An approach to quantitate maternal transcripts localized in sea urchin egg cortex using RT-qPCR with accurate normalization.

The sea urchin egg cortex is a peripheral region of eggs comprising a cell membrane and adjacent cytoplasm, which contains actin and tubulin cytoskeleton, cortical granules and some proteins required for early development. Method for isolation of cortices from sea urchin eggs and early embryos was developed in 1970s. Since then, this method has been reliable tool to study protein localization and cytoskeletal organization in cortex of unfertilized eggs and embryos during first cleavages. This study was aimed to estimate the reliability of RT-qPCR to analyze levels of maternal transcripts that are localized in egg cortex. Firstly, we selected seven potential reference genes, 28S, Cycb, Ebr1, GAPDH, Hmg1, Smtnl1 and Ubb, the transcripts of which are maternally deposited in sea urchin eggs. The candidate reference genes were ranked by five different algorithms (BestKeeper, CV, ΔCt, geNorm and NormFinder) based on calculated level of stability in both eggs as well as isolated cortices. Our results showed that gene ranking differs in total RNA and mRNA samples, though Ubb is most suitable reference gene in both cases. To validate feasibility of comparative analysis of eggs and isolated egg cortices, we selected Daglb-2 as a gene of interest, which transcripts are potentially localized in cortex according to transcriptome analysis, and observed increased level of Daglb-2 in egg cortices by RT-qPCR. This suggests that proposed RNA isolation method with subsequent quantitative RT-qPCR analysis can be used to determine cortical association of transcripts in sea urchin eggs.

Introduction

RT-qPCR is a powerful tool to quantify gene expression levels during development, after exposure to chemical or physical treatment of cells in in vitro. Data normalization in RT-qPCR analysis is aimed to minimize errors in estimation of target mRNA levels. The most common approach is usage of endogenous reference genes [1]. Perfect reference gene should have constant expression, while expression levels of many genes may be considerably changed during development and reveal different expression levels in different tissues and organs. So, each particular case requires seeking for reference genes that are most stably transcribed in all experimental samples. Using variably expressed genes as references leads to incorrect results [2]. Reference genes are chosen by comprehensive evaluation of gene expression stability of candidate genes by combinations of several methods.

Egg is a single cell, which has the potential to develop into a multicellular organism. Oocytes and eggs are polarized by asymmetrically deposited organelles and molecules within the cytoplasm. Asymmetrically distributed maternal molecules, RNAs and proteins, are key regulators of cell specification during early development. One of the ancient mechanisms governing cell polarization is associated with localized RNAs found in oocytes of many model animals, like ascidians, Drosophila, zebrafish and Xenopus. Localized RNAs are also found in somatic cells, like neurons, oligodendrocytes, myoblasts, fibroblasts and epithelial cells [3,4]. In oocytes, different types of cytoskeleton play a major role in anchoring of RNAs [5]. Drosophila nanos is accumulated by diffusion and entrapment posteriorly by binding to actin filaments [6]. Localization of gurken requires static anchoring by Dynein at dorsal-anterior oocyte region and oskar posterior accumulation depends on its interaction with Kinesin heavy chain [7,8]. In Xenopus oocytes, Vg1 RNA is actively transported along microtubes and anchored to actin microfilaments in vegetal oocyte cortex [9].

