Proteome and morphological analysis show unexpected differences between promastigotes of Leishmania amazonensis PH8 and LV79 strains.

BACKGROUND: Leishmaniases are diseases caused by Leishmania protozoans that affect around 12 million people. Leishmania promastigotes are transmitted to vertebrates by female phlebotomine flies during their blood meal. Parasites attach to phagocytic cells, are phagocytosed and differentiate into amastigotes. We previously showed that PH8 and LV79 strains of Leishmania amazonensis have different virulence in mice and that their amastigotes differ in their proteomes. In this work, we compare promastigotes' infectivity in macrophages, their proteomes and morphologies. METHODS/PRINCIPAL
FINDINGS: Phagocytosis assays showed that promastigotes adhesion to and phagocytosis by macrophages is higher in PH8 than LV79. To identify proteins that differ between the two strains and that may eventually contribute for these differences we used a label-free proteomic approach to compare promastigote´s membrane-enriched fractions. Proteomic analysis enabled precise discrimination of PH8 and LV79 protein profiles and the identification of several differentially abundant proteins. The proteins more abundant in LV79 promastigotes participate mainly in translation and amino acid and nucleotide metabolism, while the more abundant in PH8 are involved in carbohydrate metabolism, cytoskeleton composition and vesicle/membrane trafficking. Interestingly, although the virulence factor GP63 was more abundant in the less virulent LV79 strain, zymography suggests a higher protease activity in PH8. Enolase, which may be related to virulence, was more abundant in PH8 promastigotes. Unexpectedly, flow cytometry and morphometric analysis indicate higher abundance of metacyclics in LV79.
CONCLUSIONS/SIGNIFICANCE: Proteome comparison of PH8 and LV79 promastigotes generated a list of differential proteins, some of which may be further prospected to affect the infectivity of promastigotes. Although proteomic profile of PH8 includes more proteins characteristic of metacyclics, flow cytometry and morphometric analysis indicate a higher abundance of metacyclics in LV79 cultures. These results shed light to the gaps in our knowledge of metacyclogenesis in L. amazonensis, and to proteins that should be studied in the context of infection by this species.

Introduction

Leishmaniases are diseases caused by more than 20 species of Leishmania from Leishmania and Viannia subgenera. According to WHO, 98 countries are endemic for leishmaniasis, which can be classified according to its clinical manifestations into tegumentary (TL) and visceral (VL) forms, endemic in 89 and 79 countries, respectively [1].

The clinical form and severity of the disease depend on the parasite species and isolate, as well as vector and mammalian host characteristics [2-4]. Leishmania infantum and Leishmania donovani are the most frequent etiologic agents of VL, the systemic and most severe form of the disease. Many species may cause TL, which can be further classified into cutaneous localized, mucosal, diffuse and disseminated forms [4, 5]. In Brazil, seven dermotropic species are associated with TL, and Leishmania braziliensis, Leishmania amazonensis and Leishmania guyanensis are the most frequent ones [6]. Leishmania amazonensis symptomatic infections usually lead to cutaneous localized leishmaniasis, characterized by one or a few ulcerated lesions, and more rarely to the diffuse form, characterized by the absence of cell-mediated immunity and typified by many non-ulcerated lesions with high parasite loads [4].

Leishmania parasites have a heteroxenic life cycle. They are transmitted by female phlebotomine of the Phlebotomus (Africa, Asia and Europe) and Lutzomyia (Americas) genera [7]. The insect vector ingests macrophages infected with amastigotes from the vertebrate host during its blood meal. In the vector digestive tract, amastigotes differentiate into procyclic promastigotes, which multiply in the midgut [8]. Promastigotes then migrate to the thoracic midgut and stomodeal valve, where they multiply again and start differentiation into infective metacyclic forms [8]. During another blood meal, the infected vector transmits the parasite to a new mammalian host. Metacyclic promastigotes are then internalized by several phagocytic cells and perpetuate mainly in macrophages [9]. The receptors involved in the recognition and phagocytosis of parasites are mainly complement (CR), mannose, fibronectin and Fc-γ receptors [10]. Inside the macrophage, the parasite converts into the amastigote form, which resides and proliferates in an acidic vacuole [9].

Promastigotes and amastigotes molecules having a key role in the establishment of infection in the insect vector and mammalian host are named virulence factors [11]. They include membrane proteins and glycoconjugates (Glycosylphosphatidylinositol (GPI)-anchored glycoproteins, lipophosphoglycan (LPG), free GPI glycolipids and proteophosphoglycans). An abundant molecule in promastigote´s surface is LPG, a GPI-anchored glycoconjugate composed of a long phosphoglycan chain, a glycan core and a neutral oligosaccharide cap [11]. LPG is essential for adhesion of some Leishmania species to some vectors [8], as well as for phagocytosis and survival inside the macrophage [12]. Another important membrane-anchored virulence factor is metalloproteinase GP63, a protein involved in phagocytosis, resistance to complement lysis and subversion of macrophage signaling and activation [13-17].

Proteomic strategies have been employed in the identification of virulence factors of different Leishmania species and strains and for deciphering the mechanisms involved in the increased virulence conferred by specific factors (revised in [18]). However, most of these studies compared genetically altered parasites (usually parasite knocked out for specific genes) and/ or employed techniques such as 2-DE that do not allow the analysis of a high number of proteins. A recent study from our group compared two strains of L. amazonensis named PH8 and LV79 [19]. Promastigotes and amastigotes of PH8 strain caused larger lesions with higher parasite loads in murine models [19]. Amastigotes from LV79 and PH8 were isolated from footpad lesions of BALB/c mice and their soluble proteomes were compared. The abundances of all proteins and of the differential ones precisely clustered samples from the same strain [19]. Thirty-seven proteins showed different abundance between the two strains, 12 of which were increased in PH8 and 25 in LV79 amastigotes. Interestingly, superoxide dismutase, HSP70 and tryparedoxin peroxidase (TXNPx), proteins associated with augmented resistance to oxidative stress and survival of Leishmania, were increased in the soluble extracts of the less virulent LV79 strain [19].

We then wondered if the higher parasite loads observed for PH8 lesions resulted only from higher infectivity and survival of PH8 amastigotes or if promastigotes from this strain were also more efficiently internalized by macrophages. In the present study, we compared PH8 and LV79 early stationary phase promastigotes in terms of their internalization by murine macrophages in vitro and showed that PH8 are more adherent and are more phagocytosed by macrophages. To try to understand the molecular basis of these phenotypic differences we compared membrane-enriched proteomes of promastigotes of the two strains and identified several proteins with differential abundances, which will be discussed throughout the paper.

The higher phagocytosis of PH8 promastigotes may be relevant in early steps of in vivo infection, contributing to the higher virulence of this strain. Proteomic comparison identified several proteins, some of which may be further explored as potentially involved in L. amazonensis binding to macrophage and phagocytosis.

Material and methods

Ethics statement

Experiments with BALB/c mice were performed according to the Brazilian College of Animal Experimentation (CONEP) guidelines and with the approval of the Institutional Animal Care and Use Committee (CEUA) of the University of São Paulo (protocol number 9829290419).

L. amazonensis promastigotes culture

For L. amazonensis promastigotes culture, medium 199 (Sigma) was supplemented with 0.005% hemin, 40 mM HEPES pH 7.4, 100 μM adenine, 4 mM sodium bicarbonate, 20 μg/mL gentamicin and 10% FBS. Promastigotes of LV79 (MPRO/BR/72/M1841, isolated from the sand fly Lutzomyia flaviscutellata from Pará State, Brazil) and PH8 (IFLA/BR/67/PH8, obtained from the rodent Proechimys sp from Pará State, Brazil) strains were obtained through cultivation of amastigotes derived from BALB/c mice lesions in medium 199 at 24°C. Parasites were subcultured weekly to the initial density of 2 x 106 parasites/mL until eighth passage. For all experiments, parasites at fourth day of culture, early stationary phase, were employed.

Flow cytometry analysis to determine metacyclic promastigotes

2 x 106 promastigotes were collected in each of the 5 tubes prepared for each strain, washed twice with PBS pH 7.2 (800 x g, 10 min at 4°C) and fixed in 1% paraformaldehyde in PBS for 30 min at 4°C. Next, the parasites were washed with PBS and resuspended in 50 uL PBS. Cell acquisition was performed using a BD LSR Fortessa Cell analyser (BD, Franklin Lakes, NJ, USA), and the collected data were analyzed using FlowJo Software (LLC, Ashland, OR, USA). The frequencies of metacyclic promastigote forms were determined by gating cells with morphology similar to previously described [20] from at least 25,000 events, based in forward scatter (FSC, voltage 600) and side scatter (SSC, voltage 350) features.

Morphometric analysis of promastigotes

Morphometric analysis of PH8 and LV79 promastigotes was performed by collecting parasites during in vitro culture. Cultures were synchronized by sub culturing 3 times for 2x106/mL every 3 days, and parasites were collected at days 2, 4 and 6 of culture, counted, fixed and stained with Giemsa. 150 parasites per condition were classified in procyclics, nectomonads, leptomonads or metacyclics based on body length and flagellum length, according to [21].

Phagocytosis assay

BALB/c mice were euthanized in a CO2 chamber and cleaned with 70% alcohol. With the aid of tweezers, scalpel and scissors, skin and muscles of the hindlimb were removed in order to obtain its tibia and femur. After hygiene in 70% alcohol, the bones were washed in sterile PBS and epiphyses were excised exposing their medullary cavity. With the help of a 21-gauge needle connected to a 10 mL syringe, the bone marrow cells were expelled from the cavity by the passage of RPMI 1640 medium. The cells were homogenized in RPMI 1640 medium supplemented with 20% FBS, 30% L929 supernatant and 20 μg/mL gentamicin, distributed in 75 cm2 culture flasks and incubated at 37°C and 5% CO2 for seven days for differentiation into macrophages.

Cells were harvested from culture flasks in PBS with the aid of a cell scraper and centrifuged at 800 x g for 10 minutes. The resulting pellet was resuspended in RPMI 1640 medium supplemented with 10% FBS and 20 μg/mL gentamicin. Cells stained with 0.4% trypan blue were counted using a hemocytometer and 4 x 105 viable cells were plated in 13 mm diameter glass coverslips arranged in a 24-well plate. After overnight incubation at 37°C 5% CO2, macrophages were incubated with parasites at multiplicity of infection (MOI) of 10:1 in RPMI 1640 medium supplemented with 10% FBS and 20 μg/mL gentamicin at 4°C for 2 hours. Subsequently, the plates were incubated at 34°C 5% CO2 for 5 minutes and again transferred to ice. Cells were washed with ice cold PBS and fixed with PBS containing 4% paraformaldehyde for 5 minutes. After washing with PBS, cells were incubated with 50 mM ammonium chloride for 30 minutes and blocked with PBS 1% BSA (Gibco, Thermo Fisher Scientific) for 30 minutes at 37°C.

