The genetic study of multi-incident families is a powerful tool to investigate genetic contributions to the development of Parkinson's disease. In this study, we identified the rare PTPRA p.R223W variant as one of three putative genetic factors potentially contributing to disease in an Australian family with incomplete penetrance. Whole exome sequencing identified these mutations in three affected cousins. The rare PTPRA missense variant was predicted to be damaging and was absent from 3,842 alleles from PD cases. Overexpression of the wild-type RPTPα and R223W mutant in HEK293T cells identified that the R223W mutation did not impair RPTPα expression levels or alter its trafficking to the plasma membrane. The R223W mutation did alter proteolytic processing of RPTPα, resulting in the accumulation of a cleavage product. The mutation also resulted in decreased activation of Src family kinases. The functional consequences of this variant, either alone or in concert with the other identified genetic variants, highlights that even minor changes in normal cellular function may increase the risk of developing PD.
The genetic study of multi-incident families is a powerful tool to investigate genetic contributions to the development of Parkinson's disease. In this study, we identified the rare PTPRA p.R223W variant as one of three putative genetic factors potentially contributing to disease in an Australian family with incomplete penetrance. Whole exome sequencing identified these mutations in three affected cousins. The rare PTPRA missense variant was predicted to be damaging and was absent from 3,842 alleles from PD cases. Overexpression of the wild-type RPTPα and R223W mutant in HEK293T cells identified that the R223W mutation did not impair RPTPα expression levels or alter its trafficking to the plasma membrane. The R223W mutation did alter proteolytic processing of RPTPα, resulting in the accumulation of a cleavage product. The mutation also resulted in decreased activation of Src family kinases. The functional consequences of this variant, either alone or in concert with the other identified genetic variants, highlights that even minor changes in normal cellular function may increase the risk of developing PD.
Parkinson’s disease (PD) is the second most common neurodegenerative disease worldwide with prevalence estimated at 0.3% of the entire population, and 1% in persons over 60 years of age [1]. It is characterised by a slow and chronic loss of dopaminergic neurons in the substantia nigra pars compacta (SNpc), located in the midbrain [2]. PD presents primarily as motor symptoms, which include gate dysfunction, bradykinesia, rigidity, and resting tremors [3, 4].The exact mechanism behind the pathogenesis of PD remains unknown. However, both environmental and genetic factors are suggested to play a role. Approximately 10–15% of PD patients report a first-degree relative with PD [5, 6], with SNCA, LRRK2 and VPS35 robustly linked to late-onset familial PD. Mutations in these genes are variably penetrant, but can lead to rare monogenic forms of PD, which account for approximately 2% of PD in populations of European descent [7, 8]. The identification of novel disease-causing mutations provides opportunities to understand aberrant molecular processes that can lead to disease. A genomic analysis of probands from 18 multi-incident families in Queensland had only identified one kindred that could ascribe to a known genetic form of disease [9] suggesting that other contributing factors have yet to be elucidated. Given both the discrepancy between cases with a family history of disease and known monogenic carriers, as well as the benefit of identifying novel targets for disease, we have been investigating novel genetic causes of PD using multi-incident families.In this study we identified affected members of a Queensland family with PD sharing three missense single nucleotide variants (SNVs) in genes PTPRA, ARL14EP and HYDIN (Fig 1A and 1B). Due to the change in charge and high Combined Annotation Dependent Deletion (CADD) score for the p.R223W single nucleotide variation in PTPRA, this gene was chosen for further analysis. PTPRA encodes the type I integral membrane phosphatase, receptor protein tyrosine phosphatase alpha (RPTPα). Mutations in PTPRA have been identified as segregating with disease in a family with schizophrenia and in other unrelated patients with this disease. Moreover, there is also evidence that variants in this gene may increase patients susceptibility to schizophrenia and autism spectrum disorders [10, 11]. RPTPα has a short extracellular, N-glycosylated region, a transmembrane domain, a short cytosolic wedge region and two catalytic phosphatase domains (D1 and D2) (Fig 1C). The catalytic activity of RPTPα is found within this tandem arrangement of cytosolic phosphatase domains [12]. Unlike other PTPases, both catalytic domains of RPTPα are active, though D1 (the membrane proximal domain) has catalytic activity 4–5 orders of magnitude more active against phosphotyrosine (pY) peptides than D2, the membrane distal domain [13]. RPTPα is responsible for activating Src family kinases (SFKs) such as Src and Fyn by dephosphorylating their inhibitory phosphorylated tyrosine residues (Y527 and Y530 respectively) and promoting SFK signalling for cell proliferation, integrin signalling and neuroinflammation [14-16]. The p.R223W mutation is situated within the wedge region, just N-terminal of D1, in a region implicated in homodimerisation stability [17] and activity regulation [18]. In addition to homodimerisation, proteolytic cleavage has been suggested as a mechanism to regulate RPTPα activity. RPTPα reportedly undergoes processing by calpain in the cytoplasm, resulting in reduced phosphatase activity [19].
Fig 1
(A) Pedigree of the family carrying the PTPRA mutation. ’M’ indicates confirmed heterozygous carriers of PTPRA mutation, italicised ’M’ indicates inferred genotype. Shaded lower right shapes represent PD and upper left represents undiagnosed tremor. Squares represent males, circles represent females and diamonds represent undisclosed gender. Dark triangle represents proband. Diagonal lines represent deceased members. Non-essential pedigree information has been omitted or modified to protect the privacy of the family. Subtext indicates pedigree ID (QPP ID), age / age of death and age at symptom onset. (B) Description of shared rare missense variants identified in three affected cousins. CDS: Coding DNA sequence, gnomAD: Genome Aggregation Database, SGC: Sydney Genomics Collaborative, CADD: Combined Annotation Dependent Depletion. (C) Schematic diagram of the RPTPα protein. Orange lines represent N-linked glycosylation sites. TMD = transmembrane domain. Arrow indicates the R223W mutation. D1 and D2 are the phosphatase domains.
(A) Pedigree of the family carrying the PTPRA mutation. ’M’ indicates confirmed heterozygous carriers of PTPRA mutation, italicised ’M’ indicates inferred genotype. Shaded lower right shapes represent PD and upper left represents undiagnosed tremor. Squares represent males, circles represent females and diamonds represent undisclosed gender. Dark triangle represents proband. Diagonal lines represent deceased members. Non-essential pedigree information has been omitted or modified to protect the privacy of the family. Subtext indicates pedigree ID (QPP ID), age / age of death and age at symptom onset. (B) Description of shared rare missense variants identified in three affected cousins. CDS: Coding DNA sequence, gnomAD: Genome Aggregation Database, SGC: Sydney Genomics Collaborative, CADD: Combined Annotation Dependent Depletion. (C) Schematic diagram of the RPTPα protein. Orange lines represent N-linked glycosylation sites. TMD = transmembrane domain. Arrow indicates the R223W mutation. D1 and D2 are the phosphatase domains.To study the functional consequences, if any, of RPTPαR223W we generated mammalian expression constructs and carried out systematic cellular and molecular approaches to evaluate if RPTPαR223W affected RPTPα activity.
Methods
Ethics statement
All donor tissue and information were obtained with informed and written consent of the participants. All procedures were in accordance with National Health and Medical Research Council Code of Practice for Human Experimentation and approved by the Griffith University Human Experimentation Ethics Committee, Approval Number ESK/04/11/HREC.
Genetic analysis
As detailed previously [9] the proband from family #431, a multi-incident family enrolled in the Queensland Parkinson’s Project, was found not to carry known and highly suspected genetic causes of disease, including point mutations, indels, trinucleotide expansions and gene dosage. An analysis of rare missense sequence variants shared with affected members of the family was conducted through whole exome sequencing of the proband III:2, III:1 and III:4. Briefly, Ion AmpliSeq exome libraries were sequenced on the Ion Proton (Thermo Fisher Scientific), and subsequent variant calling was performed using the Torrent Suite (v4.0) (Thermo Fisher Scientific). Annotation was facilitated by the ANNOVAR package [20]. Sequence variants shared amongst the affected members and had a minor allele frequency less than 0.0001 in the gnomAD [21] were selected. Aligned whole exome sequencing data (BAM) presented in this report have been uploaded to NCBI SRA. BioProject ID: PRJNA844215. SRA IDs: SRR19500741 and SRR19500742.
Expression constructs
RPTP⍺ (splice variant 1; transcript ID ENST00000216877.10) was amplified from HEK293T cDNA using KOD polymerase with 5’ aatB sites for gateway cloning, 5’ Kozak sequence and no stop codon using the following primers: 5’-GGGGACAAGTTTGTACAAAAAAGCAGGCTTAGCCGCCAT GGATTCCTGGTTCATTCTTG-3’ and 5’-GGGGACCACTTTGTACAAGAAAGCTGGGTACTTGAAGTT GGCATAATCTGAG-3’. RPTPα-aatB was subcloned into pDONR201 and then into pcDNA3.1-3xFLAG-V5-ccdB (a gift from Susan Lindquist & Mikko Taipale (Addgene plasmid #87064)) using BP Clonase II and LR Clonase II respectively according to the manufacturer’s instructions (Thermo Fischer Scientific). Mutations were introduced by inverse PCR using KOD polymerase and the following primers for R223W: 5’- CTGGAAGAGGAAATTAACTGGAGAATGGCAGAC -3’ and 5’- GTCTGCCATTCTCCAGTTAATTTCCTCTTCCAG -3’, and for Sv4: 5’- CTTTCCCTCCTTCAGGTAATTCTGACTCGAAGGACAGAAGAGATGAGACACCAATTATTG -3’ and 5’–TTGGTGTCTATCTCTTCTGTCCTTCGAGTCAGAATTACCTGAAGGAGGGAAAGTTTC -3’. DpnI (NEB) treated mutagenesis PCR products were transformed into XL10-gold supercompetent E. coli (Agilent). Correct sequence identity was verified by Sanger sequencing.
