Association of the Val66Met polymorphism of the BDNF gene and the deletional mutation of CYP2D6 gene with the prevalence and severity of depressive disorder in an Eastern Indian population.

Background: The Val66Met single nucleotide polymorphism (SNP) of the brain-derived growth factor (BDNF) and deletional mutation of the cytochrome P4502D6 (CYP2D6) have been reported to be linked to the etiology and severity of depressive disorders (DD) in a variable manner among different ethnicities and populations. Aims: The present study was aimed to find the relationship of mutational variations of these two neurotrophins with the severity of DD and their serum cortisol levels as a marker of the stress factor.
Methods: In 104 drug-naïve newly diagnosed cases of DD and 106 control subjects, the severity of depression was assessed using the HAM-D score. Val66Met SNP of the BDNF was analyzed in them using restriction digestion of its polymerase chain reaction (PCR) product. CYP2D6 deletional variants were detected by the absence of their PCR products. Serum cortisol levels were measured by the enzyme-linked immunosorbent assay (ELISA) technique.
Results: The Chi-square test (Χ2 = 1.42, P = 0.49) did not show any higher prevalence of Val66Met SNP of the BDNF gene in the case group. A correlation coefficient (R) of -0.14 for HAM-D score with a P value of 0.29 signified no direct link of the severity of DD with this SNP. However, a Χ2 of 12.68 with P < 0.001 indicated a significantly higher prevalence of the CYP2D6 deletional mutants in DD cases, whereas an R-value of 0.39 for HAM-D score with P < 0.001 suggested a significantly higher severity of DD having with them. Serum cortisol level showed a significant positive correlation with the deletional variants of CYP2D6 (R = 0.198, P = 0.04) and the HAM-D score (R = 0.22, P = 0.025).
Conclusion: We conclude that CYP2D6 deletion significantly contributes to the severity and stress factor in the DD patients in our study population. Early identification of these mutations may provide important molecular and cellular predisposition for the disease and may lay the ground for possible more effective measures of intervention. Copyright:

INTRODUCTION

Depressive disorder (DD) is one of the commonest psychiatric disorders worldwide that affects human life and society in a multifactorial manner. In a recent survey conducted by the National Mental Health Survey (NMHS)[1] of India in 2019, the lifetime prevalence of DD (ICD-10 DCR) in the Indian population has been suggested to be about 5.25%, which is a substantial number in our highly populous country that affects several important aspects such as personal and family life of the patient, effective manpower, and economic burden on the family and the country. DD is a multifactorial illness including several genetic, epigenetic, and environmental factors. Among several genetic factors, the single nucleotide polymorphism (SNP) of brain-derived neurotrophic factor (BDNF) gene, resulting in the replacement of valine by methionine (Val66Met) at its 66th position of the BDNF protein molecule, and the deletional variant of cytochrome 4502D6 (CYP2D6) gene, leading to drastically low levels of this protein in the brain, have been found to play significant roles in the etiology and the severity of DD worldwide albeit with some degree of inconsistent results from place to place.

BDNF gene is located on chromosome 11p13 and codes for a neurotrophin that is highly responsible for the regulation of the proliferation and differentiation of synapses and their plasticity in the central nervous system, particularly the hippocampus, which is related to the initiation and functioning of memory.[234] So, it was proposed that a decreased synthesis of BDNF protein may be responsible for DD, and anti-depressants may increase its synthesis in the brain along with improvement in the symptoms of DD. Particularly, the Val66Met SNP (rs6265) was found to be associated with DD in several countries although the association has been inconsistent and inconclusive worldwide.[5] In Caucasian countries, Val66Met SNP has been found to be more consistently associated with DD in comparison to the Asian countries in spite of showing a higher prevalence of this SNP among the Asian population.[67]