Cells were incubated overnight with mice anti-Leishmania serum (1:75, “homemade”) before permeabilization, therefore antibodies bind exclusively to adhered parasites. In the following day, cells were washed with PBS and permeabilized with 0.1% Triton X-100 in TBS 1% BSA for 10 minutes, washed with PBS and then incubated with a mixture of 10 mg/mL DAPI (1:600), anti-mouse IgG (H+L) secondary antibody Alexa Fluor®488 (1:1,000; Molecular Probes, Thermo Fisher Scientific) and Texas Red 568 phalloidin (1:500; Molecular probes, Thermo Fisher Scientific) for 1 hour at room temperature. Slides were washed six times with PBS, three times with water and mounted with Prolong diamond (Molecular Probes, Thermo Fisher Scientific) for fluorescence analysis. Images were acquired in a DMI6000B/AF6000 (Leica) fluorescence microscope coupled to a digital camera system (DFC 365 FX). Tests were performed in technical triplicate and a total of 500 macrophages were analyzed for each coverslip. Parasites were classified as adhered (green with nucleus in blue) and phagocytosed (nucleus labeled in blue).

Protein extraction

Membrane-enriched fractions were obtained through sodium carbonate extraction adapted from [22-25]. Briefly, 1 x 109 promastigotes were washed three times with 4 mL of PBS and resuspended to a final density of 4 x 109 promastigotes/mL in a 100 mM sodium carbonate (pH 11) solution with protease inhibitor cocktail (800 nM aprotinin, 50 μM bestatin, 1 mM AEBSF, 15 μM E64, 20 μM leupeptin e 10 μM pepstatin A; Fermentas, Thermo Fischer Scientific). Promastigotes were lysed by eight cycles of freeze and thaw (liquid nitrogen and 40°C) and ultrasonication, performed three times for five seconds at 40% output spaced with 30-second intervals on ice (Vibra Cell VC50, Sonics&Materials Inc.). Remaining whole parasites were removed by centrifugation at 2,000 x g for 5 minutes at 4°C and the resulting supernatant was ultracentrifuged at 120,000 x g for 1 hour at 4°C. Lastly, supernatant (cytoplasmic fraction) was transferred to a new microtube and pellet (membrane-enriched fraction) was resuspended in 8 M urea and 100 mM ammonium bicarbonate (pH 7.5) with protease inhibitor cocktail (Fermentas). Protein concentration was determined by Bradford assay (BioRad).

For total protein extracts (used in SDS-PAGE, western blot and zymography), promastigotes were resuspended in PBS with protease inhibitor cocktail (Fermentas) at a final density of 2 x 109 parasites/mL. Parasites were lysed by eight cycles of freeze and thaw (liquid nitrogen and 40°C). Protein concentration was determined by Bradford assay.

SDS-PAGE, western blot and zymography

15 or 20 μg of protein were added to sample buffer (2% SDS; 60 mM Tris-HCl pH 6.8; 0.1% bromophenol blue; 1.2% β-mercaptoethanol; 10% glycerol) and boiled at 95°C for 5 minutes prior to separation in 10% or 12% acrylamide gels. Gels were composed of a stacking gel (5% acrylamide/bis-acrylamide; 125 M Tris-HCl pH 6.8; 0.1% SDS; 0.1% ammonium persulfate; 0.1% TEMED) and a running gel (375 mM Tris HCl pH 8.8; 10 or 12% acrylamide/bis-acrylamide; 0.1% SDS; 0.1% ammonium persulfate; TEMED 0.04%). Electrophoresis was performed in running buffer (25 mM Tris-HCl; 250 mM glycine; 0.1% SDS) at 80 V for 30 minutes and at 120 V for the rest of the run. For staining, gels were incubated with staining solution (40% methanol, 10% acetic acid and 0.1% Coomassie Brilliant blue R-250) for one hour at room temperature and then washed with a 20% methanol and 5% acetic acid solution for destaining.

For western blot, proteins were transferred to nitrocellulose membranes (GE healthcare) in transfer buffer (25 mM Tris pH 8.2; 192 mM glycine; 20% methanol; 0.1% SDS) employing the TE 77 semidry system (GE healthcare). In order to prevent nonspecific binding, membranes were blocked with PBS with 5% milk and 0.1% Tween 20 for 1 hour at room temperature prior to incubation overnight at 4°C with primary antibodies (anti-GP63 (1: 5,000), anti-TXNPx (1: 5,000), anti-enolase (1: 250) or anti-α-Tubulin (1: 50,000; T5168 Sigma)) diluted in PBS with 2.5% milk and 0.1% Tween 20. After three washing steps with PBS 0.1% Tween 20, membranes were incubated for 1 hour at room temperature with anti-mouse IgG (1:10,000; KPL) HRP-conjugated secondary antibodies diluted in PBS with 2.5% milk and 0.1% Tween 20. Membranes were washed three times with PBS 0.1% Tween 20 and two times with PBS. Lastly, membranes were incubated with ECL Prime Western Blotting Detection Reagent (GE healthcare) and chemiluminescence was detected by the ChemiDoc XRS+ Imaging system (BioRad). Band intensities were determined through ImageJ software. For validation, western blots were performed with biological triplicates.

For zymography, 2 μg of protein in sample buffer without β-mercaptoethanol were loaded to 12% SDS gels containing 0.1% gelatin. After electrophoresis, gels were incubated for 1 hour at room temperature in buffer containing 50 mM Tris pH 7.4, 2.5% Triton X-100, 5 mM CaCl2 and 1 μM ZnCl2. A parallel experiment was performed without ZnCl2. Subsequently, gels were incubated overnight at 37°C in buffer containing 50 mM Tris pH 7.4, 5 mM CaCl2, 1 μM ZnCl2 and 0.01% NaN3 [26]. Gels were stained and destained as described above. Zymography was performed with biological triplicates.

Protein digestion and peptide desalting

Tryptic digestion, desalting and MS were performed according to [27]. Briefly, after adjusting the pH of the samples to 7.5 with ammonium bicarbonate, 100 μg of protein were reduced by incubation with 10 mM DTT at 30°C for 30 minutes. Subsequently, proteins were alkylated by incubation with 40 mM iodoacetamide for 30 minutes in the dark at room temperature. To stop the alkylation reaction, DTT was added to a final concentration of 10 mM. Digestion buffer (50 mM ammonium bicarbonate and 10% ACN) was added to dilute urea concentration to 1.4 M. Digestion was performed by incubation with trypsin 1:50 (w/w) for 16 hours at 30°C and stopped by the addition of 10% formic acid to a final concentration of 1%.

The resulting peptide mixtures were desalted with hydrophilic–lipophilic-balanced SPE (Waters) and peptides eluted with 1 mL of 70% (v/v) ACN and 1% (v/v) TFA. Finally, the peptides were vacuum dried before MS analysis.

MS analysis

Promastigote membrane proteome analysis was performed with three biological replicates for each strain. Each biological replicate was analyzed twice by nLC-MS/MS, resulting in two technical replicates. Peptide separation was performed on the EASY- nLC system (Thermo Fisher Scientific) employing the Acclaim PepMap 100 C18 column (10 cm; 75 μm ID; 3 μm C18-A2; Thermo Fisher Scientific) and solvents A (0.1% formic acid) and B (0.1% formic acid; 99% ACN). Elution was performed for 77 minutes using a linear gradient from 1 to 50% of solvent B with a flow rate of 0.3 μL/min. Columns were washed and re-equilibrated between experiments. The eluted peptides were ionized by nanoelectrospray and directed to the LTQ Velos Orbitrap mass spectrometer (Thermo Fisher Scientific). Mass spectra were acquired in positive-ion mode with a range of 400 to 1,600 m/z, resolution of 30,000 (full width at half-maximum at m/z 400) and AGC target >1 × e6. The 20 most abundant precursor ions (z ≥ 2) were isolated to a target value of 5,000 and isolation width of 2 and fragmented by low-energy CID (normalized collision energy of 35% with 10 ms activation time) in the linear IT. For the detection of less abundant peptides, dynamic exclusion was applied with exclusion list size of 500, exclusion duration of 30 s and repeat count of 1. The raw data were submitted to PRIDE (https://www.ebi.ac.uk/pride/archive) under the submission number PXD017870.

Protein identification and bioinformatics analyses

Protein identification and bioinformatics analysis were performed with the MaxQuant software version 1.5.3.8 [28-30]. RAW files of the technical duplicates were imported to the software and combined into one. Search engine Andromeda was used to search MS/MS spectra against Uniprot Leishmania mexicana database (2018/09/10, 8,044 entries). For the search, the following parameters were adopted: (i) 4.5 ppm tolerance level for MS and 0.5 Da for MS/MS; (ii) trypsin cleavage at both ends with maximum of two missed cleavages allowed per peptide; (iii) cysteine carbamidomethylation (57.021 Da) as a fixed modification; (iv) oxidation of methionine (15.994 Da) and protein N-terminal acetylation (42.010 Da) as variable modifications. The feature ’match between runs’ was employed with a 0.7 minute match time and 20 minute alignment time window. All identifications were filtered to obtain a peptide and protein false discovery rate (FDR) of less than 1%. For protein identification, at least one unique peptide was required. For label-free quantification using unique and razor peptides, a minimum of two ratio counts was established as necessary. Protein abundance was calculated based on its normalized spectral intensity (LFQ Intensity).

Statistical analyses were performed with the Perseus software v.1.5.8.5 [31]. Potential contaminants, reverse hits and proteins identified only by the site were removed. The LFQ Intensity values were transformed into log2 (X) and only proteins with at least two valid values in at least one of the groups (PH8 or LV79) were maintained. Imputation was performed separately for each expression column; missing values were replaced by random numbers drawn from a normal distribution adopting a down shift of 1.8 and a distribution width of 0.3 [31]. Principal component analysis was constructed with all proteins identified. After exclusion of exclusively detected proteins, statistical analyses to compare LV79 and PH8 strains were performed by Student’s t test with Benjamini-Hochberg correction and FDR = 0.05. Differences were considered significant for corrected p-value (q-value) ≤.05. The heat map was constructed based on the hierarchical clustering of the Z-scores calculated from the log2 of LFQ Intensity values of differentially abundant proteins. For fold change calculations, mean of LFQ Intensity values of PH8 biological replicates were divided by the mean of LFQ Intensity values of LV79 biological replicates. Biological processes in which proteins participate were determined according to Gene ontology and KEGG Enzyme annotations and other literature sources. Protein subcellular localization was determined according to gene ontology (Cellular Component) and prediction tools classifications (DeepLoc-1.0 (http://www.cbs.dtu.dk/services/DeepLoc/), WoLF PSORT (https://wolfpsort.hgc.jp/), LocTree3 (https://rostlab.org/services/loctree3)) and TOPCONS (http://topcons.cbr.su.se/pred/)) [32-35].

Enolase activity assay

For enzymatic assays, parasites were washed two times with PBS and resuspended in lysis buffer (20 mM Tris HCl pH 7.7; 1 mM EDTA; 0.25 M sucrose; 0.1% Triton X-100) with protease inhibitor cocktail (Fermentas) to a final density of 2.5 x 109 parasites/mL. Samples were homogenized in vortex and centrifuged at 15,000 x g for 15 minutes at 4°C. Supernatant’s protein content was measured at 280 nm by Nanodrop. Reactions were initiated by addition of 40 μg of protein to the mixture containing 50 mM Tris–HCl pH 7.5, 2 mM MgSO4, 75 mM KCl and 2 mM phosphoenolpyruvate (PEP) in a final volume of 200 μL in 96-well plates. This assay monitors the enolase reverse reaction, following PEP conversion to 2-phosphoglycerate (2-PGA), measured spectrophotometrically at 240 nm in the SpectraMax i3 multi-mode detection platform (Molecular devices). Absorbance was converted to μmols of PEPox/mg.min using the molar extinction coefficient of PEP = 1.256. Enzymatic assay was performed with five biological replicates.