Cell culture and transfection
HEK293T cells (ATCC) were cultured in Dulbecco’s modified Eagle medium (DMEM/F12; Thermo Fischer Scientific) supplemented with 10% foetal calf serum (FCS;Thermo Fischer Scientific) at 37°C, 5% CO2. For immunoblot experiments 100,000 cells were plated in a 24-well plate (Nunc) overnight and constructs transfected with Lipofectamine 2000 (Thermo Fischer Scientific). For immunofluorescence (IF) experiments, cells were plated overnight and transfected with Lipofectamine 2000. After 24 hours, cells were replated onto a 384 well CellCarrier plate (PerkinElmer). The cells were either lysed or fixed 48 hours post-transfection. Lysis was performed using TNE-TX buffer (10mM Tris, 150 mM NaCl, 1mM EDTA, 1% Triton X-100, cOmplete protease inhibitors (Sigma), cOmplete phosphatase inhibitors (Sigma)), incubating for 20 min on ice and centrifugation for 5 min at 4°C. Alternatively, lysis for signalling experiments was performed using TNE-SDS buffer (10mM Tris, 150 mM NaCl, 1mM EDTA, 1% SDS, cOmplete protease inhibitors (Sigma), cOmplete phosphatase inhibitors (Sigma)), incubating 10 min on ice, before sonicating and centrifugation for 10 min. For IF experiments, cells were washed in ice cold PBS and fixed in 4% PFA (Sigma) for 10 min.
Stable cells
pcDNA3.1-RPTP⍺-3xFLAG-V5, pcDNA3.1-RPTP⍺R223W-3xFLAG-V5, pcDNA3.1-Sv4WT-3xFLAG-V5 and pcDNA3.1-Sv4R232W-3xFLAG-V5 were linearised with FspI and transfected into 6 well plates containing various densities of HEK293 cells. After 48 hours, cells were passaged in DMEM/F12 containing 150 μg/ml hygromycin (Thermo Fischer Scientific) and 10% FCS, with media replaced every three days until stable colony formation. All wells containing non-transfected HEK293 cells died in the presence of 150 μg/ml hygromycin. Stable colonies were isolated and expanded in DMEM/F12 containing 150 μg/ml hygromycin and 10% FCS and expression verified by immunofluorescence and immunoblotting.
Cell treatments
For Endo H experiments lysates were aliquoted and treated in the presence or absence of 250U EndoH (NEB) for 2 hours at room temperature prior to immunoblotting. For cleavage experiment cells were treated 4 hours prior to lysis with, 10μM MG132 (Calbiochem), 1μM DAPT (Sigma), 200nM phorbol 12-myristate, 13-acetate (PMA, Sigma), 20μM TAPI-2 (Calbiochem), 10μM BB94 (Calbiochem), 10μM BIV (Calbiochem). For EGF experiments, stable RPTPα expressing HEK293 cells were plated at 500,000 cells/well in 6-well plates. Twenty-four hours after plating, the media was replaced with DMEM/F12 for 18 hours prior to addition of 100ng/ml EGF (Thermo Fischer Scientific) for the appropriate times prior to lysis.
Immunoblotting
Samples were prepared in 1X SDS sample buffer ± 100mM DTT (BioRad), boiled for 5 minutes and centrifuged for 30 sec. Immunoblots were performed using Tris-Glycine gels electrophoresed and transferred to nitrocellulose (GE Healthcare) membranes using standard protocols. Membranes were blocked for 60 min in PBS containing either 3% non-fat milk powder or 5% BSA and probed with appropriate primary antibodies overnight at 4°C (see Table 1. for details). Primary antibodies were detected by incubating the membranes in either: goat-anti-mouse-680RD and goat-anti-rabbit-800CW secondary antibodies (both 1:24,000); goat-anti-mouse-HRP antibody (1:20,000); or goat-anti-rabbit-HRP antibody (1:20,000) for 60 min. Membranes were imaged on an Odyssey-Fc imaging system (Licor).
Table 1
Antibodies used in this study.
Epitope
Company
Cat. No.
Dilution
FLAG
Sigma
F3165
1:3000
V5
Cell Signalling
#13202
1:3000
α-tubulin
Sigma
T5168
1:12,000
Phospho-PTPα (Y789)
Cell Signalling
#4481
1:1000
Src (36D10)
Cell Signalling
#2109
1:3000
Phospho-Src (Y416)
Cell Signalling
#6943
1:3000
Non-phospho-Src (Y527)
Cell Signalling
#2107
1:3000
Phospho-Tyrosine (P-Tyr-1000)
Cell Signalling
#8954
1:1000
Phospho-ERK1/2
Cell Signalling
#5726
1:3000
Src (L4A1)
Cell Signalling
#2110
1:3000
Immunoprecipitation
Protein G Sepharose 4 Fast Flow (GE Healthcare) beads were washed in TNE-TX before incubation with mouse anti-FLAG for one hour. The FLAG-sepharose was divided equally into tubes and each was incubated with lysates for 2 hours at room temperature by rotation. Immunoprecipitates were washed in TNE-TX and eluted in 2X SDS sample buffer, boiled for 5 mins and immunoblotted.
DTSSP crosslinking
Two days post-transfection, cells were washed twice with cold PBS before incubation with cold 3,3′-Dithiobis(sulfosuccinimidylpropionate) (DTSSP) (Thermo Fischer Scientific) at 4°C on ice for two hours. Excess DTSSP was quenched by the application of 1M Tris pH 7.5 for a further 15 minutes. Cells were then lysed using TNE-TX as previously described.
Microscopy
Fixed cells were blocked and permeabilised with PBS containing 1% BSA, 0.3% Triton X-100 for 60 mins at room temp and mouse-anti-FLAG (1:1000) were incubated for 90 min room temperature. After washing in PBS, detection was achieved by incubating with donkey-anti-mouse-488 (1:1000, Thermo Fischer Scientific) and DAPI (1:10,000, Sigma). Cells were imaged on an Operetta CLS system with an X63/1.15 objective.
Statistical analysis
Statistical analysis was preformed using GraphPad Prism (v8). All data are presented as means ± standard deviation. Comparisons between two groups were analysed using Student’s two-tailed unpaired t test.
Results
Genetic analysis identified a PTPRA mutation shared among PD affected members of a Queensland family
The multi-incident family enrolled in the Queensland Parkinson’s Project (QPP), family #431, presented with dominant inheritance, with notable incomplete penetrance, suggesting a substantial genetic component for disease within the family. The proband was excluded for known disease-causing mutations previously [9], thus analysis of the family aimed to identify putative disease-causing genetic lesions. The family presented with two unaffected members with inferred carrier status above the age of 80 years. Incomplete penetrance was anticipated due to the notable age- and ethnicity-dependent partial penetrance of the LRRK2 p.G2019S [22]. Whole exome sequence analysis was performed in three affected cousins, III:1, III:2, III:4, which identified three rare heterozygous missense variants shared between the members, PTPRA p.R223W (NM_080840), ARL14EP p.A146V (NM_152316) and HYDIN p.A2271E (NM_001270974) (Fig 1A). These genes and variants have not been implicated in parkinsonism previously and presented as novel putative targets for disease. The variants in PTPRA and ARL14EP were predicted to be damaging by both the SIFT and PolyPhen-2 programs and had CADD scores of 28.6 and 21.5, respectively (Fig 1B). The HYDIN variant was not predicted to be damaging. As the ARL14EPA146V variant was a conservative replacement and in our initial studies we observed no obvious differences between the ARL14EPWT and ARL14EPA146V proteins in pilot immunoblot or subcellular localisation studies (unpublished) we decided to pursue the RPTPα protein variant further. Furthermore, the PTPRA p.R223W variant was absent in 3,842 PD alleles across seven countries from the GeoPD consortium (www.geopd.net), suggesting it is rare across multiple ethnicities.
RPTPαR223W is transported to the plasma membrane
To investigate if the p.R223W mutation altered RPTPα protein stability and trafficking we first generated RPTPαWT and RPTPαR223W V5/Flag-tagged expression constructs. HEK293T cells were transfected with the RPTPαWT construct, lysed and analysed by immunoblot. RPTPαWT resolved primarily as two bands at ~160 kDa and ~120 kDa (Fig 2A). While the observed MW of RPTPα-V5/Flag is approximately 30 kDa larger than what is most commonly reported in the literature [23-26] it is not uncommon for the protein to be reported larger than 130 kDa [27-31] regardless of number or position of tags. As RPTPα undergoes N-glycosylation [23] the two bands likely represented post-Golgi (complex N-glycans) and endoplasmic reticulum (ER) forms of the protein. We confirmed this by treating lysates with endoglycosidase H (EndoH) which cleaves high mannose N-linked glycans present only in the ER and found that the ~120 kDa band was indeed sensitive to EndoH treatment whereas the ~160 kDa band was insensitive (Fig 2A). Next, we expressed both RPTPαWT and RPTPαR223W in HEK293T cells, lysed and analysed by immunoblot to investigate if the R223W mutation altered RPTPα stability. We found that both RPTPαWT and RPTPαR223W resolved primarily as the post-Golgi ~160 kDa form, with no significant change in abundance (Fig 2B). We next performed immunocytochemical staining of both RPTPαWT and RPTPαR223W transfected HEK293T cells to investigate the subcellular localisation of both proteins. As expected, we found that both the WT and R223W proteins were localised primarily at the plasma membrane (Fig 2C) indicating that the R223W protein was indeed correctly trafficked to the plasma membrane.
Fig 2
(A) Immunoblot of non-transfected (NT) and RPTPα wild-type (RPTPαWT) HEK293T cells. The lysates were treated in the presence (+) or absence (-) of endoglycosidase H (EndoH) detected with anti-V5 antibody. (B) Immunoblot of RPTPαWT and RPTPαR223W transfected HEK293T cells detected with anti-V5 antibody. (C) Immunofluorescent image of transfected HEK293T cells stained with anti-FLAG antibody. Scale bar = 10μm.