CYP2D6 gene produces the cytochrome P450 2D6 protein isoform of the cytochrome family, which is involved in several important metabolic pathways. The CYP2D6 protein assists in the metabolism of several important metabolites in the brain such as 5-methoxytryptamine, anandamide, and tyramine. It also catalyzes the synthesis of serotonin and dopamine[8] and therefore, genetic variants particularly the homozygous varieties that result in the defective synthesis of this protein have been proposed to be a major contributory factor for decreased hippocampus volume, major depression, anxiety disorders, and schizophrenia.[9] However, heterogeneous results are prevalent regarding this variant also that mainly vary due to ethnic differences around the world.[9]

In spite of inconsistent and heterogeneous reports regarding the involvement of these two variants around the world, it is quite evident that their products have a significant role in influencing major human behavioral patterns including the development of DD and other psychiatric disorders. However, the authors could find very few reports regarding the involvement of these genes in DD in the Indian population. Hence, with the research question of whether these common variants are involved in DD in Indian subjects, we hypothesized that there may be an association between the Val66Met SNP and CYP2D6 deletional variants with DD in our Eastern Indian population and designed the study accordingly.

Serum cortisol levels have been important biomarkers for several neuropsychiatric disorders including schizophrenia, anxiety disorders, and DD[1011], and recent meta-analytical studies have underscored the predictive role of cortisol on DD.[12] Several genetic studies reported that the SNPs for the HPA axis and glucocorticoid receptors are involved in decreased secretion of cortisol, their cellular function at the end organ level, and the likelihood of suffering from depressive symptoms.[1314] A significant reciprocal association has been found between the cortisol and BDNF levels in human post mortem pre-frontal cortex and the plasma in animal models that signify that the neuroprotective BDNF is negatively correlated to the stress hormone cortisol in both humans and animal models.[15] However, being non-specific for these associations between the serum cortisol levels and specific genetic variants of BDNF, limitations exist in linking it with any specific diseases such as DD at an evidence-based genetic level. The present study also aimed to find any possible association of serum cortisol with the above-mentioned genetic variants in DD in our study population.

METHODS

Study design: The present study was carried out as a hospital-based case–control study for 1 year from September 2019 to August 2020. Cases were selected from newly diagnosed drug-naive major depressive disorder attending the Psychiatry Unit of a tertiary care hospital of West Bengal. Inclusion criteria for the selection were i) first episode of the depressive disorder according to the ICD-10 criteria, ii) not under any type of drug treatment either psychotropic or any that could affect the serum cortisol levels, iii) both sexes with equal preference, and iv) in the age group of 20 to 59 years. The exclusion criteria were i) no other psychiatric, metabolic, nutritional, inflammatory, kidney, liver, or endocrine disorders, ii) persons with drug abuse or alcohol addiction, iii) pregnant subjects and patients suffering from any type of malignant disorders.

Sample size: Considering the lifetime prevalence of DD to be about 5.25% in India as reported in a recent study carried out by the National Mental Health Survey (NMHS) in 2019,[1] our minimum sample size (s) was calculated using the formula:

s = ([1.96) 2 x p (1-p)])/d2 = 77,

where 1.96 is the corresponding Z value for 95% confidence interval, p is the prevalence of the disorder, and d is the precision, which is generally considered to be 5% or 0.05.

Considering a loss of cases or data at the level of 10% during the course of the study, the final minimum sample size was calculated to be 77/0.9 = 85 for the case group.

Selection of study subjects: After determining the inclusion and exclusion criteria and the minimum effective sample size for the case population, 104 cases in the 1-year study period were selected by the concerned psychiatrist in the Department of Psychiatry using the IDC-10 guidelines. In total, 106 age- and sex-matched control subjects were selected from persons attending the patients. All controls were healthy and free from any type of psychiatric, inflammatory, metabolic, endocrinological, and malignant disorder and any substance use-related disorder. First-degree relatives of cases were excluded from selection in the control group to avoid any genetic predisposition. Pregnant populations were excluded from both case and control groups.