Real time RT-PCR

Promastigotes (5x107) from three synchronized cultures from each strain were collected at days 2 and 4 and RNA was prepared using TRIzol reagent (Life Technologies, Carlsbad, CA, USA), according to the manufacturer’s instructions. RNA concentration was determined by spectrophotometry (Nanodrop ND1000, Thermo Fisher Scientific). Samples with 2,5μg were treated with DNase I (Thermo Fisher Scientific) and used to prepare cDNA using Supescript II enzyme (Thermo Fisher Scientific) and oligodT and random hexamers.

cDNA was used as a template for qPCR with the Maxima SYBR Green/ROX qPCR MasterMix (Thermo Fisher Scientific) and specific primers for selected CDSs (SHERP For 5’ AAGGGACCAGATGAGCAACGT 3’ and Rev 5’ TTCAATCGTGTTGCCCACTGC 3’, META 1 For 5’ AAGCTTGATTGGCAAGCACAG 3’ and Rev 5’ CGTTCATGAAGTTCGCCACTT 3’, GAPDH For 5’ TCAAGGTCGGTATCAACGGC 3’ and Rev 5’ TGCACCGTGTCGTACTTCAT 3’). qPCR reactions were performed on a StepOne Plus thermocycler (Thermo Fisher Scientific) using the program: 95◦C for 10 min followed by 40 cycles at 95◦C for 15 s, 60◦C for 60 s, and 72◦C for 20 s. After determining the efficiency of amplification of the four genes, 2−ΔΔCt equation was employed to calculate the relative expression [36] of each gene in all samples using GAPDH as reference gene. LV79 day 2 mean values were used for normalization. Three biological replicates of each condition and three technical replicates for each sample were analyzed.

Statistical analysis

Statistical analyses were performed by unpaired parametric Student’s t test (n ≤ 2) when two samples were compared, and by ANOVA followed by Tukey posttest for three or more samples. Differences were considered significant for p-value ≤ 0.05.

Results

A previous study of our group showed that L. amazonensis amastigotes of PH8 strain were more infective in mice than those of LV79 strain [19]. Moreover, proteome analysis indicated that lesion-derived amastigotes from the two strains differ in terms of the abundance of several proteins [19]. We then wondered whether promastigotes of the two strains would also differ in terms of internalization by macrophages. In face of the low proportion of metacyclics in stationary phase (around 5% according to [37]), the isolation of membrane fractions for proteomic analysis from metacyclics would not be feasible. For this reason, all experiments employed promastigotes at the fourth day of culture, which corresponds to the early stationary phase for both strains, as shown in S1 Fig. This figure also indicates that PH8 and LV79 have similar growth curves, suggesting that their populations possibly have similar compositions.

The results shown in Fig 1 indicate that PH8 promastigotes adhere more (Fig 1A) and are more efficiently phagocytosed by murine bone marrow-derived macrophages in vitro (Fig 1B), as shown by the higher proportion of parasites attached to the cells and internalized.

Fig 1

In vitro phagocytosis assay with PH8 and LV79 promastigotes.

A. Number of promastigotes of PH8 and LV79 strains adhered to 500 macrophages. B. Number of promastigotes of PH8 and LV79 strains phagocytosed by 500 macrophages. Phagocytosis assays were performed with murine bone marrow-derived macrophages and a MOI of 10:1. Data represent mean ± SD of three technical replicates. Statistical analysis by Student’s t-test, *: p < .05, **: p < .01, ***: p < .001. Representative results of two experiments with similar profile.

Validation of sodium carbonate extraction for membrane enrichment

To identify membrane proteins that might account for the higher adhesion and phagocytosis of PH8 strain, we adapted a membrane extraction protocol previously employed to enrich L. donovani promastigotes´ membranes [22-25]. Total, cytoplasmic and membrane-enriched fractions of LV79 promastigotes were analyzed by SDS-PAGE, and a clear difference was observed in the protein profile of membrane-enriched fraction (Fig 2A). Membrane enrichment was validated by comparing the abundance of GP63, usually associated with promastigotes´ membranes, and TXNPx, a cytoplasmic enzyme, in the three fractions (Fig 2B). As expected, GP63 was more abundant in membrane-enriched when compared to the cytoplasmic fraction, while TXNPx was more abundant in the cytoplasm (Fig 2B), indicating that the extraction protocol was successfully adapted to L. amazonensis promastigotes.

Fig 2

Validation of sodium carbonate extraction with LV79 promastigotes.

A. 20 μg of protein of total cell (T), cytoplasmic (C) and membrane-enriched (M) fractions were analyzed by SDS-PAGE. B. Abundance of GP63 and TXNPx in 15 μg of total (T), cytoplasmic (C) and membrane-enriched (M) fractions were compared by Western blot.

Quantitative large-scale comparison of membrane-enriched proteomes of PH8 and LV79 promastigotes

Membrane-enriched fractions were prepared in biological triplicate from paired PH8 and LV79 promastigote day four cultures. Membrane enrichment was confirmed by Western blot with anti-GP63 and anti-TXNPx antibodies before proteomic analysis, as shown in S2 Fig.

Proteomes of the three samples of each strain were analyzed and 1659 proteins were identified, listed in S1 Table (Fig 3A). Principal component analysis based on all identified proteins efficiently clustered PH8 and LV79 samples (Fig 3B). From these, 1557 were identified both in PH8 and LV79 fractions, while 65 were detected exclusively in PH8 and 37 in LV79 (Fig 3A). Proteins detected exclusively in PH8 or LV79 are listed in S2 and S3 Tables, respectively. It should be noted that proteins detected exclusively in one condition might be present at levels below the limit of detection in the other condition. The majority of these proteins (33 from 65 proteins, 50.7% in PH8, and 17 from 37, 46% in LV79) has not been characterized.

Fig 3

Comparison of membrane-enriched proteomes of PH8 and LV79 promastigotes.

A. Venn diagram showing the number of proteins identified exclusively in PH8, in LV79 and identified in both strains. B. Clustering of the six samples (three biological samples (S1, S2 and S3) for each strain) by principal component analysis of all proteins identified. C. Heat map constructed based on the hierarchical clustering of the 6 samples (three samples (S1, S2 and S3) for each strain) based on Z-scores calculated from the log2 of LFQ Intensity values of differentially abundant proteins identified after Student’s t test with Benjamini-Hochberg correction and FDR = 0.05.

Considering the proteins identified in both strains, 62 proteins were identified as more abundant in PH8 samples, while 41 were identified as more abundant in LV79, as shown in the heat map (Fig 3C). S4 Table lists the differentially abundant proteins. Four proteins showed fold increases above 10 in PH8: Putative ATP-binding cassette protein subfamily G, member 1 (LABCG1), Glutamate dehydrogenase, Putative flagellar calcium-binding protein and Surface antigen-like protein. These proteins may eventually contribute to the increased infectivity of PH8.

Classification of proteins identified in proteomic analysis based on subcellular localization

Subcellular localization of the proteins identified in proteomic analysis was established according to Gene ontology annotations (Cellular Component). However, several Leishmania proteins are not characterized. Indeed, only 588 proteins from the 1659 (35,4%) had GO classification, as shown in S5 Table. In these cases, subcellular location was determined based on a consensus of DeepLoc-1.0, WoLF PSORT and Loc Tree3 predictions [32, 34, 35]. The proteins were classified as secreted or belonging to the “cilium”, cytosol, golgi complex, glycosome, plasma membrane, mitochondria, nucleus, endoplasmic reticulum or intracellular vesicles (Fig 4A). In addition, predictions tools DeepLoc-1.0 and TOPCONS were utilized to identify integral membrane proteins [32, 33].

Fig 4

Classification according to subcellular localization of all proteins identified in the membrane-enriched proteome of PH8 and LV79 promastigotes.

A. Circle chart showing percentage of proteins identified in proteomic analysis belonging to each subcellular localization. B. Circle chart showing percentage soluble and integral membrane proteins C. Circle chart showing percentage of integral membrane proteins identified in proteomic analysis belonging to each subcellular localization.

Most proteins were localized in the cytosol (43%), mitochondrion (17%) and nucleus (15%) (Fig 4A), and only 3% of the proteins were localized in the cell membrane. According to our classification, proteins that have at least one transmembrane domain correspond to 14% of the proteome (Fig 4B), most of which belong to the mitochondria (27%), cell membrane (21%) and endoplasmic reticulum (18%) (Fig 4C).

Classification of regulated proteins based on biological process

The proteins more abundant in PH8 and LV79 promastigotes, including all exclusively detected and differentially abundant proteins, were classified according to the biological processes in which they participate. Proteins were assigned based on Gene ontology and KEGG Enzyme annotations and other literature sources into eleven biological processes: amino acid metabolism, carbohydrate metabolism, lipid metabolism, nucleotide metabolism, DNA replication and repair, transcription, mRNA processing, translation, cytoskeleton composition, membrane and vesicle trafficking and proteolysis (S2–S4 Tables; Fig 5).

Fig 5

Classification of differentially abundant proteins based on biological process.

A. Circle chart showing percentage of the proteins more abundant in PH8 promastigotes belonging to each biological process. B. Circle chart showing percentage of the proteins more abundant in LV79 promastigotes belonging to each biological process. C. Bar diagram showing the percentage of differential proteins from each biological process detected as more abundant in LV79 and in PH8 strains.

We observed that proteins more abundant in PH8 promastigotes participate mainly in carbohydrate metabolism (21%), cytoskeleton composition (17%) and vesicle and membrane trafficking (13%) (Fig 5A and 5C). Proteins related to proteolysis, mRNA processing, DNA replication and repair, transcription and lipid metabolism are also more abundant in PH8 promastigotes (Fig 5C). In contrast, the majority of the proteins more abundant in LV79 promastigotes participate in translation (47%), amino acid metabolism (21%) and nucleotide metabolism (14%) (Fig 5B and 5C).

GP63 is regulated at protein and enzymatic level in L. amazonensis PH8 and LV79 strains

Three isoforms (E9AN53, E9AN57 and E9AZL8) of GP63, a well-known virulence factor of Leishmania, were detected in all samples analyzed. One of these isoforms was more abundant in LV79 membrane-enriched promastigotes fractions (S4 Table and Fig 6A). This finding was not expected considering the lower virulence of this strain and the higher abundance of GP63 in soluble proteome of PH8 lesion derived amastigotes previously reported [19]. We thus compared GP63 abundance in total and membrane-enriched fractions of PH8 and LV79 promastigotes by Western blot. Fig 6B shows that GP63 is indeed more abundant in total (left) and membrane-enriched (right) fractions of LV79 when compared to PH8. We then sought to analyze GP63 activity of promastigotes total extracts (with inhibitors to several proteases other than metalloproteases) by zymography in gelatin gels. Data shown in Fig 6C (left panel), representative of three experiments with similar results, suggests that GP63 (50 kDa band) is enzymatically more active in PH8. Non-reducing Western blot for GP63 (Fig 6C, right panel) supports the size of band pointed as GP63. We have performed an assay without ZnCl2 and the bands near 50 kDa were a little less pronounced, but still evident. We believe ZnCl2 remnants present in total protein extract may be enough for GP63 activity, as observed by others [38, 39].