In sea urchin eggs, cortex may play a key role for accumulation of maternal factors that lead to establishment of polarity along both animal-vegetal and dorsal-ventral axes [10-12]. Disheveled, a protein of the Wnt/β-cathenin pathway regulating specification of vegetal blastomeres, is found in vegetal part of the eggs joined with egg cortex [13]. Also, Panda and Coup-TF mRNAs are found in subcortical area of oocytes, unfertilized eggs and early embryos. Panda reveals gradient distribution is required to restrict Nodal signaling, which leads to dorsal-ventral axis formation in the sea urchin embryos [14]. Coup-TF is a member of steroid-thyroid-retinoic acid superfamily, which controls proper cell specialization along both animal-vegetal and dorsal-ventral axes. Coup-TF knockdown leads to lack of nervous and digestive systems and ciliary band in embryos [15]. Unequal distribution of maternal Coup-TF mRNA has been detected but not in all sea urchin species. Coup-TF were found to be localized laterally to animal-vegetal and 45° angle to dorsal-ventral axes in eggs of Strongylocentrotus purpuratus and Lytechinus variegatus, but not of Paracentrotus redivivus [16,17]. Some proteins necessary for development are associated with egg cortex, suggesting cortical distribution irrespective of directions of prospective developmental axes. Seawi and Vasa have been found in granules localized in egg cortex and later accumulated in primordial germ cells of sea urchin embryos [18,19]. Besides specified animal-vegetal and dorsal-ventral axes in sea urchin eggs early segregation of apical and basolateral cortical regions with involvement of Par proteins [20] suggest the presence of other localized maternal factors that are necessary for epithelial organization of blastoderm.

Cell specification along embryonic axes and establishment of architecture of embryonic cells require many unequally distributed maternal factors in oocytes and eggs, many of them are still unknown for sea urchins. Exciting approach for quantitative RNA measurement called qPCR tomography was designed on Xenopus oocytes [21,22]. Principles of this method consist of RT-qPCR with RNA samples isolated from cryosections of oocytes given along animal-vegetal axis. Thus, the authors propose to use qPCR tomography to analyze spatial expression patterns of RNAs in Xenopus oocytes localized in animal and vegetal poles. Availability of appropriate methods is a good prerequisite for further development of methods to study spatial distribution of maternal transcripts in sea urchin oocytes and eggs. One of the perspective approaches is comparative quantitative analysis of RNAs from sea urchin eggs and their isolated cortices. A method for cortex isolation from sea urchin eggs and embryos since 1970s [23]. In the current study, we used this method to isolate RNA with following RT-qPCR, which allows measurement of levels of cortex-associated maternal transcripts.

The primary goals of this study are to evaluate suitability of quantitative RT-qPCR analysis of egg cortex-associated maternal transcripts and find appropriate reference genes for accurate signal normalization. Firstly, we found that RNA isolation from egg cortices is a feasible procedure with additional stages to further concentrate RNA samples. We selected some previously known (28S, GAPDH, Hmg1 and Ubb), and several new (Cycb, Ebr1 and Smtnl1) candidate reference genes and performed RT-qPCR analysis of egg and isolated egg cortices. This set of genes was subjected to expression stability analysis using BestKeeper [24], coefficient of variation (CV) [25], ΔCt [26], geNorm [27] and NormFinder [28] methods. We found that stability of most selected genes diverged in total RNA and poly(A) RNA samples. The highest stability in both cases was for Ubb, which encodes polyubiquitin. So, this is the most suitable reference gene for comparative analysis of egg and cortex samples. Further, we predicted cortical localization of Daglb-2 by transcriptome analysis and analyzed its levels in the eggs and cortices using RT-qPCR. We compared expression levels in both total and mRNA samples and found higher level of Daglb-2 in mRNA samples of isolated cortices. This finding suggested that usage of mRNA fractions is effective in determining cortical association of Daglb-2 in sea urchin eggs. Our results demonstrate a possibility to perform RT-qPCR analysis of isolated sea urchin egg cortices with accurate signal intensity normalization.