(A) Immunoblot of non-transfected (NT) and RPTPα wild-type (RPTPαWT) HEK293T cells. The lysates were treated in the presence (+) or absence (-) of endoglycosidase H (EndoH) detected with anti-V5 antibody. (B) Immunoblot of RPTPαWT and RPTPαR223W transfected HEK293T cells detected with anti-V5 antibody. (C) Immunofluorescent image of transfected HEK293T cells stained with anti-FLAG antibody. Scale bar = 10μm.
Upon further experimentation we discovered that RPTPαWT and RPTPαR223W also resolved as two extra lower molecular weight (MW) bands ~75 kDa (C1) and ~70 kDa (C2) (equivalent to ~70 kDa and ~65 kDa respectively without the C-terminal epitope tag) (Fig 3A) which fit with the literature for proteolytic cleavage, a common mechanism for regulation of type I membrane proteins, including RPTPα [19, 24, 32]. RPTPα is cleaved by an unknown protease to liberate the ~70kDa band [24] and by calpains to generate the ~65kDa band [19]. Surprisingly, we discovered that RPTPαR223W resolved a significantly higher proportion of the C1 band (Fig 3A) suggesting that proteolysis was perturbed in RPTPαR223W expressing cells. Based on the literature and the observed MW [24, 32] we hypothesised that the C1 band represented another metalloproteinase generated fragment and the C2 band was generated by calpain cleavage [19]. To validate that the C2 band was generated by calpains we treated RPTPαR223W expressing cells with MG132, which inhibits calpain cleavage of RPTPα [19]. As expected, the C2 band was not observed after MG132 treatment and the C1 fragment was not affected (Fig 3B). We also treated RPTPαR223W expressing cells with DAPT to investigate if the C1 fragment was produced by γ-secretase cleavage and discovered that neither cleavage fragment was altered by DAPT (Fig 3B). Following this, we treated RPTPαR223W expressing cells with metalloproteinase stimulator (PMA), metalloproteinase inhibitors (TAPI-2, BB94) and beta-secretase inhibitor IV (BIV), expecting that PMA would increase the abundance of the C1 band, TAPI-2/BB94 would inhibit the generation of the C1 band and BIV would have no effect on the banding pattern (Fig 3C). As expected BIV had no effect on the banding pattern. Unexpectedly, stimulation with PMA led to an increase in the C2 species and did not increase the abundance of the C1 fragment (Fig 3C). Furthermore, the broad-spectrum metalloproteinase inhibitors (TAPI-2 and BB94) inhibited the generation of the C2 band. These inhibitors had no influence on the C1 band (Fig 3C) indicating that the C2 species is a generated by metalloproteinases prior to calpain cleavage, and is not reliant on the production of C1. The C1 band is a cleavage product generated by an unknown mechanism that is independent of calpain cleavage. This cleavage product is significantly more abundant in RPTPαR223W expressing cells. Interestingly, when we investigated the phosphorylation state of both RPTPαWT and RPTPαR223W there was no difference in either phospho-RPTPαY789 (Fig 3D) or total phospho-tyrosine of the full-length protein (Fig 3E). Furthermore, when we investigated the tyrosine phosphorylation status of the C1 and C2 fragments we observed that they were not phosphorylated (Fig 3C and 3D) indicating that these fragments are potentially catalytically inactive.
Fig 3
(A) Immunoblot of RPTPαWT and RPTPαR223W transfected HEK293T cells. Arrow indicates RPTPαR223W specific ~75 kDa band. (B) Immunoblot of RPTPαR223W transfected HEK293T cells treated with MG132 or DAPT for 4 hours. (C) Immunoblot of RPTPαR223W transfected HEK293T cells treated with PMA, TAPI-2, BB94 or BIV for 4 hours. (D) Immunoblot of RPTPαWT and RPTPαR223W transfected HEK293T cells probed with pRPTPαY789 antibody. (E) Immunoblot of RPTPαWT and RPTPαR223W transfected HEK293T cells subjected to immunoprecipitation with FLAG antibody and probed with either phospho-tyrosine (pY) or V5 antibodies.
(A) Immunoblot of RPTPαWT and RPTPαR223W transfected HEK293T cells. Arrow indicates RPTPαR223W specific ~75 kDa band. (B) Immunoblot of RPTPαR223W transfected HEK293T cells treated with MG132 or DAPT for 4 hours. (C) Immunoblot of RPTPαR223W transfected HEK293T cells treated with PMA, TAPI-2, BB94 or BIV for 4 hours. (D) Immunoblot of RPTPαWT and RPTPαR223W transfected HEK293T cells probed with pRPTPαY789 antibody. (E) Immunoblot of RPTPαWT and RPTPαR223W transfected HEK293T cells subjected to immunoprecipitation with FLAG antibody and probed with either phospho-tyrosine (pY) or V5 antibodies.
The RPTPαR223W mutation does not affect phosphatase function but does alter SFK activation
As the R223W mutation lies within the wedge region, involved in homodimerisation, we expected that homodimerisation would be altered in RPTPαR223W expressing cells. RPTPα dimerisation is a transient event that is difficult to detect under steady state conditions requiring small molecule cross linkers for detection [25, 26]. Thus, we employed DTSSP, a thiol reducible amine crosslinker, for homodimerisation studies between RPTPαWT and RPTPαR223W expressing cells. As expected, a small fraction of RPTPαWT was recovered at a higher MW band corresponding to a dimer in the absence of DTT. Furthermore, these RPTPα dimers were confirmed by the absence of the higher MW band when the crosslinker was reduced by DTT (Fig 4A). Surprisingly, when we investigated RPTPαR223W expressing cells, dimers were recovered at an equivalent amount as in RPTPαWT expressing cells, suggesting that homodimerisation is not perturbed by the R223W mutation.
Fig 4
(A) Immunoblots of RPTPα transfected HEK293T cells under non-reducing or reducing conditions. Cells were crosslinked with DTSSP prior to lysis. (B) Immunoblots of HEK293 stable cells expressing RPTPαWT and RPTPαR223W treated with 100ng/ml EGF for the indicated times and probed with the labelled antibodies. (C) Quantification of the levels of pERK 1/2 (mean±SD, n = 3). (D) Quantification of the levels of npSrcY527 (mean±SD, n = 3).
(A) Immunoblots of RPTPα transfected HEK293T cells under non-reducing or reducing conditions. Cells were crosslinked with DTSSP prior to lysis. (B) Immunoblots of HEK293 stable cells expressing RPTPαWT and RPTPαR223W treated with 100ng/ml EGF for the indicated times and probed with the labelled antibodies. (C) Quantification of the levels of pERK 1/2 (mean±SD, n = 3). (D) Quantification of the levels of npSrcY527 (mean±SD, n = 3).As RPTPα acts directly on SFKs by dephosphorylating the inhibitory phosphorylated tyrosine (SrcY527/FynY530) we next investigated if the RPTPαR223W mutation had altered activity against these phosphorylated residues. To examine this, we generated stable HEK293 lines expressing RPTPαWT and RPTPαR223W. We depleted FCS from the RPTPα expressing cells for 18 hours and treated them in the presence and absence of 100 ng/ml EGF to reinitiate EGFR signalling [33]. We then lysed the cells and analysed the RPTPα activity by immunoblot analysis. As expected EGF stimulation resulted in ERK1/2 phosphorylation (Fig 4B). We observed a trend in increased ERK1/2 phosphorylation in RPTPαR223W cells compared to RPTPαWT cells (Fig 4C), though this increase did not reach significance. In addition, a trend toward increased phosphorylation of SrcY527 in RPTPαR223W compared to RPTPαWT was observed (Fig 4D), though again did not reach significance. This data suggests that phosphatase ability of the R223W mutant is not significantly impaired compared to WT when signalling is stimulated by EGF.To investigate if the potentially reduced dephosphorylation of SrcY527 resulted in altered activation of Src, we next investigated the phosphorylation of SrcY416, which undergoes auto-phosphorylation after the dephosphorylation of Y527. Stable HEK293 lines were depleted of FCS for 18 hours and then lysed and analysed by immunoblot. Cells were not treated with EGF as we found no added effect on Y416 above that seen with serum starvation (S1 Fig). In this paradigm we found no significant decrease in the ratio of SrcY416 phosphorylation in the RPTPαR223W expressing cells (1.23±0.07) compared to RPTPαWT (1.45±0.23) (Fig 5). To elucidate if these results were unique to the short RPTPα isoform, we repeated the experiment in HEK293 cells stably expressing the longer splice variant: RPTPα-Sv4WT and RPTPα-Sv4R232W. In contrast to splice variant 1, we observed a significant decrease in Y416 phosphorylation in RPTPα-Sv4R232W cells (1.03±0.15) compared to RPTPα-Sv4WT (1.50±0.19) expressing cells. These results suggest that while phosphatase activity is not affected by the R223W/R232W mutation downstream activation of Src is reduced in RPTPα-Sv4.
Fig 5
(A) Immunoblots of HEK293 stable cells expressing RPTPαWT, RPTPαR223W, RPTPα-Sv4WT and RPTPα-Sv4R232W and probed with the labelled antibodies. (B) Quantification of the ratio of pSrcY416 signal in RPTPα mutants compared to their respective RPTPαWT (mean±SD, n = 5).
(A) Immunoblots of HEK293 stable cells expressing RPTPαWT, RPTPαR223W, RPTPα-Sv4WT and RPTPα-Sv4R232W and probed with the labelled antibodies. (B) Quantification of the ratio of pSrcY416 signal in RPTPα mutants compared to their respective RPTPαWT (mean±SD, n = 5).