Fig 6

GP63 abundance and activity in L. amazonensis promastigotes of LV79 and PH8 strains.

A. GP63 abundance (non-log transformed LFQ intensities) in proteomes of membrane-enriched fractions of LV79 and PH8 promastigotes. B. GP63 (upper figure) and α- tubulin (lower figure) abundances in total extracts (left) and membrane-enriched fractions (right) (three biological samples for each strain) of LV79 and PH8 by Western blot. For membrane-enriched fractions, GP63 is shown together with tubulin labeling in the upper figure. Graphs show normalized values (GP63/ α- tubulin). Graph C. GP63 proteolytic activity in total extracts (three biological samples for each strain) was measured by zymography (one experiment representative of three). A non-reducing Western blot for GP63 is shown in the right. Data in A and B represent means and SD of three biological samples (S1, S2 and S3) for each strain. For A, statistical analysis was performed by Student’s t test with Benjamini-Hochberg correction (FDR = 0.05) and the resulting q-value is shown in graph. For B, statistical analysis was performed by Student’s t-test, *: p < .05, **: p < .01, ***: p < .001.

The higher abundance of enolase in the proteome of PH8 membrane-fractions is shown in S4 Table and Fig 7A. This result was validated in total (left) and membrane-enriched (right) fractions by western blot (Fig 7B). Data shown in Fig 7C, representative of three experiments with similar results, suggests that there are no significant differences between strains in terms of enolase activity, although values for PH8 tend to be higher than those of LV79 (Fig 7C).

Fig 7

Enolase abundance and activity in L. amazonensis promastigotes of LV79 and PH8 strains.

A. Enolase abundance (non-log transformed LFQ intensities) in proteomes of membrane-enriched fractions of LV79 and PH8. B. Enolase abundance in total extracts (left) and membrane-enriched fractions (right) (three biological samples (S1, S2 and S3) for each strain) of LV79 and PH8 by western blot. C. Enolase activity in total extracts was monitored by the PEP conversion to 2-PGA, which was measured spectrophotometrically at 240 nm. Data in A, B and C represent means and SD of three, three and five biological replicates, respectively. For A, statistical analysis was performed by Student’s t test with Benjamini-Hochberg correction (FDR = 0.05) and the resulting q-value is shown in graph. For B and C, statistical analysis was performed by Student’s t-test, *: p < .05, **: p < .01, ***: p < .001.

Can population composition differences explain higher infectivity and proteome profile of PH8?

GO annotation analysis showed that the majority of the proteins upregulated in LV79 promastigotes participate in translation, while most of the proteins upregulated in PH8 are involved in carbohydrate metabolism, cytoskeleton composition and vesicle and membrane trafficking.

To evaluate whether a different composition in terms of parasite stages in day 4 cultures could account for the discrepant proteomic profiles and infectivity observed for PH8 and LV79, we compared parasites from the two strains by flow cytometry and morphometrical analysis. The frequency of metacyclic forms in three synchronized cultures from each strain was estimated using flow cytometry. The cells gated in the region with lower Forward side scatter (FSClow) and SSC features were representative of Leishmania (Fig 8A), as described previously [20]. Results shown in Fig 8B indicate that cultures (day 4) of LV79 strain present a significantly higher frequency of metacyclic forms (54,86%) compared to those of PH8 strain (22,37%).

Fig 8

Frequency of metacyclic promastigote forms in L. amazonensis LV79 and PH8 strains.

L. amazonensis promastigotes from LV79 and PH8 strains at early stationary phase (day 4) were analyzed by flow cytometry. A. Dot plots of SSC and FSC features representative of Leishmania gating strategy in FSClow and SSC, excluding debris, analyzed using BD LSR Fortessa Cell Analyser (Becton Dickinson). B. Frequency of metacyclic promastigotes in three independent experiments containing 5 replicates of each strain. Each bar represents the mean of the percent ±SD of metacyclics. Statistical analysis by Student’s t-test, ****: p < 0.0001.

Morphometric analysis of PH8 and LV79 promastigotes was performed during in vitro culture and parasites were classified in procyclics, nectomonads, leptomonads or metacyclics, according to [21]. Data from day 6 was not considered valid due to the huge proportion of parasites without nucleus, without flagellum or with atypical morphology. The proportion of the four stages in each culture is shown in Fig 9. Representative images of LV79 and PH8 cultures in days 2 and 4 and 6 are available as S3 Fig.

Fig 9

Proportion of procyclics, nectomonads, leptomonads and metacyclics in log phase (day 2) and early stationary phase (day 4) cultures of L. (L.) amazonensis LV79 (A) and PH8 (B) strains.

Flagellum and body length from 150 parasites were measured using ImageJ and parasites were classified according to [21].

As can be observed, both cultures show a reduction of procyclics and nectomonads and an increase in leptomonads and metacyclics from log (day 2) to early stationary phase (day 4) (Fig 9), in agreement to what is observed during development in the sandfly. Besides, it is also evident that LV79 cultures at days 2 and 4 show higher proportion of metacyclics compared to PH8. In fact, day 2 cultures of LV79 display 8.12% metacyclics compared to 0% for PH8, and day 4 cultures of LV79 show 16.56% of metacyclics compared to 3.07% for PH8. The higher proportion of metacyclics in day 4 cultures of LV79 agrees with data from flow cytometry (Fig 8B).

We also evaluated the abundance of transcripts of two genes commonly used as markers for metacyclogenesis in Leishmania: SHERP and META1. SHERP transcripts were described as good markers for L. infantum metacyclics isolated from sandfly [40] and are also more abundant as transcripts and proteins in late stationary cultures of L. major [21, 41]. META 1 protein was shown to be more abundant in L. amazonensis stationary cultures, and its overexpression increased parasite virulence [42].

The transcripts of these three genes were compared in day 2 and day 4 cultures of LV79 and PH8. The results of three independent experiments are plotted in Fig 10.

Fig 10

Relative expression of SHERP and META1 in LV79 and PH8 cultures.

Synchronized cultures from day 2 (D2) and day 4 (D4) were collected for comparative analysis of transcripts of SHERP, META1 and GAPDH. Data obtained by RealTime RT-PCR of three independent cultures for each strain, using GAPDH as the reference gene and mean values of LV79 D2 for normalization. Statistical analysis by ANOVA with Tukey posttest.

Despite a visible increase in SHERP and META1 transcripts in day 4 compared to day 2 cultures for both LV79 and PH8, no statistical difference was observed. Besides, there was no difference in expression of these genes between LV79 and PH8 cultures.

Discussion

In this study, we showed that PH8 stationary phase promastigotes are more adherent to and phagocytosed by bone marrow-derived murine macrophages in vitro than LV79. These results parallel the higher infectivity observed for PH8 in mice in vivo after inoculations of stationary phase promastigotes or amastigotes [19]. We hypothesized that this phenotypic characteristic correlates with differences in membrane composition between the two strains. In order to identify proteins possibly involved in the difference of phagocytosis and adhesion, we performed a comparative high throughput proteomic analysis of membrane-enriched fractions of PH8 and LV79 promastigotes.

Despite observing membrane enrichment by comparing GP63 and TXNPx abundance in different cellular fractions, a low percentage of membrane proteins was observed. A high number of contaminating cytoplasmic proteins was expected, as it is commonly reported by studies that employ similar protocols for membrane enrichment [25, 43–45].

Proteins potentially associated with virulence such as enolase and putative ABC transporter (ATP-binding cassette) member 1 from subfamily G (LABCG1) were upregulated in PH8 promastigotes. LABCG1, 23.57 times more abundant in PH8 promastigotes according to proteomic analysis, is an interesting target due to its membrane location. Although frequently related to drug resistance, the role of ABC transporters in virulence was already reported in Leishmania [46-48]. Indeed, the deletion of LABCG1-2 in Leishmania major reduced promastigotes’ infectivity in vitro and lesion development in vivo. Accordingly, LABCG1-2 deletion decreased phosphatidylserine (PS) exposure, increased parasite susceptibility to human complement lysis and decreased the proportion of metacyclics in stationary cultures, although transgenic parasites had growth curves similar to wild type counterparts [48]. These results are similar to what we found in LV79 and PH8: similar growth curves but differences in metacyclic composition.

Enolase is an enzyme that participates in glycolysis and gluconeogenesis, however an inactive form associated with plasma membrane was already demonstrated in L. major, L. mexicana and L. donovani [49, 50]. Enolase present on the parasite’s surface may bind to mammalian host plasminogen, which can be converted into plasmin [51]. There are evidences that plasminogen is beneficial to the parasite, since plasminogen-defective male mice develop smaller lesions when infected with L. mexicana [52]. It is hypothesized that plasmin bound to enolase allows parasite dispersion through fibrin degradation [52]. Macrophages can also bind plasminogen through surface receptors; therefore, enolase may facilitate parasite’s interaction with the host cell [53]. Furthermore, plasminogen may also inhibit complement system, conferring additional advantage to Leishmania [54]. Interestingly, enolase was recently described in exosomes shed by L. amazonensis promastigotes [16]. It is possible that the increase in enolase observed in PH8 promastigotes contributes to the higher infectivity of this strain. Enolase identified in our proteomes may be membrane-associated or cytosolic. In fact, apart from membrane-associated proteins, we also identified several metabolic enzymes in membrane-enriched fractions of PH8 and LV79 promastigotes. These findings are curious but not unexpected, since enzymes may be closely associated to membranes of cell or organelles and may also be kept inside vesicles formed during membrane rupture. Although the protocol employed sodium carbonate, which should reduce vesicle formation, these artifacts may still occur [23]. No significant difference was observed in enolase enzymatic activity between total extracts of PH8 and LV79, which may suggest that the inactive enolase isoform is responsible for differences of abundance observed between strains.

The virulence factor GP63 was also identified as differentially abundant between membrane-enriched fractions of LV79 and PH8. This glycoprotein is more abundant in promastigotes than amastigotes and is important in several phases of infection [13]. GP63 is secreted by promastigotes in exosomes, which are inoculated in the vertebrate by the sandfly during the blood meal [13, 55–57]. Besides, GP63 present in exosomes enhances cutaneous leishmaniasis in L. amazonensis experimental model [16]. In the extracellular matrix, it may cleave collagen and fibronectin, helping in promastigote movement [58]. It may also cleave and inactivate C3b, interrupting complement cascade but enabling parasite internalization by CR3 [59, 60]. Binding of GP63 to CR3 inhibits pro-inflammatory signaling and oxidative burst, contributing to parasite survival [59, 61, 62]. Inside the macrophage, GP63 translocates to cytoplasm and nucleus, where it affects several mammalian host cell pathways [13, 14, 17]. Curiously, according to proteomics analysis GP63 was more abundant in membrane-enriched fractions of LV79, which was confirmed by western blot. However, zymography (based on a band with the same migration of GP63 in non-reducing WB) suggests that GP63 proteolytic activity is higher in PH8 promastigotes and therefore may contribute to its virulence. These results, which must be confirmed by other assays, may indicate that GP63 activity is not directly proportional to its expression, however there is little information about the regulation of GP63 activity in Leishmania.