Materials and methods

Animals and sample preparations

Adult S. intermedius sea urchins were collected in the Peter the Great Bay (Sea of Japan) (permission to collect animals 252021030802 of the Federal Agency for Fishery of the Russian Federation), kept in tubes with aerated sea water and fed with algae (Ulva fenestrata and Saccharina japonica) and carrot. Eggs were obtained by injection with 0.5M KCl. Eggs were washed several times with filtered sea water and then two times with CFSS (12mM HEPES, pH 7.6–7.8, 385mM NaCl, 10mM KCl, 21mM Na2SO4, 17mM glucose and 2.5mM MgCl2). Cortices were isolated as described previously [19,29-31]. Briefly, eggs attached to poly-L-lysine-coated coverslips (24×24 mm) were washed twice with CFSS supplemented with 5 mM EGTA. The coverslips were then gently washed by direct sprinkling with cortex isolation buffer (0.8 M mannitol, 50 mM Hepes, 50 mM Pipes, pH 6.5–6.8, 2.5 mM MgCl2, 20 mM EGTA, titrated by KOH) to remove majority of the egg content. Cortex samples were immediately used for RNA isolation. Isolated cortices were prepared on 6–8 coverslips for RNA isolation. To confirm quality of the isolated cortices, the latter were processed for imaging. The cortices were fixed with 3% PFA and 0.1% glutaraldehyde in CIB for 30 min. Coverslips were washed with PBS, mounted in Vectashield and observed using phase contrast and DIC microscopy on Axio Imager A2 equipped with AxioCam HRc digital camera (Carl Zeiss, Germany). For actin labeling, after fixation and washing, the cortices were treated with 0.1 M glycine in PBS (15 min) and then blocked with 1% BSA (20 min). Cortices were stained with phalloidin-CruzFluor 488 (1:150, Santa Cruz, USA) for 1 h, washed and mounted in Vectashield (Vector Laboratories, USA). Confocal images were taken on LSM 710 LIVE (Carl Zeiss, Germany). Images were processed using Fiji software [32].

RNA extraction and cDNA synthesis

Total RNA was extracted from unfertilized eggs and isolated egg cortices using PureLink Mini kit (Thermo Fisher Scientific, USA) with some modifications. Total RNA from eggs was isolated according manufacturer’s manual from 4–5 μl of egg suspension using 0.6 ml of lysis buffer supplemented with DTT. RNA from cortices were isolated using 2.5 ml of lysis buffer per 6–8 coverslips. Each coverslip was consequently placed in Petri dish filled with lysis buffer and cortices were lysed by pipetting. Then, the content was centrifuged through one spin cartridge after addition of equal volume of ethanol. To analyze total RNA, the samples were subsequently concentrated by GeneJet RNA Cleanup and Concentration Micro kit (Thermo Fisher Scientific, USA). Concentrations of the samples were estimated by measuring absorbance at 260 nm on Biophotometer (Eppendorf, Germany). Only samples with high purity (A260/A280 = 1.8–2.0) were used in analysis. To obtain poly(A) mRNA fraction, the RNA samples isolated by PureLink Mini kit were subsequently purified by Magnetic mRNA Isolation kit (New England Biolabs, USA). mRNA concentration was estimated by Qubit RNA HS Assay Kit (Thermo Fisher Scientific, USA). The first strand cDNA was synthetized using ProtoScript II kit (New England Biolabs, USA) from 1 μg of total RNA or 1.5 ng of mRNA with Random Primer Mix (2 and 0.5 μl, respectively). cDNA samples were diluted two times and stored at -80°C until further use.

Transcriptomic analysis

RNA-sequencing was done on entire eggs and isolated cortices. Illumina TruSeq stranded mRNA library construction and generation of raw sequence reads using Illumina NovaSeq 6000 platform (2×100 pair bases) were performed by Macrogen Company (Seoul, South Korea). De novo transcriptome assembly was built by Trinity [33] using Galaxy web-based platform [34] (https://usegalaxy.org). SRAs and assembled transcriptome were submitted to GenBank (BioProject PRJNA686841). The assembled sequences were blasted against Uniprot Swiss-Prot database and against S. purpuratus genome [35] with a cut-off E-value of 1e-5. For quantitative gene expression analysis reads were aligned to the assembled transcriptome with Bowtie [36], and transcript abundance was estimated with RSEM [37]. We analyzed the gene expression values presented in FPKM. Blast and subsequent analysis were performed using computational resources provided by the Shared Services Center “Data Center of FEB RAS” (Khabarovsk) [38].