Discussion
In this study we identified a rare, functional PTPRA variant that segregates with parkinsonism in a multiplex family. We propose that the presence of this functional mutation may increase risk of development of parkinsonism in concert with the other identified variants and environmental factors. Interestingly, rare variants in PTPRA were also recently found in a family study of schizophrenia, though their functional significance has not been elucidated [10]. While this variant is rare, with a minor allele frequency of 5.34 x 10−5, it is more common than the LRRK2 p.R1441H/G/C, VPS35 p.D620N or the SNCA p.A53T or p.A30P variants [21].While parkinsonism status of participants of gnomAD is not disclosed, it would be mistaken to assume that all PTPRA p.R223W carriers develop PD. Rather, we hypothesise that in this family, additive to their other genetic and environmental risk factors, the perturbed activity of the protein due to this variant conferred risk for developing PD before the age of 80 years. To examine the hypothesis that the genetic change in isolation increases risk of disease, by 5-fold with 80% power, would require a balanced case-control study of 120,000 participants. However, it is much more challenging to examine the risk in the context of this particular family and will require follow-up assessments of the next generation and further characterisation of the role of the aberrant proteins. Recently, during the submission process a new PD database was published (https://pdgenetics.shinyapps.io/VariantBrowser/), which includes new sequence data from the International Parkinson Disease Genomics Consortium (IPDGC) and the United Kingdom Biobank (UKB). The PTPRA variant was identified in 4/5141 PD patients and 42/42754 controls. Both the ARL14EP and HYDIN variants were absent. The UKB has collected extensive phenotypic data about their participants through surveys and imaging tools, however, there are still noteworthy constraints on the data: (1) only 10% of participants are over 80 years of age. (2) 3,602 participants had PD, however, 19,460 parents of participants were reported to have PD [34, 35]. Carrier status of these participants was unknown. (3) The dataset had disclosed 30.3% of participants were related up to the third-degree [34], indicating frequency of rare variants may be exaggerated due to these familial clusters. Given the notable incomplete penetrance of known PD genes by the age of 80 years [22] and given the absence of extended clinical family history, relatedness and age with these 42 controls, it is still plausible that the PTPRA SNV we identified may have a role in PD. Further, this could be further exacerbated by other rare variants, such as the ARL14EP and HYDIN SNVs and/or other genetic background and environmental factors. Nonetheless, the PTPRA variant had altered the normal protein function. In the ectopic overexpression experiments presented here, the RPTPαR223W protein appeared functional and was transported to the plasma membrane correctly suggesting that this SNV does not render the RPTPα protein unstable. Even though the R223W mutation was located within the wedge region responsible for stability of dimerisation, no difference in dimerisation was observed compared to the wild-type RPTPα. However, the R223W expressing cells did display a significant increase in one proteolytic cleavage product, in addition to reduced activation of Src for the longer splice variant, despite apparently unchanged phosphatase ability of the mutant.It was unexpected that the cytoplasmic located R223W mutation would influence proteolytic cleavage. However, given the size of the substituted amino acid, it is possible that enough of a change in protein structure was introduced to facilitate enhanced proteolytic cleavage. Even though we were unable to determine the exact mechanism by which this cleavage occurred, we can conclude that metalloproteinases, β-secretase, γ-secretase and calpains are not the mechanism for the enhanced R223W cleavage fragment. Given that we utilised a C-terminal epitope tag for detection of the cleavage fragment we can conclude that this fragment is equivalent to the 68 kDa fragment observed but not studied further by Kapp et al. [24].Typically, PD is the result of progressive loss of dopaminergic neurons with age, therefore we would not expect a PD-causing mutation in PTPRA, a gene important for neuronal development [36], to have a strong/severe phenotype as this would result in many other neurological problems. Although dimerisation was unaffected in this overexpression paradigm, the change in RPTPαR223W proteolytic processing might result in the generation of a dimer inactivating cleavage fragment that results in altered phosphatase activity similar to inactivation of receptor tyrosine kinases by proteolytic cleavage [37]. The absence of phosphorylation at Y789 in these cleaved fragments suggests they may be catalytically inactive against SFK substrates [38-40]. According to the tyrosine displacement model presented by Zheng and collegues [38], pY789 of RPTPα is required to displace the Src SH2 domain, allowing access to pY527. However, several studies dispute this model, showing that Tyr789 phosphorylation is not necessary for pY527 dephosphorylation [31, 41–43]. Meanwhile it has reported that activity of the Y789F mutant depended on substrate, with a pool of mutants still active against EGFR/Src, and PTPRA-potentiated ERK activation unaffected by Y789F mutants [33]. As no consensus has yet been reached as to the necessity of pY789, further work is required to verify the activity of C1 and C2.The ability of RPTPα to dephosphorylate SrcY527 was unaffected by the R223W/R232W mutation. However, SrcY416 phosphorylation was perturbed in R232W expressing cells. Previous studies have shown that while RPTPα induces the activation of Src kinase by reducing the phosphorylation of Y527, a reduction in overall Src kinase phosphotyrosine levels was also observed [27]. This suggests that either Y527 dephosphorylation was not followed by Y416 phosphorylation, or that RPTPα is also capable of dephosphorylating SrcY416 [38, 40]. In unstimulated thymocytes RPTPα actually had an overall negative effect on Fyn activation, due to its ability to dephosphorylate the Fyn equivalents of Y527 and Y416 [44]. Perhaps the R232W variant slows down the disassociation of RPTPα from the SH2 domain of Src, providing physical impairment to SrcY416 auto-phosphorylation. The region the mutation resides in is important for the formation and stabilisation of dimers [18, 45] and is predicted to be important for protein-protein interactions [46]. The D1 domain is important for the formation of the active site pocket [45], but the upstream wedge region where R223 resides has no defined contribution to phosphatase activity. However, elucidation of the detailed mechanism underlying the reduction in SrcY416 phosphorylation in the R223W/R232W variants is beyond the scope of the present study.Liberation of the RPTPα ectodomain may also play a role in the regulation of SFK signalling by either stabilising or inhibiting RPTPα dimerisation or activating other membrane proteins, as for amyloid precursor protein (APP) processing. The β-secretase BACE1 cleaves APP at the N-terminus of the Aβ domain, which is the first step in the formation of pathogenic Aβ in Alzheimer’s disease [47]. Conversely, α-secretase can cleave within the Aβ domain, thereby precluding Aβ generation and producing a fragment (sAPPα) that is believed to be neuroprotective [47]. sAPPα is believed to promote neurite outgrowth, synaptogenesis and cell adhesion [48, 49] while APPβ acts as ligand for DR6, promoting caspase 6 activation resulting in axonal pruning [50].This study has identified a novel SNV linked to familial PD. Two other SNVs were also shared amongst affected members of the multi-incident family; these may also be involved or required for PD progression and further studies into these mutations are required to understand their role in PD. Nonetheless, this putative PD associated mutation, PTPRA p.R223W/R232W does generate a functional protein which is cleaved by an unknown protease to a greater extent than the wild-type protein and results in impaired Src activation in R232W expressing cells. Whether this contributes to increased risk of PD alone, or in concert with the other SNVs, still remains to be determined.
Original uncropped western blots.