Rating of depression using the Hamilton depression rating scale (HAM-D).[16] In the present study, grading of the DD was performed using the HAM-D scale in the Department of Psychiatry. This is the most widely utilized clinically determined depression scale that uses a semi-structured questionnaire using 17 items linked to the degree of severity (score from 0–4) of the symptoms of DD during the past week. A score of 0–7 is considered to be normal or controlled by a drug, whereas a score more than 20 indicates moderate severity.

Laboratory investigations: Five mL of venous blood was collected in an aseptic way from study subjects. Genetic analysis was performed using the Ethylene Diamine Tetra-acetic Acid- mixed blood sample, whereas serum cortisol was obtained from the serum of the clotted sample.

Genetic analysis:

DNA isolation: DNA was isolated using the phenol–chloroform extraction method following the well-established method of Blin and Stafford (1976).[17] The degree of purification of DNA was assessed by measuring the absorbance ratio at 460 nm and 480 nm, the ratio being >1.8 for the purified DNA. The integrity of the separated DNA was assessed by running them through a 0.7% agarose gel.

Amplification by PCR: For PCR of both genes, we used the PCR thermocycler from Applied Biosystems, Life Diagnostics, USA.

PCR of the rs6265, Val66Met BDNF gene: It was carried out in a 50 mL reaction mixture consisting of 25 mL PCR master mix (Thermo Fisher Scientific, USA), 2 mL each of 0.5 mmol forward (ACTCTGGAGAGCGTGAATGG) and reverse (ACTACTGAGCATCACCCTGGA) primers, 2 mL (2 mg) of the template DNA, and 19 mL of nuclease-free water. The primers were obtained from the NCBI primer blast website www.ncbi.nlm.nih.gov/tools/primer-blast. The PCR conditions were i) initial denaturation at 95°C for 5 min followed by ii) 30 cycles of 1 min denaturation at 95°C, 1 min annealing at 60°C, 1 min polymerization at 72°C, iii) a single step of final extension at 72°C for 5 min, and iv) 4°C for final storage when needed. Using this method, a PCR amplicon of 171 bp size was obtained for the rs6265, Val66Met of the BDNF gene.

Restriction digestion of BDNF PCR product: This was done using the restriction enzyme Eco72I (Thermo Fisher Scientific, USA) following the standard protocol. BDNF genes having a G allele in place of A were cut into two fragments of 72 and 99 bp.

PCR of the CYP2D6 gene: PCR for this gene was carried out in a 25 mL reaction mixture (as no sample was needed for the restriction digestion) consisting of 12.5 mL PCR master mix (Thermo Fisher Scientific, USA), 1 mL each of 0.5 mmoL forward (CCCTGGTTATCCCAGAAGGC) and reverse (GTTTCACCCACCACCCATGT) primers, 1 mL (1 mg) of the template DNA, and 9.5 mL of nuclease-free water. The primers were obtained from the NCBI primer blast website www.ncbi.nlm.nih.gov/tools/primer-blast. The PCR conditions were i) an initial denaturation at 95°C for 5 min, ii) 30 cycles of 1 min denaturation at 95°C, 1 min annealing at 58°C, 1 min polymerization at 72°C, iii) a single step of final extension at 72°C for 5 min, and iv) 4°C for final storage as needed. Using this method, a PCR amplicon of 750 bp size was obtained for the non-deletional wild variety of the gene, whereas no PCR product was obtained in the case of the deletional mutant variants. For quality control of PCR of both genes, the beta-globin gene was run as a positive control, whereas the PCR master mix with any one of the primer but without any sample, DNA template was run as a negative control.

Estimation of serum cortisol level: Serum cortisol levels were measured using the competitive immunoassay technique using enzyme-linked immunosorbent assay (ELISA) reagent kits (AccuBind, USA) and the automated ELISA reader and washer (Tecan, USA) from fresh blood samples drawn at 8.30 am from both case and control subjects as blood samples drawn between 7 and 10 am time frame gives better consistency in results.[18] The precision of the whole process was monitored by the coefficient of variation (CV) of the test, which remained below 10 at the value of 6.5 throughout the test process.