Selection of candidate reference genes and gene of interest

28S rRNA gene and three protein-coding genes, GAPDH, Hmg1 and Ubb, were previously used as reference genes for embryonic and adult samples of different sea urchin species [39-42]. Three protein-coding genes, Cycb, Ebr1 and Smtnl1, were selected from a list of genes upon preliminary differential expression analysis [37]. Cycb, Ebr1 and Smtnl1 transcripts are abundant and their FPKM values did not significantly differ in samples of eggs and isolated cortices (Table 1). Gene of interest, Daglb-2, was selected from a list of cortically enriched transcripts with FPKM values >0.5 and significantly higher in cortices (Table 1). All used protein-coding sequences were found in the transcriptome. A part of 28S sequence was amplified and sequenced with primers designed to close species S. purpuratus (GenBank Ac. No. AF212171.1): Forward (CGCCCAACAGCTGACTCAGA) and Reverse (TAGCACCAGAAATCGGACGAA). All sequences were deposited in GenBank database. Accession numbers of sequences, primers and products’ sizes are given in Table 2.

Table 1

FPKM values of new candidate reference genes and gene of interest.

Gene	FPKM
	Eggs	Cortices
Cycb	18086.99	15769.9
Daglb-2	2	9
Ebr1	7476.33	6490.31
Smtnl1	4183.87	3781.28

Table 2

Names of genes, primers used for RT-qPCR and reaction efficiency.

Gene	Accession number	Primers	Product size, bp	Efficiency, %	R2
28S	MW915850	F: GATTAACGAGATTCCCACTGTCC R: AAGCACCTCCCACCTATCCTAC	160	94	0.997
Cycb	MW735848	F: TCACATCAAACCCATCATCCA R: TGATTTCAGCTGTGAGAGCGA	139	91	0.996
Daglb-2	OK274215	F: GTATTAGACCCTCTGAGCGCATC R: CCTCTGATTGCGATGACCACT	187	98.4	0.995
Ebr1	MW735849	F: AGAAGTGGGAGTTTTCCTTATCCTC R: ACAGGACAGTCCACTGGGTGAT	195	90.1	1.000
GAPDH	MW735850	F: GATCTAACTGTCCGTCTGAAGAAGC R: GGGCGATACCAGCGTTAGC	181	105.2	0.991
Hmg1	MW735851	F: ACAGAGCAGCCATAAAGAGTGTTC R: TCCTTAGCAGCACCCTTGTCA	127	101.9	0.999
Smtnl1	MW735852	F: CAAGTTTGGTGGAGTGGCG R: GCACTGATACCCGTGGTTGTT	144	92	1.000
Ubb	MW735853	F: TTCAAAGGCAAGACCATCACAC R: AGAGAGTGCGGCCATCCTC	148	92.5	0.999

RT-qPCR

RT-qPCR was conducted on CFX96 Touch Real-Time PCR Detection System (Bio-Rad, USA) using qPCRmix-HS SYBR master mix (Evrogen, Russia). Reaction mixture (25 μl) contained 2 μl of template cDNA and 0.25 μM of each primer with the following temperature program: 94°C for 30 s, 40 cycles of 94°C for 10 s, 55°C for 25 s and 72°C for 15 s. After then, melting curve analysis was done. Three independent biological replicates were prepared and each replicate was analyzed in technical triplicate. PCR efficiency was evaluated using the CFX Manager (Bio-Rad, USA).

Data analysis

The stability of seven potential reference genes were analyzed using five approaches, BestKeeper [24], CV [25], ΔCt [26], geNorm [27] and NormFinder [28]. Daglb-2, which is potentially localized in egg cortex, was used to validate selected reference genes. Relative levels of Daglb-2 in eggs and egg cortices were calculated according to their Ct values using the 2-ΔΔCt method [43]. Statistical analysis and data visualization were performed using GraphPad Prizm 9 Demo software (GraphPad Software, USA).