(PDF)Click here for additional data file.(DOCX)Click here for additional data file.18 Mar 2021PONE-D-21-04758Does a rare mutation in PTPRA contribute to the development of Parkinson’s disease in an Australian multi-incident family?PLOS ONEDear Dr. Sykes,Thank you for submitting your manuscript to PLOS ONE. After careful consideration, we feel that it has merit but does not fully meet PLOS ONE’s publication criteria as it currently stands. Therefore, we invite you to submit a revised version of the manuscript that addresses the points raised during the review process.Both reviewers noted issues with the manuscript and Reviewer 1 suggested rejection. We would be willing to consider a revised manuscript, but these issues would have to be addressed.Please submit your revised manuscript by May 02 2021 11:59PM. If you will need more time than this to complete your revisions, please reply to this message or contact the journal office at plosone@plos.org. When you're ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file.Please include the following items when submitting your revised manuscript:A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). You should upload this letter as a separate file labeled 'Response to Reviewers'.A marked-up copy of your manuscript that highlights changes made to the original version. You should upload this as a separate file labeled 'Revised Manuscript with Track Changes'.An unmarked version of your revised paper without tracked changes. You should upload this as a separate file labeled 'Manuscript'.If you would like to make changes to your financial disclosure, please include your updated statement in your cover letter. Guidelines for resubmitting your figure files are available below the reviewer comments at the end of this letter.If applicable, we recommend that you deposit your laboratory protocols in protocols.io to enhance the reproducibility of your results. Protocols.io assigns your protocol its own identifier (DOI) so that it can be cited independently in the future. For instructions see: http://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocolsWe look forward to receiving your revised manuscript.Kind regards,Salvatore V PizzoAcademic EditorPLOS ONEJournal Requirements:When submitting your revision, we need you to address these additional requirements.1. Please ensure that your manuscript meets PLOS ONE's style requirements, including those for file naming. The PLOS ONE style templates can be found athttps://journals.plos.org/plosone/s/file?id=wjVg/PLOSOne_formatting_sample_main_body.pdf andhttps://journals.plos.org/plosone/s/file?id=ba62/PLOSOne_formatting_sample_title_authors_affiliations.pdf2. PLOS ONE now requires that authors provide the original uncropped and unadjusted images underlying all blot or gel results reported in a submission’s figures or Supporting Information files. This policy and the journal’s other requirements for blot/gel reporting and figure preparation are described in detail at https://journals.plos.org/plosone/s/figures#loc-blot-and-gel-reporting-requirements and https://journals.plos.org/plosone/s/figures#loc-preparing-figures-from-image-files. When you submit your revised manuscript, please ensure that your figures adhere fully to these guidelines and provide the original underlying images for all blot or gel data reported in your submission. See the following link for instructions on providing the original image data: https://journals.plos.org/plosone/s/figures#loc-original-images-for-blots-and-gels.In your cover letter, please note whether your blot/gel image data are in Supporting Information or posted at a public data repository, provide the repository URL if relevant, and provide specific details as to which raw blot/gel images, if any, are not available. Email us at plosone@plos.org if you have any questions.3. Please include captions for your Supporting Information files at the end of your manuscript, and update any in-text citations to match accordingly. Please see our Supporting Information guidelines for more information: http://journals.plos.org/plosone/s/supporting-information.[Note: HTML markup is below. Please do not edit.]Reviewers' comments:Reviewer's Responses to Questions
Comments to the Author1. Is the manuscript technically sound, and do the data support the conclusions?The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented. Reviewer #1: PartlyReviewer #2: Partly********** 2. Has the statistical analysis been performed appropriately and rigorously? Reviewer #1: I Don't KnowReviewer #2: Yes********** 3. Have the authors made all data underlying the findings in their manuscript fully available?The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified. Reviewer #1: YesReviewer #2: Yes********** 4. Is the manuscript presented in an intelligible fashion and written in standard English?PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here. Reviewer #1: YesReviewer #2: Yes********** 5. Review Comments to the AuthorPlease use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters) Reviewer #1: In their manuscript, Hill et al. investigated a rare mutation of the receptor type protein tyrosine phosphatase RPTPα. They discovered the mutant in a family with Parkinson's disease (PD) and localized it to the wedge region in the intracellular domain. Physiological characterization of the mutant showed intact processing and trafficking but altered proteolytic processing and a delayed catalytic activty. However, a causal role for PD remained speculative.The study in principle is of interest. However, even as an initial study, it has several problems. First, how likely is a causal role of RPTPα for the development of Parkinson's disease when the new sequence data (page 12) show a similar prevalence of the mutant in patients and controls (~1:1000)?Next, the cDNA of RPTPα was newly cloned. How good was the sequence characterized? The transiently expressed protein shows an abnormal molecular weight. RPTPα is normally found as a protein of 130 kD and not 180. The proteolytic processing of the extracellular domain of RPTPα occurs only for a splice variant containing an additional 9 amino acids in the extracellular domain. Has this variant been cloned? If so, why then do we not see a total of three processed fragments, as has been published: 75 kD for the membrane anchored form, and 63 and 68 kD for the cytoplasmic products of calpain cleavage? Why is there only little stimulation of the metalloprotease by PMA (Fig. 3B)? And why was the metalloprotease not stimulated with POV which works better? Similarly, the calpain protease was not tested by stimulation with a Ca-ionophore. Since the authors claim the 70 kD protein fragment to be the product of the metalloprotease, this would have been essential. Finally, the term "regulated intracellular proteolysis" (p10) is inappropriate for an extracellularly cleaving metalloprotease.The immunofluorescence shown in Fig. 2C is of very low quality and does not allow to see a difference between overexpressing and background cells, making it difficult to accept that trafficking of the mutant protein is normal. The phalloidin staining is a complete failure.The authors find no tyrosine phosphorylation on the proteolytically processed fragments and conclude that these do not possess catalytic activity. However, they do not prove and not even give a reason for their hypothesis. In addition, the authors provided the same image in Fig. 3A and 3D. This becomes obvious when looking at the complete blot in the supplemental figure.In Fig. 4A, dimerization of the mutant phosphatase is tested. As a control, a delta-wedge mutant is added. This protein is hardly expressed which should at least be discussed.Finally, in Fig. 4B the effect of the mutant on Src activation is investigated. Phosphorylation of Src-Y527 is more strongly present 10 min after serum stimulation than in presence of the wild type form. This is a surprising result but it is also surprising that the inhibitory Src-Y527 phosphorylation increased at all after serum treatment for both phosphatase variants. The considerably varying levels of phosphatase expression may be one explanation, however, also the level of activating phosphorylation of Akt is higher before stimulation than after 5 and 10 min. This rather points to a general experimental problem. It would have been less error prone to establish cell lines overexpressing RPTPα than performing transient expression experiments. Last, the tubulin blot in Fig. 4B, right panel is part of the total blot shown for RPTPα in the supplemental figure. How can it appear as a separate blot without additional bands as the last figure of the supplemental data?Reviewer #2: Hill et all identified three candidate genes that might contribute to Parkinson’s disease in an Australian family. Of these, the PTPRA p.R223W variant was the most likely to contribute to the disease. The R223W mutation did not affect the expression level of RPTPalpha and RPTPalpha was still expressed on the cell membrane. However, the R223W mutation led to the formation of a novel proteolytic cleavage product. The R223W mutation did not affect dimerization of RPTPalpha. Yet, the dynamics of Src Tyr527 phosphorylation appeared to be different in cells expressing the R223W variant, compared to wild type RPTPalpha. The authors conclude that a rare familial mutation in PTPRA alters its proteolytic processing and activity and may contribute to the cause of Parkinson’s disease.This is an interesting report which shows that signaling of RPTPalpha is affected by R223W mutation. The correlation of the R223W mutation with Parkinson’s disease is not fully penetrant, which may be due to genetic enhancers and/or suppressors of the phenotype.Points:1. Src Tyr527 phosphorylation appears to be affected by expression of the R223W variant, in that serum stimulation results in a transient increase in Tyr527 phosphorylation for about 30 min in the presence of wild type RPTPalpha and only 10 min in the presence of the R223W variant (Fig.4). The authors claim that Src activity is affected differently by wild type and mutant RPTPalpha. This is not evident from the data provided. Tyr527 is an inhibitory phosphorylation site, which is phosphorylated by Csk. Activation of Src will lead to enhanced phosphorylation of the autophosphorylation site, Tyr416. Phosphorylation of Tyr416 is generally taken as a measure for Src activity. The authors should therefore reprobe their blots with Src pTyr416-specific antibodies to be able to conclude that Src activity is affected. It is noteworthy that both pTyr416 and pTyr527 are substrates of RPTPalpha.Minor points:1. The last sentence of the main text does not read well: “This results in a subtle, yet significant delay in activity potentially altering SFK signalling would be altered in the brains of affected patients.”2. Ref 9 appears to be the same as ref 20.********** 6. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.If you choose “no”, your identity will remain anonymous but your review may still be made public.Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy. Reviewer #1: NoReviewer #2: No[NOTE: If reviewer comments were submitted as an attachment file, they will be attached to this email and accessible via the submission site. Please log into your account, locate the manuscript record, and check for the action link "View Attachments". If this link does not appear, there are no attachment files.]While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com/. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Registration is free. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email PLOS at figures@plos.org. Please note that Supporting Information files do not need this step.13 Jul 2021Reviewer #1:The study in principle is of interest. However, even as an initial study, it has several problems. First, how likely is a causal role of RPTPα for the development of Parkinson's disease when the new sequence data (page 12) show a similar prevalence of the mutant in patients and controls (~1:1000)?The reviewer raises a valid question and which we had considered carefully before composing the manuscript. While the International Parkinson’s Disease Genomics Consortium and United Kingdom Biobank data does suggest similar prevalence rates, we describe the limitations of this data. Referring specifically in the discussion, “(1) only 10% of participants are over 80 years of age. (2) 3,602 participants had PD, however,19,460 parents of participants were reported to have PD (Bycroft et al., 2018; Van Hout et al., 2020). Carrier status of these participants was unknown. (3) The dataset had disclosed 30.3% of participants were related up to the third-degree (Bycroft et al., 2018), indicating frequency of rare variants may be exaggerated due to these familial clusters”, the age of participants from the UKB, unknown carrier status of participants with PD affected relatives and the high rate of third-degree or closer relationships decreases the reliability of this dataset as a true measure of the rate of the rare mutation in an unaffected control population. Nevertheless, we have included this data for transparency. Furthermore, we also propose additional factors, such as the other 2 rare mutations, other genetic or environmental factors, may operate in synergy with the aberrant RPTPα functionality to increase disposition of disease, which increases the complexity of the variant-disease relationship. Referring to the discussion text: which has been adjusted to now read “Further, this could be further exacerbated by other rare variants, such as the ARL14EP and HYDIN SNVs and/or other genetic background and environmental factors.