Although not directly related to phagocytosis, metabolic differences may also be important to understand the different behavior previously reported for PH8 and LV79 in vivo. The majority of the proteins upregulated in LV79 promastigotes participate in translation. In contrast, most of the proteins upregulated in PH8 are involved in carbohydrate metabolism, cytoskeleton composition and vesicle and membrane trafficking. Several studies have compared procyclic and metacyclic promastigotes of different Leishmania species [63-65]. During metacyclogenesis of L. major, proteins related to translation are downregulated and proteins related to motility, upregulated [64]. Furthermore, in L. infantum and L. tropica proteins that participate of carbohydrate metabolism are more abundant in metacyclics promastigotes [63, 65]. There are no similar studies for L. (L.) amazonensis in the literature, but these observations prompted us to analyze whether a higher abundance of metacyclics in PH8 day 4 cultures could account for increased infectivity and different proteome profile of this strain.

The comparison of metacyclic proportions between L. (L.) amazonensis strains is not a simple task. Purification of L. amazonensis metacyclics is usually performed using antibody mAb 3A1 directed to procyclic LPG [66] or Ficoll gradients. Ficoll separation was developed for L. major [67], and although not based on LPG and feasible for purification of LPG deficient L. major, its efficiency is affected by LPG characteristics. The LPG profile of the PH8 strain revealed presence of glucose as side chains [68], and for this reason we don´t consider the comparison of the proportion of metacyclics in PH8 and LV79 by Ficoll purification accurate.

In face of these technical caveats on metacyclic purification for comparison, we opted to estimate metacyclic proportions by two different morphological techniques and to compare the abundance of commonly used metacyclic markers in cultures of LV79 and PH8. We observed higher abundance of metacyclics in LV79 according to the morphological analyses, although the expression of molecular markers was similar between the two strains. These data reinforce the complexity of classification of stages in L. amazonensis and defy the scientific community to invest in projects aimed to study L. amazonensis development in the vector and search for appropriate metacyclic markers for this species.

We believe our work contributes to different aspects of L. amazonensis biology. First, it compares strains with different biological behavior and identifies proteins more abundant in the more infective (and virulent) PH8 strain, some of which can be further studied as potentially involved in Leishmania adhesion and phagocytosis. Besides, we highlight the importance of evaluating not only the abundance of the proteins, but also their biological activity, as speculated for GP63. We also show that although PH8 parasites have a proteomic profile more similar to metacyclics, their morphological characteristics indicate a higher proportion of procyclics. These data reinforce the complexity of classification of stages in L. (L.) amazonensis and defy the scientific community to invest in projects aimed to study L. (L.) amazonensis development in the vector and search for appropriate metacyclic markers for this species. We also believe our work may stimulate further studies comparing PH8 and LV79, such as those focused on the analysis of exosome composition. Although our proteome study didn’t include analysis of exosomes, we do believe PH8 and LV79 secrete exosomes with different composition in terms of membrane and cytosolic proteins (as well as other molecules). Comparison of the two secretomes will certainly add further information to L. amazonensis virulence and pathogenicity.

Growth curve of L. amazonensis PH8 and LV79 promastigotes.

PH8 and LV79 promastigotes were cultured in 199 medium at 24°C and culture density was calculated daily over 6 days. Cultures were initiated with 2 x 106 promastigotes/mL on day 0. Data represented as mean ± SD of three biological replicates.

(TIF)

Click here for additional data file.

Membrane enrichment of LV79 and PH8 promastigotes extracts.

Before proteomics analysis, membrane enrichment was confirmed by Western blot of cytoplasmic (C) and membrane-enriched (M) extracts with anti-GP63 and anti-TXNPx antibodies. Data shown is representative of three analyses performed with different extracts from paired PH8 and LV79 promastigotes cultures.

(TIF)

Click here for additional data file.

Representative images of LV79 and PH8 cultures at days 2, 4 and 6.

Cultures were synchronized, and parasites were counted, fixed and stained with Giemsa at days 2, 4 and 6 of culture.

(TIF)

Click here for additional data file.

All proteins identified with at least two valid numbers in one of the groups (PH8 or LV79) after exclusion of contaminants, reverse hits and proteins only identified by site.

The LFQ Intensity values were transformed into log2 (X).

(XLSX)

Click here for additional data file.

List of proteins exclusively detected in PH8 samples.

Uniprot identification (protein ID), protein names and iBAQ (sum of the intensities of the peptides normalized by the number of peptides theoretically formed) of proteins exclusively detected in PH8.

(XLSX)

Click here for additional data file.

List of proteins exclusively detected in LV79 samples.

Uniprot identification (protein ID), protein names and iBAQ (sum of the intensities of the peptides normalized by the number of peptides theoretically formed) of proteins exclusively detected in LV79.

(XLSX)

Click here for additional data file.

Differentially abundant proteins identified after T test with Benjamini-Hochberg correction and FDR = 0.05.

Protein names, Uniprot identification (protein ID), fold change PH8/LV79, q-value (corrected p-value) and biological process of differentially abundant proteins.

(XLSX)

Click here for additional data file.

Protein subcellular localization.

Subcellular localization of the proteins identified in proteomic analysis was established according to Gene ontology annotations (Cellular Component). For those that lack annotation, subcellular location was determined based on a consensus between DeepLoc-1.0, WoLF PSORT and Loc Tree3 predictions. The proteins were classified as secreted or belonging to the “cilium”, cytosol, golgi apparatus, glycosome, cell membrane, mitochondria, nucleus, endoplasmic reticulum (ER) or intracellular vesicles. In addition, the proteins were distinguished between soluble and integral membrane proteins according to DeepLoc-1.0 and TOPCONS predictions.

(XLSX)

Click here for additional data file.

(PDF)

Click here for additional data file.

Transfer Alert

This paper was transferred from another journal. As a result, its full editorial history (including decision letters, peer reviews and author responses) may not be present.

9 Mar 2022

Submitted filename: Reviewers Complete Reply.pdf

Click here for additional data file.

12 Apr 2022

A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). You should upload this letter as a separate file labeled 'Response to Reviewers'.

A marked-up copy of your manuscript that highlights changes made to the original version. You should upload this as a separate file labeled 'Revised Manuscript with Track Changes'.

An unmarked version of your revised paper without tracked changes. You should upload this as a separate file labeled 'Manuscript'.

If you would like to make changes to your financial disclosure, please include your updated statement in your cover letter. Guidelines for resubmitting your figure files are available below the reviewer comments at the end of this letter.

If applicable, we recommend that you deposit your laboratory protocols in protocols.io to enhance the reproducibility of your results. Protocols.io assigns your protocol its own identifier (DOI) so that it can be cited independently in the future. For instructions see: https://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocols. Additionally, PLOS ONE offers an option for publishing peer-reviewed Lab Protocol articles, which describe protocols hosted on protocols.io. Read more information on sharing protocols at https://plos.org/protocols?utm_medium=editorial-email&utm_source=authorletters&utm_campaign=protocols.

We look forward to receiving your revised manuscript.

Kind regards,

Yara M. Traub-Csekö

Academic Editor

PLOS ONE

Journal Requirements:

When submitting your revision, we need you to address these additional requirements.

1. Please ensure that your manuscript meets PLOS ONE's style requirements, including those for file naming. The PLOS ONE style templates can be found at

https://journals.plos.org/plosone/s/file?id=wjVg/PLOSOne_formatting_sample_main_body.pdf and

https://journals.plos.org/plosone/s/file?id=ba62/PLOSOne_formatting_sample_title_authors_affiliations.pdf

2. Please update your submission to use the PLOS LaTeX template. The template and more information on our requirements for LaTeX submissions can be found at http://journals.plos.org/plosone/s/latex.

3. We note that the grant information you provided in the ‘Funding Information’ and ‘Financial Disclosure’ sections do not match.

When you resubmit, please ensure that you provide the correct grant numbers for the awards you received for your study in the ‘Funding Information’ section.

4. PLOS ONE now requires that authors provide the original uncropped and unadjusted images underlying all blot or gel results reported in a submission’s figures or Supporting Information files. This policy and the journal’s other requirements for blot/gel reporting and figure preparation are described in detail at https://journals.plos.org/plosone/s/figures#loc-blot-and-gel-reporting-requirements and https://journals.plos.org/plosone/s/figures#loc-preparing-figures-from-image-files. When you submit your revised manuscript, please ensure that your figures adhere fully to these guidelines and provide the original underlying images for all blot or gel data reported in your submission. See the following link for instructions on providing the original image data: https://journals.plos.org/plosone/s/figures#loc-original-images-for-blots-and-gels.

In your cover letter, please note whether your blot/gel image data are in Supporting Information or posted at a public data repository, provide the repository URL if relevant, and provide specific details as to which raw blot/gel images, if any, are not available. Email us at plosone@plos.org if you have any questions.

[Note: HTML markup is below. Please do not edit.]

Reviewers' comments:

Reviewer's Responses to Questions

Comments to the Author

1. Is the manuscript technically sound, and do the data support the conclusions?

The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented.

Reviewer #1: Yes

Reviewer #2: Yes

Reviewer #3: Partly

**********

2. Has the statistical analysis been performed appropriately and rigorously?

Reviewer #1: Yes

Reviewer #2: Yes

Reviewer #3: Yes

**********

3. Have the authors made all data underlying the findings in their manuscript fully available?

The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified.

Reviewer #1: Yes

Reviewer #2: Yes

Reviewer #3: Yes

**********

4. Is the manuscript presented in an intelligible fashion and written in standard English?

PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here.

Reviewer #1: Yes

Reviewer #2: Yes

Reviewer #3: Yes

**********

5. Review Comments to the Author

Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters)

Reviewer #1: In the manuscript entitled "Proteome and morphological analysis show unexpected differences between promastigotes of L. amazonensis PH8 and LV79 strains” has been used two strains of Leishmania amazonensis (PH8 and LV79), causing different clinical presentations of cutaneous leishmaniases in mice, as shown in their previous publication (reference 15). In present study, were compared promastigotes’ infectivity in macrophages, their proteomes and morphologies. The authors try to correlate the biological findings with the identified proteins. Apart from comparing protein abundance, they also analyzed enzymatic activity when appropriate, and noticed that protein abundance do not always correspond to activity.

In general, the study is well written and experiments have been conducted with appropriate controls, replication, and sample sizes. The conclusions drawn appropriately based on the data presented, perhaps except for the activity of GP63.

In my opinion, it does not seem possible to assume that the zymography data can be attributed exclusively to GP63 activity. Hence I would like to know “ how” and “why” the authors assume that “protein abundance do not always correspond to activity” performing only zymography.

It seems to me that the authors have already answered several questions from other reviewers, as well as improved writing and data presentation, and now the article is almost suitable for publication.

- Minor Revision (Line numbers are missing, which can make it difficult to find the text)

ABSTRACT

I cannot understand how “contradictory results shed light”…. it looks confused to me

INTRODUCTION

Page 4- The authors use “vector and host”, however, vector is also host

M & M

2.3 - What is the quantity and/or volume of parasites? 1X not required. PBS pH?

2.5 – Number of cells are missing in some protocols. Fixed with 4% paraformaldehyde (Water or PBS?)