Results

Quality of isolated cortices and measurement of RNA amount

Only high-quality samples were used for RNA isolation. Whole eggs or highly disrupted cortices were absent on the coverslips (Fig 1A). The presence of cortical granules and specific actin pattern point to integrity of the isolated cortices (Fig 1B and 1C). Yield of total RNA isolated from eggs varied from 6 to 19 μg. Yield of RNA isolated from cortices was 1.2–4 μg. To determine percentage of purified poly(A) RNA, mRNA values were divided by total RNA values given for mRNA purification and then multiplied by 100 in each experiment. Amount of mRNA was 84–300 ng (1.43(mean) ± 0.23 (SD)% of input) from eggs and 8.4–18.7 ng (0.64(mean) ± 0.12 (SD)% of input) from cortices. Percentage of purified poly(A) RNA from isolated cortices was 2.27(mean)±0.34(SD) times lower than that from eggs.

Fig 1

Isolated cortices from unfertilized eggs.

(A) Phase contrast image of isolated cortices attached to poly-L-lysine treated coverslip. (B) DIC image of cortex at high magnification. Granular pattern indicates multiple cortical granules. (C) Confocal image of actin staining. There is small punctate pattern of actin staining, which is typical for egg cortices. Scale bars 50 μm (A), 10 μm (B, C).

Selection of candidate reference genes, specificity and amplification efficiency of RT-qPCR

Seven potential reference genes for comparative RT-qPCR analysis of eggs and isolated cortical layers were tested to find appropriate genes that can be used for accurate normalization. Four genes were selected based on literature data: 28S, GAPDH, Hmg1, Ubb. Three genes, Cycb, Ebr1 and Smtnl1, were selected from a list of preliminary tested genes that are abundant in both eggs and isolated cortices based on transcriptomics analysis (Table 1). Also, we tested several genes previously used for normalization or found by transcriptome analysis, but we omitted them because PCRs specific for these genes using our primers did not fit the required amplification efficiency (90–110%).

All chosen genes were tested for reaction specificity which was determined by melting curve analysis. Single peaks were detected for all tested genes (S1 Fig). No signals were detected with all primer pairs without templates. Amplification efficiencies were calculated by standard curve method using two-, four- or five-fold serial dilutions of cDNA samples. Amplification efficiencies ranged between from 90.1% to 105.2%. Correlation coefficients (R2) displayed values 0.991–1.000 (Table 2).

Levels of candidate reference genes

Levels of tested candidate reference genes in six samples (three samples from eggs and three samples from isolated egg cortices) were evaluated by RT-qPCR of total RNA and mRNA samples. Raw and mean Ct values are shown in S1 Table. Maximum differences in Ct values between technical replicates were <0.5 cycles. In total RNA samples, among tested genes 28S and Ubb were the most abundant genes with the lowest means of Ct values (15.6 and 15.91, respectively). GAPDH showed the lowest level with highest mean Ct value (28.02). Maximum and minimum Ct variation were observed for 28S (4.87 cycles) and Smtnl1 (0.66 cycles), respectively (Fig 2A). In mRNA samples, most abundant genes were Ubb (mean Ct value 20.99) and 28S (mean Ct value 21.52). GAPDH revealed minimal level with mean Ct of 32.24. 28S was most variative with Ct range of 3.79 cycles. The least variative gene was Ubb with Ct range of 1.1 cycles (Fig 2B).

Fig 2

Boxplot of Ct values for candidate reference genes in all samples.

(A) Ct values in cDNA samples synthesized from total RNA (B) Ct values in cDNA samples synthesized from mRNA. The boxes show interquartile range (25–75%), horizontal lines represent medians. The whiskers show the minimum and maximum values. No outliers were detected.

Expression stability analysis and determination of minimal number of reference genes for normalization

We employed expression stability analysis using five different algorithms to evaluate of level variations for each transcript in unfertilized eggs and egg cortices.

BestKeeper analysis: this method allows to analyze stability by SD and CV generated from raw Ct values [24]. The lowest SD and CV values correspond to the highest stability. SD values ≤1 indicate acceptance as reference genes. According to the SD values, the most stable gene for total RNA and mRNA samples was Ubb (SD value = 0.21 and 0.32, respectively) (Fig 3A). The least stable gene was 28S (SD = 1.72 for total RNA and 0.99 for mRNA). Total RNA value is higher than 1, which is unacceptable for usage of 28S as reference gene. For mRNA, the level of 28S rather reflect the degree of purification.

