impact factor: 5.157
Authors: Fábio Madeira; Matt Pearce; Adrian R N Tivey; Prasad Basutkar; Joon Lee; Ossama Edbali; Nandana Madhusoodanan; Anton Kolesnikov; Rodrigo Lopez Journal: Nucleic Acids Res Date: 2022-04-12 Impact factor: 19.160