2.12- Primer sequence of HASP (or HASPA)? After all, was HASP (or HASPA?) used or not? It is not described here, but it appears in the result (page 25), and in the caption of Figure 10, but not in the bars of Figure 10!

Reviewer #2: The work presented by the authors aims to analyze the protein composition of two strains of Leishmania amazonensis (PH8 and LV79) that show differences in relation to the infectivity of murine macrophages. In this work, a proteomic analysis of material enriched with membrane proteins was performed. The authors performed in vitro adhesion and phagocytosis assays which revealed that the PH8 strain has a greater adhesion capacity and is also more endocytosed by macrophages than the LV79 strain. Validation experiments of data obtained in proteomics were performed using techniques such as Western blot and Real time RT-PCR, which provided robustness to the analyses. The result obtained with the GP63 zymogram could be more accurate and revealing if the authors had used a fluorescent peptide substrate, such as Dansyl-AYKKWV-NH2. Overall the manuscript is well written in correct and objective English.

Reviewer #3: The manuscript PONE-D-22-07087 reports on the in vitro infection capability and proteomics analysis of two Leishmania amazonensis strains associated with different severity of cutaneous leishmaniasis in BALB/c mice. Bone marrow-derived macrophages were used for comparing parasites’ adherence and infectivity and membrane-enriched fractions of early stationary phase promastigotes were analyzed by label-free proteomics. The study is technically fair; however, there are some issues that authors are encouraged to address.

Major comments:

- Pag. 6. The end of the introduction is a summary of the results. Instead of this summary, the authors could clarify in that final paragraph what was the hypothesis and the objective of the study, since it is not clear why to return to an in vitro infection with promastigotes after having made a comparative analysis of amastigotes obtained from in vivo infections. On the one hand the authors mention phenotypic differences (emphasizing membrane proteins), on the other they seem to be interested in metacyclogenesis. So, it is not clear in the text, what is the main objective.

- Pag. 10. Authors state: “For total protein extracts (used in SDS-PAGE, western blot and zymography), promastigotes were resuspended in PBS with protease inhibitor cocktail (Fermentas) at a final density of 2 x 109 parasites/mL. Parasites were lysed by eight cycles of freeze and thaw (liquid nitrogen and 40oC).” This way of lysing parasites favors soluble proteins while membrane proteins remain in the debris. Please clarify which fraction was used for the SDS-PAGE, WB and Zym assays?

- Pag. 16. Item 3.1. During the encounter of the parasites with the phagocytic cells, both the parasites actively infect the cells (when they are infectiuos) and the cells actively phagocytize the parasites. Decrease in the infective capability of the former or phagocytic capability of the latter would result in lower rates of infection. It is not clear to this reviewer why the authors describe the results in terms of phagocytosis and make no mention of the infectivity of the strains. It is also not clear why, if they talk about phagocytosis, there is no specific control for this, such as latex beads.

- Figure 1. Figure 1A, describing the results in terms of 500 cells is not clear. Please describe the number of parasites attached per cell (in the population of 500 cells tested) or alternatively the percentage of cells with parasites attached (in the population of 500 cells tested). The same applies to figure 1B, describe the number of phagocytosed parasites per cell.

- Pag. 18. Figure 2. As described in the methods, the total protein extracts for SDS-PAGE and Western blotting were prepared differently than the membrane and cytoplasmic fractions. In figure 2, total protein only appears to represent the soluble fraction, so it would be more correct to present the total protein extract from which the M and C fractions were prepared.

- Page 18. Supplementary table 1. For quantification and clusterization, proteins identified with only one peptide should be excluded. Please, exclude those proteins.

- Page 19. Supplementary table 4. This table presents fold change values, but it is not clear if these are based on the LFQ or iBAQ values. Please clarify that in the legend of the table.

Regarding the iBAQ values, could it be clarified in the text why these values were included and how they were used in the analysis of the results?

- Pag. 20. The authors report that only 14% of the identified proteome has at least one transmembrane domain, which reveals that proteins from other cell compartments would be the majority in the analyzed membrane fraction. Given this finding, the data should be better filtered based on the results of the predictors so that only proteins with predicted transmembrane domains are included in the final list, giving more robustness to the result. For this reviewer, 14% (~230 proteins), being stringent and restricted to only true membrane proteins, would be a much more interesting group to analyze and discuss. Alternatively, an analysis of the cytosolic fraction could be done for comparison and subtraction from the membrane fraction.

- Page 21. First paragraph. Once again, these results show that the data probably needs to be better filtered so as not to lose focus on the membrane proteins involved in adhesion and infection.

- Pag 21. Figure 6. How do the authors explain that the total extracts of both strains do not contain what was observed in the membrane fractions? Please explain.

- Page 22. First paragraph and figure 6C. It is not clear why the authors credit the 50 kDa band to GP63. In zymography the electrophoretic migration of proteins is retarded, so enzyme activity may appear in regions above (not below) the calculated theoretical molecular mass for the protein. Thus, the molecular mass values of the observed proteolytic activities should be reviewed in figure 6C. Moreover, assigning a proteolytic band to GP63 solely based on electrophoretic migration is wrong. The most that can be said is that they are metallopeptidases that migrate in that molecular mass and even so, this figure lacks a control with a specific inhibitor for this class of enzymes, to demonstrate that they are metallopeptidases and not another class of peptidases. That control should be included.

Also, please describe in the legend to figure 6 what panel C-right is.

- Page 23. Item 3.7, first paragraph. For this reviewer, this is due to the limitations of the methodology used for the enrichment of membrane proteins and it is again suggested to better filter the data so that proteins without transmembrane domains are not included.

- Fig. 8. Cytometry profiles are very different between strains on day 4 of culture. While in the growth curve, on day 4 the strains seem to have the same number of parasites and to be in the same growth phase (early stationary), the analysis by cytometry shows completely different profiles. How do the authors explain that?

- Pag. 26-27. Authors state: “Only 3% of the proteins were localized in the cell membrane, probably because sodium carbonate extraction promotes the enrichment of integral membrane proteins, including those belonging to intracellular organelles. Although the percentage of integral membrane proteins is low, other studies that perform cell fractionation of Leishmania promastigotes by differential centrifugation have also failed to achieve a significant enrichment [44, 45].” If authors filter better the data, I suggest correcting this percentage for the 14% reported before (proteins with transmembrane proteins). I also suggest rewriting this paragraph since it does not seem correct to justify the low number of membrane proteins obtained in this study, using the failure that other studies have shown in this enrichment.

- Pag. 27. Interestingly, ABCG1 is a phosphatidylserine transporter potentially involved in oxidative stress and metacyclogenesis among others (Parasites Vectors 10, 267 (2017). https://doi.org/10.1186/s13071-017-2198-1). The authors are encouraged to elaborate on this.

- Pag. 28. The authors cannot claim that the observed proteolytic activities are due to GP63. Please re-write that paragraph.

- Page 29. This reviewer suggests avoiding discussing metabolic differences as these proteins appear to be "contaminants" of the membrane fractions and there are no other assays showing differences in the mentioned metabolic pathways between the strains.

Minor comments:

• Page 3 Introduction. Whenever the subgenus is mentioned, the genus should be mentioned first. Please correct for L. Leishmania and L. Viannia

• Pag. 4. Leishmania infantum chagasi is not a species, L. chagasi is a synonym of L. infantum.

• Pag. 4. It is important to mention that the main characteristic of the diffuse form caused by L. amazonensis is the absence of cell-mediated immunity.

• Pag. 6. Authors state: “… This conflicting data indicates that metacyclogenesis in L. amazonensis is a complex issue and that different methods must be used to characterize parasite stages and to search for factors involved in infectivity.” The results shown in the manuscript do not support this statement. Please moderate to sentence.

• Pag. 7. Item 2.2. This reviewer suggests making a more complete description of these strains, such as their origin and the host from which they were isolated.

• Page 8. Item 2.4. Please, clearly describe how the synchronization of the cultures was done.

• Page 8. Last paragraph. Please explain why this infection was made at that temperature (4°C) and how it reflects (or not) the natural interaction of these cells (macrophages-parasites)

• Supplementary figure 2. Instead of being supplemental, this figure could be added to the current figure 2.

• In figure 10 the titles of the Y axis are missing

**********

6. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.

If you choose “no”, your identity will remain anonymous but your review may still be made public.

Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.

Reviewer #1: No

Reviewer #2: No

Reviewer #3: No

[NOTE: If reviewer comments were submitted as an attachment file, they will be attached to this email and accessible via the submission site. Please log into your account, locate the manuscript record, and check for the action link "View Attachments". If this link does not appear, there are no attachment files.]

While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com/. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Registration is free. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email PLOS at figures@plos.org. Please note that Supporting Information files do not need this step.

6 Jun 2022

Dear Dr. Yara Traub-Csekö,

We want to thank you and the reviewers for the opportunity of submitting a revised version of our work. We also want to thank the three reviewers for the critical and detailed analysis that contributed for a better version of the manuscript. We believe and hope that this new version of the paper is suitable for publication in PlosOne.

Please find our answers to reviewers´requests below:

Reviewer #1: In the manuscript entitled "Proteome and morphological analysis show unexpected differences between promastigotes of L. amazonensis PH8 and LV79 strains” has been used two strains of Leishmania amazonensis (PH8 and LV79), causing different clinical presentations of cutaneous leishmaniases in mice, as shown in their previous publication (reference 15). In present study, were compared promastigotes’ infectivity in macrophages, their proteomes and morphologies. The authors try to correlate the biological findings with the identified proteins. Apart from comparing protein abundance, they also analyzed enzymatic activity when appropriate, and noticed that protein abundance do not always correspond to activity.

In general, the study is well written and experiments have been conducted with appropriate controls, replication, and sample sizes. The conclusions drawn appropriately based on the data presented, perhaps except for the activity of GP63.

R: We would like to thank reviewer 1 for the positive analysis of our work in terms of the conduction of experiments and text quality.

In my opinion, it does not seem possible to assume that the zymography data can be attributed exclusively to GP63 activity. Hence I would like to know “ how” and “why” the authors assume that “protein abundance do not always correspond to activity” performing only zymography.

R: We have performed a Western blot of GP63 under non-reducing conditions to map GP63 position in conditions similar to those used in zymography. As seen in Fig6C (right panel), GP63 band in non-reducing gel migrates near 50KDa. Zymography shown in Fig6C (left panel) shows a band near 50KDa at the same position of GP63 in the corresponding WB. Besides, zymography was done using samples containing several protein inhibitors, to guarantee that metalloprotease activity would be preserved, but may other proteases would be inactive.

Other works have used similar approaches, such as the ones by Duque et al., 2019 and Hassani et al., 2014.

It seems to me that the authors have already answered several questions from other reviewers, as well as improved writing and data presentation, and now the article is almost suitable for publication.

- Minor Revision (Line numbers are missing, which can make it difficult to find the text)

R: We apologize for that. Line numbers were included.

ABSTRACT

I cannot understand how “contradictory results shed light”…. it looks confused to me

R: We agree with this reviewer. We have modified the text to “These results shed light to the gaps in our knowledge of metacyclogenesis in L. amazonensis and to proteins that should be studied in the context of infection by this species.”

INTRODUCTION

Page 4- The authors use “vector and host”, however, vector is also host

R: The reviewer is correct. We have changed host for mammalian host.