“We also describe in the discussion, to assess the risk of this variant in isolation, we would require a balanced case-control study of 120,000 participants, which unfortunately, is larger than currently available IPDGC or UKB datasets or feasible for us to perform.Next, the cDNA of RPTPα was newly cloned. How good was the sequence characterized? The transiently expressed protein shows an abnormal molecular weight. RPTPα is normally found as a protein of 130 kD and not 180.In our study we have used RPTPα SV1(793AA protein, transcript ID ENST00000216877.10, also termed PTPα123 (Kapp et al. 2012)) and not RPTPα SV4 (802AA protein, transcript ID ENST00000399903.7, also termed PTPα132 (Kapp et al. 2012)). We have fully sequenced the open reading frame and confirmed that it is correct. Furthermore, the observed MW of the mature full length RPTPα SV1 @~160kDa (between the 250 and 130 kDa bands) is consistent with (Yao et al. 2017) which studied RPTPα SV1 – as designated by the Y789F mutation (Y798 in SV4) Fig 6E and supplemental figure S5 A, B – PTPRA-FLAG migrating between 250/130 kDa and the “precursor” ~120 kDa which is equivalent to what we also observe in our study.To make it absolutely clear which splice variant has been used the materials and methods now reads “RPTP⍺ (splice variant 1; transcript ID ENST00000216877.10) was amplified from HEK293T cDNA”The proteolytic processing of the extracellular domain of RPTPα occurs only for a splice variant containing an additional 9 amino acids in the extracellular domain.We initially believed the bands to be produced by RIP and after reanalysing the data have completely rewritten this section. Aside from our study, RPTPα SV1 cleavage bands also present @ 68 and 63 kDa Fig 1A (Kapp et al. 2012). In this paper the 63 kDa band is interoperated to be produced by calpain cleavage and the 68 kDa “has the size of the PTP� intra and might occur right at the plasma membrane” was not studied further.In our hands the equivalent bands at ~75kDa (C1), which may be cleaved close/at the membrane is not stimulated by PMA or inhibited by TAPI2/BB94 indicating that it is not generated by metalloproteinase. However, the ~70kDa (C2) band, is stimulated by PMA and is completely inhibited by TAPI2/BB94 indicating that although it is generated by calpain cleavage it first requires cleavage by a metalloproteinase.Has this variant been cloned? If so, why then do we not see a total of three processed fragments, as has been published: 75 kD for the membrane anchored form, and 63 and 68 kD for the cytoplasmic products of calpain cleavage? Why is there only little stimulation of the metalloprotease by PMA (Fig. 3B)? And why was the metalloprotease not stimulated with POV which works better? Similarly, the calpain protease was not tested by stimulation with a Ca-ionophore. Since the authors claim the 70 kD protein fragment to be the product of the metalloprotease, this would have been essential.We decided to use PMA as it stimulated equivalent if not better cleavage of RPTPα SV4 (Kapp et al. 2012 Fig 1C and Fig 2A, termed TPA). Our hypothesis was that the R223W fragment was being generated by metalloproteinases and that PMA would increase its abundance. We have performed MG132 treatment and conclude that the 70kDa (C2) fragment is produced by calpain cleavage as its abundance is decreased by MG132 treatment (Figure 3B). However, PMA stimulates the generation of the 70 kDa (C2) band and this generation is completely blocked by TAPI-2, indicating an initial metalloproteinase step happens prior to calpain cleavage.Finally, the term "regulated intracellular proteolysis" (p10) is inappropriate for an extracellularly cleaving metalloprotease.We thank the reviewer for their comment and we agree and have adjusted the whole section accordingly using the terminology C1 and C2 for the two cleavage fragments.The immunofluorescence shown in Fig. 2C is of very low quality and does not allow to see a difference between overexpressing and background cells, making it difficult to accept that trafficking of the mutant protein is normal. The phalloidin staining is a complete failure.We have completed new imaging with just anti-FLAG, with higher quality images. A non-transfected cell control is added to demonstrate the specificity of the antibody staining.The authors find no tyrosine phosphorylation on the proteolytically processed fragments and conclude that these do not possess catalytic activity. However, they do not prove and not even give a reason for their hypothesis.We thank the reviewer for their comment and have addressed this with the following text and the results section now reads “Furthermore, when we investigated the phosphorylation status of the C1 and C2 fragments we observed that they were not phosphorylated (Fig 3C-D) indicating that these fragments are potentially catalytically inactive, as Y789 phosphorylation has been shown to be required for phosphatase activity against SFKs.”And discussion section with the following text“The absence of phosphorylation at Tyr789 in these cleaved fragments suggests they may be catalytically inactive against SFK substrates. The phosphorylation of Tyr789 provides the binding site for the SH2 domain of Src during Src activation. Indeed, mutation or dephosphorylation of this residue blocks RPTPα ability to dephosphorylate Y527 in Src both in vitro and in vivo.”In addition, the authors provided the same image in Fig. 3A and 3D. This becomes obvious when looking at the complete blot in the supplemental figure.We agree with reviewer #1 and Fig 3D was accidently used also for Figure 3A. We have corrected Figure 3A (and supplemental figure) with the correct image.In Fig. 4A, dimerization of the mutant phosphatase is tested. As a control, a delta-wedge mutant is added. This protein is hardly expressed which should at least be discussed.We have addressed this with the following text and the section now reads “The detection of RPTPαΔwedge by immunoblot was consistently lower than the full-length proteins in our experiments (data not shown) but nonetheless demonstrated the importance of the wedge region but not R223 in RPTPα homodimerisation.”Finally, in Fig. 4B the effect of the mutant on Src activation is investigated. Phosphorylation of Src-Y527 is more strongly present 10 min after serum stimulation than in presence of the wild type form. This is a surprising result but it is also surprising that the inhibitory Src-Y527 phosphorylation increased at all after serum treatment for both phosphatase variants. The considerably varying levels of phosphatase expression may be one explanation, however, also the level of activating phosphorylation of Akt is higher before stimulation than after 5 and 10 min. This rather points to a general experimental problem. It would have been less error prone to establish cell lines overexpressing RPTPα than performing transient expression experiments. Last, the tubulin blot in Fig. 4B, right panel is part of the total blot shown for RPTPα in the supplemental figure. How can it appear as a separate blot without additional bands as the last figure of the supplemental data?To address this more specifically we generated stable HEK293 RPTPα WT and R223W cells, performed EGF stimulation, pERK1/2 analysis and have rewritten the entire section accordingly.Reviewer #2: Points:1. Src Tyr527 phosphorylation appears to be affected by expression of the R223W variant, in that serum stimulation results in a transient increase in Tyr527 phosphorylation for about 30 min in the presence of wild type RPTPalpha and only 10 min in the presence of the R223W variant (Fig.4). The authors claim that Src activity is affected differently by wild type and mutant RPTPalpha. This is not evident from the data provided. Tyr527 is an inhibitory phosphorylation site, which is phosphorylated by Csk. Activation of Src will lead to enhanced phosphorylation of the autophosphorylation site, Tyr416. Phosphorylation of Tyr416 is generally taken as a measure for Src activity. The authors should therefore reprobe their blots with Src pTyr416-specific antibodies to be able to conclude that Src activity is affected. It is noteworthy that both pTyr416 and pTyr527 are substrates of RPTPalpha.We have changed the experimental design to use stable expressing RPTP� cells, EGF stimulation and pERK1/2 activation.Minor points:1. The last sentence of the main text does not read well: “This results in a subtle, yet significant delay in activity potentially altering SFK signalling would be altered in the brains of affected patients.”Due to the new data this sentence has been removed2. Ref 9 appears to be the same as ref 20.We thank the reviewer for their feedback, we have removed the duplicate reference accordingly.Submitted filename: PLOSone Comments to the Author_v3.docxClick here for additional data file.28 Jul 2021PONE-D-21-04758R1Does a rare mutation in PTPRA contribute to the development of Parkinson’s disease in an Australian multi-incident family?PLOS ONEDear Dr. Sykes,Thank you for submitting your manuscript to PLOS ONE. After careful consideration, we feel that it has merit but does not fully meet PLOS ONE’s publication criteria as it currently stands. Therefore, we invite you to submit a revised version of the manuscript that addresses the points raised during the review process.There remain concerns which should be addressed if the authors plan to submit a revised manuscript.Please submit your revised manuscript by Sep 11 2021 11:59PM. If you will need more time than this to complete your revisions, please reply to this message or contact the journal office at plosone@plos.org. When you're ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file.Please include the following items when submitting your revised manuscript:A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). You should upload this letter as a separate file labeled 'Response to Reviewers'.A marked-up copy of your manuscript that highlights changes made to the original version. You should upload this as a separate file labeled 'Revised Manuscript with Track Changes'.An unmarked version of your revised paper without tracked changes. You should upload this as a separate file labeled 'Manuscript'.If you would like to make changes to your financial disclosure, please include your updated statement in your cover letter. Guidelines for resubmitting your figure files are available below the reviewer comments at the end of this letter. If applicable, we recommend that you deposit your laboratory protocols in protocols.io to enhance the reproducibility of your results. Protocols.io assigns your protocol its own identifier (DOI) so that it can be cited independently in the future. For instructions see: http://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocols . Additionally, PLOS ONE offers an option for publishing peer-reviewed Lab Protocol articles, which describe protocols hosted on protocols.io. Read more information on sharing protocols at https://plos.org/protocols?utm_medium=editorial-email&utm_source=authorletters&utm_campaign=protocols . We look forward to receiving your revised manuscript.Kind regards,Salvatore V PizzoAcademic EditorPLOS ONEJournal Requirements:Additional Editor Comments (if provided):[Note: HTML markup is below. Please do not edit.]Reviewers' comments:Reviewer's Responses to Questions