Statistical methods: Independent t-tests and analysis of variance (ANOVA) were used for the comparison of mean values between case and control groups as applicable. Rectification for the P value for multiple t-test was performed using the Bonferroni correction in the posthoc ANOVA. Risk factors for the distribution of different genetic alleles between the two groups were assessed by Chi-square test and odds ratio analysis. A Chi-square test was done to find the stabilization status of different alleles in the study population according to the Hardy–Weinberg equilibrium (HWE) rule. The HW equilibrium study was carried out by computing the relative frequencies of each allele in the study population and comparing these observed frequencies with their expected outcomes using Chi-square tests. The degree of association between relevant study parameters in the case group was performed using the bivariate correlation analysis and regression study. For all statistical tests, the results were considered to be significant with a P value < 0.05 with a 95% confidence interval with an 80% power of the study. All statistical tests were performed using the statistical software SPSS 21 for Windows 10 version.

Ethical considerations: The study strictly adhered to the guidelines from the revised Helsinki declaration and Indian Council of Medical Research protocol for human studies. Informed consent was taken from all study subjects or their legal guardians and the study was conducted after getting ethical approval from the Institutional Ethics Committee.

RESULTS

The total number of cases and controls were 104 and 106, respectively, for the present study. Using the independent t-test, the mean age for the case and control groups were found to be 36.75 ± 5.12 and 35.73 ± 4.90 years with a P value of 0.141. Cases had 50 males and 54 females, whereas controls had 60 males and 46 females. Chi-square for gender distribution was 2.46 with a P value of 0.116. Both these statistics showed that both the case and control groups were age- and sex-matched [Figure 1].

Figure 1

Age and sex distribution among case and control groups

Figure 1: Age and sex distribution among case and control groups.

Results of the Hardy-Weinberg (HW) equilibrium analysis showed that the Val66Met SNP was stably distributed in both the case and control groups in our study population as Chi-square values for them were 2.03 and 3.11, respectively, with a P value >0.05 for both (data not shown in tables). As there were no heterozygotes for the CYP2D6 deletional variation, the HW test was not done for it.

The pattern of restriction digestion of the Val66Met SNP and the PCR products of CYP2D6 variants are shown in Figure 2. The bands are labeled for their base pairs (bp) measures against the 100 bp ladder run in lane 1. Three bands for the BDNF restriction digestion are seen in lane 2 and 171, 99 and 72 bp, indicating a heterozygote pattern. Lane 3 having only one band at 171 bp region indicates a homozygous uncut mutant AA genotype. Two bands at 72 and 99 bp in lane 4 indicate a homozygous cut mutant GG genotype. For the PCR products of deletional and non-deletional variants of the CYP2D6 gene, a 750 bp band in lane 5 indicated its non-deletional variant, whereas the absence of any band in lane numbers 6, 7, and 8 indicated the deletional variants.

Figure 2

Restriction digestion pattern of the BDNF and CYP2D6 variants. Lane numbers from left to right: Lane 1: 100 bp DNA ladder, Lane 2: heterozygote (HTZ) genotype of Val66Met SNP of the BDNF gene, Lane 3: homozygous (HZ) genotype of Val66Met SNP of the BDNF gene for A allele, Lane 4: HZ genotype of Val66Met SNP of the BDNF gene for G allele, Lane 5: PCR product of non the non-deletional wild variant of the CYP2D6 gene, Lane 6: Absence absence of any PCR products of the deletional mutant variant of the CYP2D6 gene, Lane 7: negative control using the PCR master mix with any one of the primer but without any sample DNA template, and Lane 8: positive control using beta globin gene with a PCR product of 268 bp

Figure 2: Restriction digestion pattern of BDNF and CYP2D6 variants.