M & M

2.3 - What is the quantity and/or volume of parasites? 1X not required. PBS pH?

R: 2 x 106 promastigotes were collected in each of the 5 tubes prepared for each strain. This information was added to the text. Thank you.

2.5 – Number of cells are missing in some protocols. Fixed with 4% paraformaldehyde (Water or PBS?)

R: The number of cells was mentioned in the text: “Cells stained with 0.4% trypan blue were counted using a hemocytometer and 4 x 105 viable cells were plated… macrophages were incubated with parasites at multiplicity of infection (MOI) of 10:1”. Cells were fixed in PBS containing 4% paraformaldehyde.

2.12- Primer sequence of HASP (or HASPA)? After all, was HASP (or HASPA?) used or not? It is not described here, but it appears in the result (page 25), and in the caption of Figure 10, but not in the bars of Figure 10!

R: Sorry, results obtained for HASP were not of good quality, and thus were not included in the figure. I apologize for not removing from the previous version of the text.

Reviewer #2: The work presented by the authors aims to analyze the protein composition of two strains of Leishmania amazonensis (PH8 and LV79) that show differences in relation to the infectivity of murine macrophages. In this work, a proteomic analysis of material enriched with membrane proteins was performed. The authors performed in vitro adhesion and phagocytosis assays which revealed that the PH8 strain has a greater adhesion capacity and is also more endocytosed by macrophages than the LV79 strain. Validation experiments of data obtained in proteomics were performed using techniques such as Western blot and Real time RT-PCR, which provided robustness to the analyses. The result obtained with the GP63 zymogram could be more accurate and revealing if the authors had used a fluorescent peptide substrate, such as Dansyl-AYKKWV-NH2. Overall the manuscript is well written in correct and objective English.

R: We would like to thank reviewer 2 for the positive analysis of our work in terms of experiments, validations and text quality. We agree that the use of fluorescent peptides in activity assays would add more precision to GP63 analysis. Unfortunately, we are not able to do this assay at this moment, but we will include it in future experiments.

Reviewer #3: The manuscript PONE-D-22-07087 reports on the in vitro infection capability and proteomics analysis of two Leishmania amazonensis strains associated with different severity of cutaneous leishmaniasis in BALB/c mice. Bone marrow-derived macrophages were used for comparing parasites’ adherence and infectivity and membrane-enriched fractions of early stationary phase promastigotes were analyzed by label-free proteomics. The study is technically fair; however, there are some issues that authors are encouraged to address.

R: We would like to thank this reviewer for careful revision and for the precise summary of our work.

Major comments:

- Pag. 6. The end of the introduction is a summary of the results. Instead of this summary, the authors could clarify in that final paragraph what was the hypothesis and the objective of the study, since it is not clear why to return to an in vitro infection with promastigotes after having made a comparative analysis of amastigotes obtained from in vivo infections. On the one hand the authors mention phenotypic differences (emphasizing membrane proteins), on the other they seem to be interested in metacyclogenesis. So, it is not clear in the text, what is the main objective.

R: Thank you for the suggestion. We have modified this last paragraph, removing repetition and explaining the aim of the study.

- Pag. 10. Authors state: “For total protein extracts (used in SDS-PAGE, western blot and zymography), promastigotes were resuspended in PBS with protease inhibitor cocktail (Fermentas) at a final density of 2 x 109 parasites/mL. Parasites were lysed by eight cycles of freeze and thaw (liquid nitrogen and 40oC).” This way of lysing parasites favors soluble proteins while membrane proteins remain in the debris. Please clarify which fraction was used for the SDS-PAGE, WB and Zym assays?

R: For total extracts we lysed promastigotes by freeze and thaw and used the lysate without prior centrifugation. Thus, both soluble and membrane proteins were present.

- Pag. 16. Item 3.1. During the encounter of the parasites with the phagocytic cells, both the parasites actively infect the cells (when they are infectiuos) and the cells actively phagocytize the parasites. Decrease in the infective capability of the former or phagocytic capability of the latter would result in lower rates of infection. It is not clear to this reviewer why the authors describe the results in terms of phagocytosis and make no mention of the infectivity of the strains. It is also not clear why, if they talk about phagocytosis, there is no specific control for this, such as latex beads.

R: The reviewer has raised an interesting “contradiction” on the use of the term infectivity. It is considered that Leishmania does not actively infect or invade macrophages; instead, they are phagocytosed. However, the term infective capacity or infectivity is frequently employed.

The same macrophage was employed for both strains, so the difference in binding and phagocytosis is due to differences in surface molecules of the two strains. Since we wanted to have a comparative (qualitative) analysis of binding and internalization of PH8 and LV79, we didn´t employ latex beads.

- Figure 1. Figure 1A, describing the results in terms of 500 cells is not clear. Please describe the number of parasites attached per cell (in the population of 500 cells tested) or alternatively the percentage of cells with parasites attached (in the population of 500 cells tested). The same applies to figure 1B, describe the number of phagocytosed parasites per cell.

R: We opted to mention parasites attached in 500 cells because the numbers of parasites were a little lower than usual in this experiment. In fact, due to the short time of parasite: macrophage contact (5min) in phagocytosis assay, numbers of parasites attached and phagocytosed are sometimes quite low. We do agree that mentioning parasites per cell would be better, but we would have to show decimal numbers. Since the aim of the experiment is a comparative view of the two strains, we chose to represent in 500 cells, showing numbers above 1.

- Pag. 18. Figure 2. As described in the methods, the total protein extracts for SDS-PAGE and Western blotting were prepared differently than the membrane and cytoplasmic fractions. In figure 2, total protein only appears to represent the soluble fraction, so it would be more correct to present the total protein extract from which the M and C fractions were prepared.

R: The reviewer has raised an interesting point about the way we prepared the total protein mentioned in figure 2. We could have done this extract in parallel and with the same solutions we used for membrane and cytoplasmic fractions obtained by ultracentrifugation, so that the comparison would be more precise. Anyway, we consider that membrane x cytoplasmic comparison is the most important for validation of the extraction protocol, so we believe figure 2 is valid.

- Page 18. Supplementary table 1. For quantification and clusterization, proteins identified with only one peptide should be excluded. Please, exclude those proteins.

R: For protein identification, at least one razor + unique peptide was required. We chose this criterium because several Leishmania proteins, such as GP63, belong to multigene families, and a combination of razor and unique peptides allows for a confident identification of proteins within these families. For quantification, we required at least two ratio counts. Sup table 1 shows all proteins identified and quantified using the parameters described above.

- Page 19. Supplementary table 4. This table presents fold change values, but it is not clear if these are based on the LFQ or iBAQ values. Please clarify that in the legend of the table.

R: Fold changes are based on LFQ. This information is mentioned in the legend: “fold change PH8/LV79 (based on LFQ Intensity values)”.

Regarding the iBAQ values, could it be clarified in the text why these values were included and how they were used in the analysis of the results?

R: iBAQ values were included as an additional parameter but were not employed for other calculations. iBAQ was requested by a former reviewer, and we opted to keep it only in the table.

LFQ (label-free quantitation) values were used for the quantitative comparison between the two strains and downstream analyses.

- Pag. 20. The authors report that only 14% of the identified proteome has at least one transmembrane domain, which reveals that proteins from other cell compartments would be the majority in the analyzed membrane fraction. Given this finding, the data should be better filtered based on the results of the predictors so that only proteins with predicted transmembrane domains are included in the final list, giving more robustness to the result. For this reviewer, 14% (~230 proteins), being stringent and restricted to only true membrane proteins, would be a much more interesting group to analyze and discuss. Alternatively, an analysis of the cytosolic fraction could be done for comparison and subtraction from the membrane fraction.

R: The prediction of transmembrane (TM) domains is based on the in-silico translated amino acid sequences obtained by genomic data. However, in Leishmania (and other trypanosomatids) there are several membrane proteins that do not have TM domains but that are anchored by GPI anchors and other structures added after posttranslational modifications. Besides, there are proteins that are membrane associated and have roles outside the cell.

In order to identify differentially modified proteins and map the majority of regulated proteins, we initially considered the entire dataset without filtering proteins with TM domains.

Furthermore, we validated a set of selected proteins focusing mainly on membrane proteins.

- Page 21. First paragraph. Once again, these results show that the data probably needs to be better filtered so as not to lose focus on the membrane proteins involved in adhesion and infection.

R: We believe the reviewer refers to the biological process related to the regulated proteins. Indeed, differentially regulated proteins are mostly associated to translation, carbohydrate, amino acid or nucleotide metabolism, cytoskeleton composition and vesicle and membrane trafficking, functions not related to adhesion and infection. As mentioned in the previous question, we opted not to filter TM proteins because many Leishmania proteins can be located in the plasma membrane even without TM domains. Besides, classification in processes can be sometimes misleading because proteins can have more than one function. Indeed, processes such as “proteolysis” and “carbohydrate metabolism” can include proteins known to be also located in membrane, as GP63 and enolase, respectively. Additionally, many proteins are not classified in processes, although certainly located in the membrane. One example is Putative ATP-binding cassette protein subfamily G, member 1 (E9AKN6), 23 times more abundant in PH8 (sup table IV).

- Pag 21. Figure 6. How do the authors explain that the total extracts of both strains do not contain what was observed in the membrane fractions? Please explain.

R: I am not sure if we understood the reviewer´s comment. GP63 was quantified in Western blot of total and membrane-enriched fractions. In WB of membrane-enriched fractions, GP63 labeling is shown together with tubulin labeling, so we observe more bands. We have included this information in the figure legend.

- Page 22. First paragraph and figure 6C. It is not clear why the authors credit the 50 kDa band to GP63. In zymography the electrophoretic migration of proteins is retarded, so enzyme activity may appear in regions above (not below) the calculated theoretical molecular mass for the protein. Thus, the molecular mass values of the observed proteolytic activities should be reviewed in figure 6C. Moreover, assigning a proteolytic band to GP63 solely based on electrophoretic migration is wrong. The most that can be said is that they are metallopeptidases that migrate in that molecular mass and even so, this figure lacks a control with a specific inhibitor for this class of enzymes, to demonstrate that they are metallopeptidases and not another class of peptidases. That control should be included.

Also, please describe in the legend to figure 6 what panel C-right is.

R: The reviewer is correct to expect that migration should be retarded in zymography. However, the non-reducing Western blot for GP63 shown in the right panel of Fig 6C indicates an accelerated migration for GP63 in such conditions. Bouvier et al., 1985 reported similar findings in a previous study (see reference at the end of the document).

We agree with the reviewer that we cannot precisely assign the band to GP63 without the counterproof with a specific inhibitor. We have modified the text accordingly. Panel C-right is a non-reducing Western blot for GP63, included as reference of migration. Sorry for not mentioning it. This information was included in the legend.

- Page 23. Item 3.7, first paragraph. For this reviewer, this is due to the limitations of the methodology used for the enrichment of membrane proteins and it is again suggested to better filter the data so that proteins without transmembrane domains are not included.

R: As mentioned on a previous answer, we agree that several proteins contribute to these “phenotypes”, but we opted not to filter data in order not to lose potential membrane proteins. Since all extracts were processed in parallel and using the same protocol, we compared samples in terms of all proteins identified and proteins of interest were validated by different methods.