Comments to the Author1. If the authors have adequately addressed your comments raised in a previous round of review and you feel that this manuscript is now acceptable for publication, you may indicate that here to bypass the “Comments to the Author” section, enter your conflict of interest statement in the “Confidential to Editor” section, and submit your "Accept" recommendation. Reviewer #1: (No Response)Reviewer #2: (No Response)********** 2. Is the manuscript technically sound, and do the data support the conclusions?The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented. Reviewer #1: PartlyReviewer #2: No********** 3. Has the statistical analysis been performed appropriately and rigorously? Reviewer #1: N/AReviewer #2: N/A********** 4. Have the authors made all data underlying the findings in their manuscript fully available?The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified. Reviewer #1: YesReviewer #2: Yes********** 5. Is the manuscript presented in an intelligible fashion and written in standard English?PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here. Reviewer #1: YesReviewer #2: Yes********** 6. Review Comments to the AuthorPlease use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters) Reviewer #1: The revised version of the manuscript does provide only limited improvements for the understanding of the R223W mutation in PTPa.- A relevance for PD is purely speculative.- The aberrant molecular weight of PTPa has not been explained and still is not pointed out in the manuscript. Yao et al. (ref 25) also use a carboxyterminal tag of PTPa and in Fig. 4B do show a Western blot with a PTPa with regular molecular weight (about 130 kD). In contrast to the authors’ statement Yao et al. do not show a MW for the PTPa in Fig 6E but indeed do so in their Figure S5 and thus give two different MW of the phosphatase. Nevertheless, I suggest to point out the strong change of MW of the tagged PTP in the manuscript.- Phosphorylation and activity of PTPa fragments C1 and C2: the exposure shown in Fig. 3E is to short to allow detection of tyrosine phosphorylation (see bottom part of 3E and the relative amount of FL and C1/C2).The authors state that “Y789 phosphorylation has been shown to be required for phosphatase activity against SFKs (ref 24,25)“. However, there is no activity assay for PTP fragments in ref 25. The paper of Zheng et al. (ref 24) has shown full activity for full length mutated Y789F-PTPa towards Raytide and MBP.Since the changed proteolytical processing of PTPa-R223W that yields C1/C2 fragments is now the major novelty in this manuscript, it would have been appropriate to investigate the processing and the activity of the PTPa fragments.- The following point is important but had been overlooked in the original review: The sentence in the manuscript “Interestingly, we discovered that the wedge region is indeed responsible for the stability of homodimers, as RPTPαΔwedge expressing cells were present almost completely as dimers“ is contradicting itself. If the wedge is important for dimerization, its deletion should abolish dimerization. This is in agreement with the finding of Jiang et al. (2000) that dimerization of PTPa was not possible when a similar deletion of the wedge region was made.In addition to the low expression of the delta-wedge PTPa, the enhanced dimerization also needs to be discussed.- Data shown in Fig. 4B: here, newly generated cell lines have been employed to get more physiological data. These data show clearly that there is no change of activity towards Src-pY527 in the PTPa mutant. The authors have a similar point of view, as they state at the end of the Results section “These data suggest that the phosphatase activity of the R233W mutant is not hampered in comparison to RPTPαWT after EGF stimulation.” It is therefore surprising to find as a head line of the last chapter of the Results section “The RPTPαR223W mutation decreases activity against SFKs but doesn’t alter homodimerisation“. Or this sentence in the Discussion “Nonetheless, the PTPRAR223W variant had altered the normal protein function.”Taken together, the revised version leaves the reviewer with the conclusion that the PTPa-R223W mutant has no meaning for PD, and the only cell biological change for PTPa is a slightly altered proteolytical processing of the phosphatase for which the mechanism and the meaning are unknown.Reviewer #2: In the original manuscript, the authors concluded that the Parkinson’s disease-associated mutation they identified in PTPRA in an Australian family altered proteolytic processing and activity of RPTPalpha. Using stable lines in HEK293 cells, they now report that SRC Tyr527 phosphorylation and ERK/MAPK phosphorylation were not affected. Proteolytic cleavage of the mutant was affected, but the functional consequences are not evident. Combined with incomplete penetrance of the mutation, the conclusion that this mutation represents a SNP that does not have functional implications would be equally valid.SRC family kinases are the most prominent substrates of RPTPalpha. As indicated in my original review, the authors should assess Src Tyr416 phosphorylation as a read-out for SRC activity and hence for signaling downstream of RPTPalpha. If Tyr416 phosphorylation is not altered in response to the mutation, there is little or no news value in this report.********** 7. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.If you choose “no”, your identity will remain anonymous but your review may still be made public.Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy. Reviewer #1: NoReviewer #2: No[NOTE: If reviewer comments were submitted as an attachment file, they will be attached to this email and accessible via the submission site. Please log into your account, locate the manuscript record, and check for the action link "View Attachments". If this link does not appear, there are no attachment files.]While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com/. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Registration is free. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email PLOS at figures@plos.org. Please note that Supporting Information files do not need this step.13 Jan 2022Reviewer #1: The revised version of the manuscript does provide only limited improvements for the understanding of the R223W mutation in PTPa.- A relevance for PD is purely speculative.We are not claiming PTPRAR223W is a causative factor in the development of PD, merely that it was found in a patient with PD and the mutation has an effect on the protein. The SNV results in aberrant Src signalling which is addressed in the final paragraph “Nonetheless, this putative PD associated mutation, PTPRA p.R223W does generate a functional protein which is cleaved by an unknown protease to a greater extent than the wild-type protein and results in impaired Src activation. Whether this contributes to increased risk of PD alone, or in concert with the other SNVs, still remains to be determined.”- The aberrant molecular weight of PTPa has not been explained and still is not pointed out in the manuscript. Yao et al. (ref 25) also use a carboxyterminal tag of PTPa and in Fig. 4B do show a Western blot with a PTPa with regular molecular weight (about 130 kD). In contrast to the authors’ statement Yao et al. do not show a MW for the PTPa in Fig 6E but indeed do so in their Figure S5 and thus give two different MW of the phosphatase. Nevertheless, I suggest to point out the strong change of MW of the tagged PTP in the manuscript.We thank the reviewer for their thorough analysis of the literature. We agree that there is discrepancy in the literature for the observed MW of RPRPα and have added the following to the text.“While the observed MW of RPTPα-V5/Flag is approximately 30 kDa larger than what is most commonly reported in the literature21–24 it is not uncommon for the protein to be reported larger than 130 kDa25–29 regardless of number or position of tags. ”- Phosphorylation and activity of PTPa fragments C1 and C2: the exposure shown in Fig. 3E is to short to allow detection of tyrosine phosphorylation (see bottom part of 3E and the relative amount of FL and C1/C2).To address this, we have included a higher exposure image to Fig 3E. There is no tyrosine phosphorylation in the region of the C1 and C2 bands.The authors state that “Y789 phosphorylation has been shown to be required for phosphatase activity against SFKs (ref 24,25)“. However, there is no activity assay for PTP fragments in ref 25. The paper of Zheng et al. (ref 24) has shown full activity for full length mutated Y789F-PTPa towards Raytide and MBP.The authors again thank the reviewer for their thorough knowledge of the literature. Relevance of the Y789 to Src activity appears to still be debated in the literature, therefore we have added the following to the discussion:“According to the tyrosine displacement model presented by Zheng and collegues38, pY789 of RPTPα is required to displace the Src SH2 domain, allowing access to pY527. However, several studies dispute this model, showing that Y789 phosphorylation is not necessary for pY527 dephosphorylation29,41–43. Meanwhile it has reported that activity of the Y789F mutant depended on substrate, with a pool of mutants still active against EGFR/Src, and PTPRA-potentiated ERK activation unaffected by Y789F mutants32. As no consensus has yet been reached as to the necessity of pY789, further work is required to verify the activity of C1 and C2.”Since the changed proteolytical processing of PTPa-R223W that yields C1/C2 fragments is now the major novelty in this manuscript, it would have been appropriate to investigate the processing and the activity of the PTPa fragments.The authors agree that investigation of the activity of the fragments would be appropriate, unfortunately it is outside the scope of this project. In addition, we now present new data showing hampered Src activation in the RPTPα R223W and R232W, and therefore a second point of interest for this SNV.- The following point is important but had been overlooked in the original review: The sentence in the manuscript “Interestingly, we discovered that the wedge region is indeed responsible for the stability of homodimers, as RPTPαΔwedge expressing cells were present almost completely as dimers“ is contradicting itself. If the wedge is important for dimerization, its deletion should abolish dimerization. This is in agreement with the finding of Jiang et al. (2000) that dimerization of PTPa was not possible when a similar deletion of the wedge region was made.In addition to the low expression of the delta-wedge PTPa, the enhanced dimerization also needs to be discussed.We agree that our findings were in contradiction to the literature and we did not expect the results we obtained. However, we added the data because we thought it would help illustrate the assay. As the RPTPαΔwedge experiments do not add anything beneficial to the paper we have removed them from the manuscript and the figures.- Data shown in Fig. 4B: here, newly generated cell lines have been employed to get more physiological data. These data show clearly that there is no change of activity towards Src-pY527 in the PTPa mutant. The authors have a similar point of view, as they state at the end of the Results section “These data suggest that the phosphatase activity of the R233W mutant is not hampered in comparison to RPTPαWT after EGF stimulation.” It is therefore surprising to find as a head line of the last chapter of the Results section “The RPTPαR223W mutation decreases activity against SFKs but doesn’t alter homodimerisation“. Or this sentence in the Discussion “Nonetheless, the PTPRAR223W variant had altered the normal protein function.”The authors agree that consistency in our conclusions regarding protein function were not consistent in the manuscript and have now been corrected.Taken together, the revised version leaves the reviewer with the conclusion that the PTPa-R223W mutant has no meaning for PD, and the only cell biological change for PTPa is a slightly altered proteolytical processing of the phosphatase for which the mechanism and the meaning are unknown.With the new R223W and R232W data we think that this is addressed.Reviewer #2: In the original manuscript, the authors concluded that the Parkinson’s disease-associated mutation they identified in PTPRA in an Australian family altered proteolytic processing and activity of RPTPalpha. Using stable lines in HEK293 cells, they now report that SRC Tyr527 phosphorylation and ERK/MAPK phosphorylation were not affected. Proteolytic cleavage of the mutant was affected, but the functional consequences are not evident. Combined with incomplete penetrance of the mutation, the conclusion that this mutation represents a SNP that does not have functional implications would be equally valid.SRC family kinases are the most prominent substrates of RPTPalpha. As indicated in my original review, the authors should assess Src Tyr416 phosphorylation as a read-out for SRC activity and hence for signaling downstream of RPTPalpha. If Tyr416 phosphorylation is not altered in response to the mutation, there is little or no news value in this report.The authors thank the reviewer for their insightful commentary. We had previously encountered issues with successful resolution of pSrcY416 by western blot. Similar problems were resolved in a separate project with a change in the lysis procedure. We have now performed pSrcY416 immunoblots on RPTPαR223W and discovered attenuated Src activity. We have also generated RPTPa-Sv4R232W (the longer isoform) stable cells which also have attenuated Src activity. These new data suggest that the patient SNV does indeed impact RPTPα and Src signalling.Submitted filename: PTPRA_plosone_response_v4.docxClick here for additional data file.31 Jan 2022
PONE-D-21-04758R2
Does a rare mutation in PTPRA contribute to the development of Parkinson’s disease in an Australian multi-incident family?
PLOS ONE
Dear Dr. Sykes,Thank you for submitting your manuscript to PLOS ONE. After careful consideration, we feel that it has merit but does not fully meet PLOS ONE’s publication criteria as it currently stands. Therefore, we invite you to submit a revised version of the manuscript that addresses the points raised during the review process.