The distribution of different genotypes of the BDNF Val66Met SNP, the CYP2D6 variants, and serum cortisol levels in our study population are shown in Table 1. No significant difference in the distribution of the mutant homozygote AA, wild homozygote GG, or the heterozygote AG genotypes was found between the case and control subjects as the P value from the Chi-square test was >0.05. The distribution of risk allele mutant A and the wild allele G also did not show any significant difference between the two groups as suggested by their Chi-square and odds ratio values. In contrast, the deletional variant of the CYP2D6 showed significantly higher prevalence in the case group than in the control subjects as evident from the Chi-square and P values. The risk ratio of the deletional mutant was also significantly higher in the case group as suggested by a 95% confidence interval of 1.66 to 6.30 for the odds ratio for the deletional genotype of the CYP2D6. Serum cortisol level was also found to be significantly higher in the case group.

Table 1

Statistical tests showing the difference in distribution of genotype of BDNF SNP (rs 6265, val66met), CYP2D6 deletional SNP and serum cortisol levels between the case and control groups

Parameter	Study population (n)	Genotype/Allelotype			Type of statistical test χ2 with P*
		Uncut Homozygote (AA for Met)	Heterozygote (AG)	Cut Homozygote (GG for Val)
BDNF SNP (rs 6265, val66met)	Case (n=104)	26	59	19	1.42, P=0.49
	Control (n=106)	20	62	24
		Total no. of A alleles		Total no. of G alleles	χ2 with P	Odds ratio**
	Case (n=104)	111		97	1.16, P=0.28	0.81, (95% CI=0.55-1.18)
	Control (n=106)	102		110
		No deletion		Deletion	χ2 with P	Odds ratio
CYP 2D6 Deletional SNP	Case (n=104)	68		36	12.68, P<0.001*	3.24 (95% CI=1.66-6.30)**
	Control (n=106)	90		16
		Mean±SD		t (independent sample test)		P
Serum Cortisol value in µg/dl	Case (n=104)	14.18±4.00		13.3	P<0.001*
	Control (n=106)	8.00±2.58

χ2 : Chi square test. *P value is considered to be significant at P<0.05 for a 95% confidence interval. **Odds ratio is considered to be significant if >1 at both lower and higher limits of the 95% confidence interval

The distribution of HAM-D score among these genotypes of the case group is shown in Table 2. HAM-D scores showed significantly higher scores in the deletional variants of the CYP2D6 subjects (P = 0.001) but did not show any significant difference in its distribution between the three genotypes of Val66Met SNP of the BDNF gene, as suggested by the ANOVA method for this comparative assay (F = 1.68, P = 0.19), which showed the same trend even after correcting the P value for multiple t-test using the Bonferroni correction in the posthoc ANOVA [Table 2]. Having found the average value of HAM-D score higher in the CYP2D6 deletional variants, the association was further explored to see whether there was any relationship between the individual HAM-D scores with these genetic variants and serum cortisol levels. For this, the bivariate Pearson’s correlation assay was done, the results of which are shown in Table 3. It is evident from the results that the HAM-D scores are significantly positively correlated with the CYP2D6 deletional variants (R = +0.39, P < 0.001) and serum cortisol values (R = +0.22, P = 0.025) with no such association with the mutant Val66Met variants of the BDNF gene (R = –0.10, P = 0.292). Furthermore, results of the regression analysis more appropriately revealed the significant dependence of the HAM-D scores on CYP2D6 deletional variants (beta-value of 0.388 with P value <0.001) without any such dependence on BDNF variants (beta-value of 0.07 with P value 0.44).