- Fig. 8. Cytometry profiles are very different between strains on day 4 of culture. While in the growth curve, on day 4 the strains seem to have the same number of parasites and to be in the same growth phase (early stationary), the analysis by cytometry shows completely different profiles. How do the authors explain that?

R: We expected that LV79 and PH8 would have similar culture compositions on day 4, since growth curves were very similar. Cytometry experiments were performed to clarify the differences observed in the proteomes, which suggested that PH8 cultures had more metacyclic promastigotes than LV79. Curiously, cytometry profiles suggested that LV79 had more metacyclics than PH8, an observation supported by morphometric analysis. Although we have no explanation for these observations, differences in metacyclic composition were already reported in parasite cultures with similar growth curves. Indeed, Manzano et al showed that the deletion of LABCG genes 1 and 2 in L. major increased parasite susceptibility to human complement lysis and decreased the proportion of metacyclics in stationary cultures, although transgenic parasites had growth curves similar to wild type counterparts. These results are similar to what we found in LV79 and PH8: similar growth curves but differences in metacyclic composition.

- Pag. 26-27. Authors state: “Only 3% of the proteins were localized in the cell membrane, probably because sodium carbonate extraction promotes the enrichment of integral membrane proteins, including those belonging to intracellular organelles. Although the percentage of integral membrane proteins is low, other studies that perform cell fractionation of Leishmania promastigotes by differential centrifugation have also failed to achieve a significant enrichment [44, 45].” If authors filter better the data, I suggest correcting this percentage for the 14% reported before (proteins with transmembrane proteins). I also suggest rewriting this paragraph since it does not seem correct to justify the low number of membrane proteins obtained in this study, using the failure that other studies have shown in this enrichment.

R: We thank the reviewer for the suggestions. As we mentioned previously, cell membrane proteins may have TMs, may have non-protein anchors or may be bound to other proteins. Thus, we cannot replace this number by TM proteins. We opted to remove the information about proteins in cell membrane from the text, and not to mention failures from other studies, as suggested by the reviewer. Thank you.

- Pag. 27. Interestingly, ABCG1 is a phosphatidylserine transporter potentially involved in oxidative stress and metacyclogenesis among others (Parasites Vectors 10, 267 (2017). https://doi.org/10.1186/s13071-017-2198-1). The authors are encouraged to elaborate on this.

R: The reviewer has called attention to a very interesting subject. Indeed, the mentioned paper shows that LABCG1 and 2 have PS floppase activity, are involved in autophagy and redox metabolism and affect infectivity, virulence and metacyclogenesis. PH8 strain, which shows much higher levels of LABCG1 than LV79, is also more infective and virulent. We have included this information in the text. Thank you.

- Pag. 28. The authors cannot claim that the observed proteolytic activities are due to GP63. Please re-write that paragraph.

R: We do agree that our results suggest that GP63 activity is higher in PH8, but other assays are required to prove that. We have modified the text accordingly: “However, zymography (based on a band with the same migration of GP63 in non-reducing WB) suggests that GP63 proteolytic activity is higher in PH8 promastigotes and therefore may contribute to its virulence These results, which must be confirmed by other assays, may indicate that GP63 activity is not directly proportional to its expression, however there is little information about the regulation of GP63 activity in Leishmania.

- Page 29. This reviewer suggests avoiding discussing metabolic differences as these proteins appear to be "contaminants" of the membrane fractions and there are no other assays showing differences in the mentioned metabolic pathways between the strains.

R: Although our focus was on membrane proteins, the low enrichment of these proteins called attention to unexpected differences in other categories. The distinct profile of the two strains in terms of protein categories related to metabolic process suggests that the differences are robust and real. We opted to include discussion about metabolic differences since it is known that some Leishmania enzymes may also be located on the surface, sometimes with “moonlight functions” such as enolase, and to stimulate other groups to study LV79 and PH8 and other Leishmania strains in terms of metabolic differences.

Minor comments:

• Page 3 Introduction. Whenever the subgenus is mentioned, the genus should be mentioned first. Please correct for L. Leishmania and L. Viannia

R: We apologize for the mistake. Thank you very much for the careful revision.

• Pag. 4. Leishmania infantum chagasi is not a species, L. chagasi is a synonym of L. infantum.

R: We agree and revised the text.

• Pag. 4. It is important to mention that the main characteristic of the diffuse form caused by L. amazonensis is the absence of cell-mediated immunity.

R: Thank you. We have added this information.

• Pag. 6. Authors state: “… This conflicting data indicates that metacyclogenesis in L. amazonensis is a complex issue and that different methods must be used to characterize parasite stages and to search for factors involved in infectivity.” The results shown in the manuscript do not support this statement. Please moderate to sentence.

R: We have removed this phrase from page 6 and have focused on the main aims of the paper. Thanks for the suggestion.

• Pag. 7. Item 2.2. This reviewer suggests making a more complete description of these strains, such as their origin and the host from which they were isolated.

R: We have added your suggestion to the text, thank you. L. amazonensis PH8 strain (IFLA/ BR/1967/PH8) was isolated from the sand fly Lutzomyia flaviscutellata from Pará State, Brazil, while L. amazonensis LV79 (MPRO/BR/72/M 1841) was obtained from the rodent Proechimys sp also from Pará.

• Page 8. Item 2.4. Please, clearly describe how the synchronization of the cultures was done.

R: Sorry for the incomplete description. We have modified it to “Cultures were synchronized by sub culturing 3 times for 2x106/mL every 3 days”.

• Page 8. Last paragraph. Please explain why this infection was made at that temperature (4°C) and how it reflects (or not) the natural interaction of these cells (macrophages-parasites)

R: The incubation at 4oC for 2 hours allows parasite contact with macrophage but not internalization. For a “adhesion” or “binding” assay, cells would be fixed after this step. The further incubation at 34oC 5% CO2 for 5 minutes used in our protocol allows phagocytosis of Leishmania. We have employed the same protocol in Galuppo et al.

• Supplementary figure 2. Instead of being supplemental, this figure could be added to the current figure 2.

R: We opted to keep it as supplemental since validation of the membrane- enrichment protocol was performed before this experiment and is shown in figure 2.

• In figure 10 the titles of the Y axis are missing

R: We apologize for this mistake. Y axis should be “fold change in mRNA expression”

REFERENCES

Guillermo Arango Duque, Armando Jardim, Étienne Gagnon, Mitsunori Fukuda, Albert Descoteaux.The host cell secretory pathway mediates the export of Leishmania virulence factors out of the parasitophorous vacuole. PLoS Pathog. 2019 Jul 29;15(7): e1007982. doi: 10.1371/journal.ppat.1007982.

Kasra Hassani, Marina Tiemi Shio, Caroline Martel, Denis Faubert, Martin Olivier. Absence of metalloprotease GP63 alters the protein content of Leishmania exosomes. PLoS One .2014 Apr 15;9(4):e95007. doi: 10.1371/journal.pone.0095007.

Bouvier J.; Etges, R. J.; Bordier, C. Identification and purification of membrane and soluble forms of the major surface protein of Leishmania promastigotes. Journal of Biological Chemistry, v. 260, n. 29, p. 15504-15509, dez. 1985

Manzano JI, Perea A, León-Guerrero D, Campos-Salinas J, Piacenza L, Castanys S, Gamarro F. Leishmania LABCG1 and LABCG2 transporters are involved in virulence and oxidative stress: functional linkage with autophagy. Parasit Vectors. 2017 May 30;10(1):267. doi: 10.1186/s13071-017-2198-1.

Galuppo MK, de Rezende E, Forti FL, Cortez M, Cruz MC, Teixeira AA, Giordano RJ, Stolf BS. CD100/Sema4D Increases Macrophage Infection by Leishmania (Leishmania) amazonensis in a CD72 Dependent Manner. Front Microbiol. 2018 Jun 5;9:1177. doi: 10.3389/fmicb.2018.01177

Submitted filename: Reviewers PlosOne_answers_25052002.pdf

Click here for additional data file.

5 Jul 2022

Proteome and morphological analysis show unexpected differences between promastigotes of Leishmania amazonensis PH8 and LV79 strains

PONE-D-22-07087R1

Dear Dr. Stolf

We’re pleased to inform you that your manuscript has been judged scientifically suitable for publication and will be formally accepted for publication once it meets all outstanding technical requirements.

Within one week, you’ll receive an e-mail detailing the required amendments. When these have been addressed, you’ll receive a formal acceptance letter and your manuscript will be scheduled for publication.

An invoice for payment will follow shortly after the formal acceptance. To ensure an efficient process, please log into Editorial Manager at http://www.editorialmanager.com/pone/, click the 'Update My Information' link at the top of the page, and double check that your user information is up-to-date. If you have any billing related questions, please contact our Author Billing department directly at authorbilling@plos.org.

If your institution or institutions have a press office, please notify them about your upcoming paper to help maximize its impact. If they’ll be preparing press materials, please inform our press team as soon as possible -- no later than 48 hours after receiving the formal acceptance. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information, please contact onepress@plos.org.

Kind regards,

Yara M. Traub-Csekö

Academic Editor

PLOS ONE

Additional Editor Comments (optional):

Reviewers' comments:

Reviewer's Responses to Questions

Comments to the Author

1. If the authors have adequately addressed your comments raised in a previous round of review and you feel that this manuscript is now acceptable for publication, you may indicate that here to bypass the “Comments to the Author” section, enter your conflict of interest statement in the “Confidential to Editor” section, and submit your "Accept" recommendation.

Reviewer #2: All comments have been addressed

Reviewer #3: All comments have been addressed

**********

2. Is the manuscript technically sound, and do the data support the conclusions?

The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented.

Reviewer #2: Yes

Reviewer #3: Partly

**********

3. Has the statistical analysis been performed appropriately and rigorously?

Reviewer #2: Yes

Reviewer #3: I Don't Know

**********

4. Have the authors made all data underlying the findings in their manuscript fully available?

The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified.

Reviewer #2: Yes

Reviewer #3: Yes

**********

5. Is the manuscript presented in an intelligible fashion and written in standard English?

PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here.

Reviewer #2: Yes

Reviewer #3: Yes

**********

6. Review Comments to the Author

Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters)

Reviewer #2: The authors answered all my questions and I consider the article ready to be published. So I have nothing more to add.

Reviewer #3: (No Response)

**********

7. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.

If you choose “no”, your identity will remain anonymous but your review may still be made public.

Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.

Reviewer #2: No

Reviewer #3: No

**********

11 Aug 2022

PONE-D-22-07087R1

Proteome and morphological analysis show unexpected differences between promastigotes of Leishmania amazonensis PH8 and LV79 strains

Dear Dr. Stolf:

I'm pleased to inform you that your manuscript has been deemed suitable for publication in PLOS ONE. Congratulations! Your manuscript is now with our production department.

If your institution or institutions have a press office, please let them know about your upcoming paper now to help maximize its impact. If they'll be preparing press materials, please inform our press team within the next 48 hours. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information please contact onepress@plos.org.

If we can help with anything else, please email us at plosone@plos.org.

Thank you for submitting your work to PLOS ONE and supporting open access.

Kind regards,

PLOS ONE Editorial Office Staff

on behalf of

Dr. Yara M. Traub-Csekö

Academic Editor

PLOS ONE