As you can see Reviewer one has significant issues with respect to the manuscript. I would appreciate your reply to these criticisms.Please submit your revised manuscript by Mar 17 2022 11:59PM. If you will need more time than this to complete your revisions, please reply to this message or contact the journal office at plosone@plos.org. When you're ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file.Please include the following items when submitting your revised manuscript:A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). You should upload this letter as a separate file labeled 'Response to Reviewers'.A marked-up copy of your manuscript that highlights changes made to the original version. You should upload this as a separate file labeled 'Revised Manuscript with Track Changes'.An unmarked version of your revised paper without tracked changes. You should upload this as a separate file labeled 'Manuscript'.If you would like to make changes to your financial disclosure, please include your updated statement in your cover letter. Guidelines for resubmitting your figure files are available below the reviewer comments at the end of this letter.If applicable, we recommend that you deposit your laboratory protocols in protocols.io to enhance the reproducibility of your results. Protocols.io assigns your protocol its own identifier (DOI) so that it can be cited independently in the future. For instructions see: https://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocols. Additionally, PLOS ONE offers an option for publishing peer-reviewed Lab Protocol articles, which describe protocols hosted on protocols.io. Read more information on sharing protocols at https://plos.org/protocols?utm_medium=editorial-email&utm_source=authorletters&utm_campaign=protocols.We look forward to receiving your revised manuscript.Kind regards,Salvatore V PizzoAcademic EditorPLOS ONE[Note: HTML markup is below. Please do not edit.]Reviewers' comments:Reviewer's Responses to Questions
Comments to the Author1. If the authors have adequately addressed your comments raised in a previous round of review and you feel that this manuscript is now acceptable for publication, you may indicate that here to bypass the “Comments to the Author” section, enter your conflict of interest statement in the “Confidential to Editor” section, and submit your "Accept" recommendation. Reviewer #1: (No Response)Reviewer #2: (No Response)********** 2. Is the manuscript technically sound, and do the data support the conclusions?The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented. Reviewer #1: NoReviewer #2: (No Response)********** 3. Has the statistical analysis been performed appropriately and rigorously? Reviewer #1: NoReviewer #2: (No Response)********** 4. Have the authors made all data underlying the findings in their manuscript fully available?The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified. Reviewer #1: NoReviewer #2: (No Response)********** 5. Is the manuscript presented in an intelligible fashion and written in standard English?PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here. Reviewer #1: YesReviewer #2: (No Response)********** 6. Review Comments to the AuthorPlease use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters) Reviewer #1: The current revision does not provide relevant new insights or improve the manuscript essentially.A misleading statement is found in the rebuttal when the authors state “We are not claiming PTPRAR223W is a causative factor in the development of PD”. Why then do they mention PD 13x in Abstract and Introduction alone, if not for nudging the reader to see a role for PTPalpha in the development of PD?- Fig. 3E: it is surprising that in 3E the longer exposure generates considerable general darkening of the blot whereas the blot in 3C gets lighter ?- Fig. 5: The analysis of the densitometric scanning is statistically not significant. Therefore, the statements about “percentages of” are meaningless. When looking at Fig. 5B and seeing the deviation of the mean, it just brings out a laughter when the authors state in the Results section values of 80.6±0.09% and 54.3±0.21%.As Fig. 5 has been included to overcome the deficit in analysis of PTP cleavage (statement of the authors in the rebuttal) this also flops.Reviewer #2: (No Response)********** 7. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.If you choose “no”, your identity will remain anonymous but your review may still be made public.Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy. Reviewer #1: NoReviewer #2: No[NOTE: If reviewer comments were submitted as an attachment file, they will be attached to this email and accessible via the submission site. Please log into your account, locate the manuscript record, and check for the action link "View Attachments". If this link does not appear, there are no attachment files.]While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com/. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Registration is free. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email PLOS at figures@plos.org. Please note that Supporting Information files do not need this step.6 Jun 2022Reviewer #1: The current revision does not provide relevant new insights or improve the manuscript essentially.A misleading statement is found in the rebuttal when the authors state “We are not claiming PTPRAR223W is a causative factor in the development of PD”. Why then do they mention PD 13x in Abstract and Introduction alone, if not for nudging the reader to see a role for PTPalpha in the development of PD?We agree that the language in our response could have been clearer. We are not claiming that PTPRAR223W is the sole causative factor contributing to PD in this family. It likely increases risk of development, particularly in concert with the other identified mutations or environmental factors. We are not claiming that possessing the R223W mutation is a one-way ticket to PD. This is common in PD genetics for example even though SNCA and LRRK2 are robustly linked to PD, they are not 100% penetrant but are strong risk factors for developing PD (Delcambre et al., 2020; Trinh, Guella, & Farrer, 2014). This is covered by the following sentences in the discussion “While parkinsonism status of participants of gnomAD is not disclosed, it would be mistaken to assume that all PTPRA p.R223W carriers develop PD. Rather, we hypothesise that in this family, additive to their other genetic and environmental risk factors, the perturbed activity of the protein due to this variant conferred risk for developing PD before the age of 80 years.” and the last 2 sentences of the discussion “Nonetheless, this putative PD associated mutation, PTPRA p.R223W does generate a functional protein which is cleaved by an unknown protease to a greater extent than the wild-type protein and results in impaired Src activation. Whether this contributes to increased risk of PD alone, or in concert with the other SNVs, still remains to be determined.”- Fig. 3E: it is surprising that in 3E the longer exposure generates considerable general darkening of the blot whereas the blot in 3C gets lighter ?Figure 3C has clear and low intensity bands in the region of interest. Only moderate over exposure was required to visualise them better and the brightness/contrast was adjusted in ImageStudio after acquisition of the longer exposure. 3E has no noticeable bands and we have supplied the most over exposed image we have to illustrate this.- Fig. 5: The analysis of the densitometric scanning is statistically not significant. Therefore, the statements about “percentages of” are meaningless. When looking at Fig. 5B and seeing the deviation of the mean, it just brings out a laughter when the authors state in the Results section values of 80.6±0.09% and 54.3±0.21%.As Fig. 5 has been included to overcome the deficit in analysis of PTP cleavage (statement of the authors in the rebuttal) this also flops.As the reviewer has had many issues with this data we have completely redone the experiments and to eliminate all sources of ambiguity we completed these analyses on single blots, using both rabbit anti-pSrc416 and mouse-anti-tSrc. Densitometric analysis revealed a significant reduction in pSrc416 phosphorylation in cells expressing mutant splice variant four RPTPα. A reduction in pSrc416 phosphorylation was apparent but not significant for the splice variant 1 RPTPα in the current experimental paradigm of 5 independent replicates. We have supplied all the blots from 5 independent replicates for complete transparency of these results (S1_raw_images.pdf).Delcambre, S., Ghelfi, J., Ouzren, N., Grandmougin, L., Delbrouck, C., Seibler, P., … Grünewald, A. (2020). Mitochondrial Mechanisms of LRRK2 G2019S Penetrance. Frontiers in Neurology, 11, 881. https://doi.org/10.3389/fneur.2020.00881Trinh, J., Guella, I., & Farrer, M. J. (2014). Disease penetrance of late-onset parkinsonism: A meta-analysis. JAMA Neurology. https://doi.org/10.1001/jamaneurol.2014.1909Submitted filename: PTPRA_plosone_response_v5.docxClick here for additional data file.5 Jul 2022Does a rare mutation in PTPRA contribute to the development of Parkinson’s disease in an Australian multi-incident family?PONE-D-21-04758R3Dear Dr. Sykes,We’re pleased to inform you that your manuscript has been judged scientifically suitable for publication and will be formally accepted for publication once it meets all outstanding technical requirements.Within one week, you’ll receive an e-mail detailing the required amendments. When these have been addressed, you’ll receive a formal acceptance letter and your manuscript will be scheduled for publication.An invoice for payment will follow shortly after the formal acceptance. To ensure an efficient process, please log into Editorial Manager at http://www.editorialmanager.com/pone/, click the 'Update My Information' link at the top of the page, and double check that your user information is up-to-date. If you have any billing related questions, please contact our Author Billing department directly at authorbilling@plos.org.If your institution or institutions have a press office, please notify them about your upcoming paper to help maximize its impact. If they’ll be preparing press materials, please inform our press team as soon as possible -- no later than 48 hours after receiving the formal acceptance. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information, please contact onepress@plos.org.Kind regards,Salvatore V PizzoAcademic EditorPLOS ONEAdditional Editor Comments (optional):Reviewers' comments:18 Jul 2022PONE-D-21-04758R3Does a rare mutation in PTPRA contribute to the development of Parkinson’s disease in an Australian multi-incident family?Dear Dr. Sykes:I'm pleased to inform you that your manuscript has been deemed suitable for publication in PLOS ONE. Congratulations! Your manuscript is now with our production department.If your institution or institutions have a press office, please let them know about your upcoming paper now to help maximize its impact. If they'll be preparing press materials, please inform our press team within the next 48 hours. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information please contact onepress@plos.org.If we can help with anything else, please email us at plosone@plos.org.Thank you for submitting your work to PLOS ONE and supporting open access.Kind regards,PLOS ONE Editorial Office Staffon behalf ofDr. Salvatore V PizzoAcademic EditorPLOS ONE
Authors: Line Kenborg; Christina F Lassen; Beate Ritz; Klaus K Andersen; Jane Christensen; Eva S Schernhammer; Johnni Hansen; Lene Wermuth; Naja H Rod; Jørgen H Olsen Journal: Am J Epidemiol Date: 2015-04-29 Impact factor: 4.897
Authors: Matthew J Barrett; Nicholas E Hac; Guofen Yan; Madaline B Harrison; G Frederick Wooten Journal: Mov Disord Date: 2015-03-04 Impact factor: 10.338