Table 2

Distribution of HAM-D score between the deletional and non-deletional genotypes of CYP2D6 gene among case group

ANOVA for BDNF genotypes
Genotype	n	Mean square (between groups)	F	P*
HAM-D
AA	26	101.41	1.68	0.190
AG	50
GG	19
Posthoc ANOVA using the Bonferroni correction for multiple t-test
Genotype	P after Bonferroni correction
HAM-D
AA vs. AG	0.307
AA vs. GG	0.357
AG vs. GG	0.998
Independent sample t-test for CYP2D6 genotypes
	n	Mean±SD	t	P
HAM-D
Non deletional	68	23.92±5.65	–3.8	0.001*
Deletional	36	28.66±6.62

*P-value is considered to be significant at P<0.05 for a 95% confidence interval

Table 3

Correlation between the HAMD score, serum cortisol levels, and polymorphic variations of BDNF and CYP2D6 genes in the case group

Pearson’s bivariate correlations
	Cortisol	CYP2D6	BDNF	HAM-D
Cortisol
Pearson correlation coefficient (R)	1	0.198	0.082	0.220
Sig. (P)	0.043*	0.410	0.025*
CYP2D6 SNP
Pearson correlation coefficient (R)	0.198*	1	-0.004	0.390
Sig. (P)	0.043*	0.970	<.001*
n	104	104	104	104
BDNF SNP
Pearson correlation coefficient (R)	0.082	-0.004	1	-0.104
Sig. (P)	0.410	0.970	0.292
n	104	104	104	104
HAM-D
Pearson correlation coefficient (R)	0.220	0.390	-0.104	1
Sig. (P)	0.025*	<.001*	0.292
n	104	104	104	104

*Two-tailed correlation is significant for P<0.05

DISCUSSION

Genetic studies of depression show inconclusive evidence of involvement of the BDNF Val66Met (G196A, rs6265) in depression worldwide. Some studies reported that Met allele is associated with low serum BDNF levels and thus associated with depression, whereas a few studies reported that the Val allele is rather associated with depression.

The finding that the Met allele is associated with depressive disorder is reported in a study showing an association with geriatric depression[1920] and combined anxiety and DD.[21] It has been also found to be associated with depression in type 2 diabetes mellitus patients.[22] In contrast, Caldieraro et al. (2018)[23] reported a significantly lower level of BDNF and higher values of inflammatory marker tumor necrosis factor (TNF)-a associated with major depressive disorder with the Val allele. Val alleles have also been reported to be linked to a high anxiety trait and high mean neuroticism scores, which are known risk factors for the development of depression.[2425]

However, there are several studies that have reported no conclusive evidence of the association of this SNP with DD. One study involving 152 cases of DD and 255 control subjects did not find any significant difference in the distribution of Val or Met allele between cases and controls.[26] Furthermore, a meta and gene-based analysis that considered 28 studies from 26 published articles reported that there is no association of Val66Met genetic variants of BDNF with major depression.[27] Keeping in track with these results, the present study also failed to elicit any association between the Val66Met genetic variants of BDNF with DD [Table 1]. Neither, person having the Met allele of BDNF showed high severity of depression as indicated by the HAM-D score [Table 2] or any significant correlation and regression with it [Tables 3 and 4]. So, the present study suggests that although the SNP Val66Met is well established in our population as indicated by Hardy Weinberg’s rule of equilibrium, it is not a causative or associative factor linked to DD in our study population.

Table 4

Regression analysis showing the association between HAM-D scores and genotype variants of BDNF or CYP2D6

Model	Standardized coefficient Beta	t	Significance (P)
1
(Constant)		6.363	0.000
BDNF	-0.070	-0.766	0.445
CYP2D6	0.388	4.249	<0.001*

*P value is considered to be significant at P<0.05 for a 95% confidence interval

BDNF has been considered for long as an important neurotrophic factor related to several psychiatric disorders including schizophrenia, bipolar disorders, anxiety, and DD. It mainly maintains the neurite growth, synaptic transmission, and plasticity by several mechanisms including the receptor tyrosine kinase-mediated PI-3 kinase, Ras/MAP kinase, and PLCg pathways inside the cells, all leading to cellular growth and differentiation.[28] The most common defect with the Val66Met SNP of the BDNF gene has been found to be associated with the cognitive abilities linked to the hippocampus, for example, memory and recognition. However, other cognitive abilities such as planning and learning were not found to be hampered.[2930] The effect of lowered BDNF in the brain on the development of depressive illness was found to be dependent on several factors such as the morphological pattern of the brain,[31] several downstream signaling pathways, gene-by-gene, and gene-by-environmental interactions. Some studies have reported that the effects of Val66Met SNP of BDNF are expressed only when associated with two short alleles of the serotonin transporter-linked promoter region (5-HTTPLR) gene and maltreatment.[32] So, considering all these factors, it is quite explicable that in spite of stabilization of the Val66Met SNP (as indicated by the HW equilibrium), its effect is not significant on DD in our study population due to the probable absence of other confounding factors.

In contrast, CYP2D6 deletional variants were found to be significantly higher in the case group as evident by their Chi-square and odds ratio values [Table 1]. The severity index of major depression, that is, the HAM-D score was also found to be significantly high and directly associated with the deletional variants of the CYP2D6 gene in the case group [Tables 2 and 3]. CYP2D6 is a detoxifying cytochrome P450 enzyme that was evolved for the detoxification of several toxic compounds including toxic plant alkaloids in humans.[33] Their polymorphic variations have also been much older that can be traced to the Neanderthals (3), and those polymorphic variations have been found to influence brain functions in modern humans also. This detoxifying peptide has been found in numerous brain areas such as the thalamus, hypothalamus, hippocampus, substantia nigra, cerebellum, and in several layers of the frontal neocortex[3435] and functions as an important mediator in the synthesis of serotonin, dopamine, and anandamide.[8] Hence, a defect in the CYP2D6 gene and the consequent low levels of this protein leads to lower levels of serotonin and dopamine in several important areas of the brain that may result in depression and anxiety. In fact, deletional polymorphism of CYP2D6 and the consequent very low levels of the corresponding protein have been linked to a reduction in the hippocampal volume and several neuropsychiatric disorders, namely schizophrenia, anxiety, and DD.[36] It is evident that the enzyme is a major protagonist in metabolizing endogenous psychotropic substances and plays a crucial role in brain development and neuronal signaling pathways. Hence, it is being suggested increasingly that its polymorphic variations, particularly the deletional ones, are translated into individual differences in cognition and risk for developing DD.[9] The results of our present study regarding the direct association between the deletional variants of CYP2D6 with major depression and its severity scale [Tables 2 and 4] in our study population keep track with these explanations quite well and furthermore provide cues for a direct dependence of the severity of depression on the deletional variant of the CYP2D6 gene from the regression analysis [Table 4]. Moreover, its direct relationship with cortisol levels [Table 3] indicates a significant elevation in the metabolic stress in DD patients having the deletional variants.

In conclusion, we opine that although genetic factors contribute to only a part of the etiology, it plays a decisive role in the initiation of the disease process. This is particularly relevant to neuropsychiatric disorders, most of which have strong genetic predispositions. Hence, polymorphic variations of genes, such as CYP2D6, which regulate the development and differentiation of the neuronal network of the brain as well as the metabolism of drugs that have significant effects on neuropsychiatric disorders, need to be explored more frequently, particularly in the population group where their effects on psychiatric disorders are reported. Early identification of these variants may provide important molecular and cellular predisposition for the disease and may lay the ground for possible more effective measures of intervention.

Limitations: However, the results of the present study should be interpreted in the context of some of its limitations. The effects of variants in the genes could not be followed up by the estimation of the corresponding proteins in the cerebrospinal fluid (CSF) or blood. As the expression of genes varies significantly among different tissues, the estimation of these proteins in the CSF of the study population would more accurately indicate the final effect of the mutated genes. Another limitation of the present study is that it could include only two candidate genes for the present study. Although variants of these two genes are most widely studied so far worldwide, we propose to include more genetic variants relevant to DD in future studies that could help in understanding the intricate relationship between candidate genes and hub genes involved in this disorder much better.

Financial support and sponsorship

Nil.

Conflicts of interest

There are no conflicts of interest.