Fig 3

Stability analysis of candidate reference genes performed by different methods.

Stability estimated by BestKeeper (A), CV (B) ΔCt (C), geNorm (D) and NormFinder (E).

CV analysis: CV method is simply based on comparison of CV of expression levels. The lowest CV value, which is defined as a ratio of SD to average 2Ctmin-Ctsample, corresponds to the highest intragroup stability [25]. The least stable gene in both total RNA and mRNA samples was 28S with CV values of 103.4% and 68.17%, respectively. The most stable gene in total RNA samples was Smtnl1 (CV: 18.41%). In mRNA samples, Ubb showed highest stability (CV: 32.43%) (Fig 3B).

ΔCt analysis: the ΔCt method is based on pairwise comparisons and calculation of SD of ΔCt values for each pair of genes [26]. The lowest value of average SD corresponds to the highest stability of expression among evaluated genes. Our results showed that for total RNA the most stable gene was Ebr1 (SD: 0.66) and the least stable was 28S (SD: 1.75) (Fig 3C). In mRNA samples, the most stable gene was Hmg1 (SD: 0.743) and least stable gene was again 28S (SD: 1.72).

geNorm analysis: this method is based on pairwise variation that consequently exclude least stable genes after each step of analysis. Finally, two most stable genes are determined. geNorm utilize average expression stability (M) values [27]. Threshold M value of ≤ 0.5 indicate good reference genes. The most stable genes have the lowest M values. As shown, among seven tested genes the best pair for total RNA was Smtnl1/Ubb with M value of 0.16 (Fig 3D). 28S and Cycb showed M values ≥ 0.5, which indicated their inapplicability as reference genes. The best pair in mRNA analysis was GAPDH/Cycb with M value of 0.33 followed by Hmg1 (M value 0.4). M values of other genes were above 0.5, which makes them inappropriate as reference genes. Among them, 28S was the least stable (M value 0.94) (Fig 3D). Another parameter calculated by geNorm is pairwise variation (Vn/n+1) between normalization factors. It allows defining minimal number of reference genes for accurate normalization. Cut-off threshold of 0.15 is recommended to determine the optimal number reference genes [27,44]. In our test, all pairwise variations in both total RNA and mRNA cases revealed M value <0.15 (Fig 4), which point to usage of two reference genes for normalization.

Fig 4

Determination of minimal number of reference genes for accurate normalization.

Pairwise variations (Vn/n+1) were calculated by geNorm in all samples (eggs and isolated egg cortices) for total RNA (A) and mRNA (B).

NormFinder analysis: this method takes into account both intragroup and intergroup expression variability. The most stable genes have the lowest stability values [28]. NormFinder analysis revealed that the most and the least stable genes were Ebr1 (0.125) and 28S (0.97), respectively, in total RNA (Fig 3E). Additionally, NormFinder determined the Ebr1/Hmg1 pair as the best combination of reference genes, as these genes have the lowest values. In mRNA samples, Cycb and 28S revealed the highest (0.2) and the lowest stability (0.98), respectively. The best pair of reference genes according to NormFinder was Cycb/GAPDH.

After analysis by different methods, we summarized the ranking of candidate reference genes, which is presented in Table 3. For total RNA, general view showed that Ubb, Ebr1 and Smtnl1 were the three most stable, and therefore, the most appropriate reference genes. BestKeeper analysis revealed that Ubb was most stable gene. ΔCt and NormFinder analyses detected Ebr1 as most stable and according to CV method the most stable gene was Smtnl1. geNorm does not allow recognition of the best reference gene, this method determines the pair of genes with the highest stability. For total RNA the best pair of reference genes was found to be Smtnl1/Ubb. Data obtained from mRNA samples showed different ranking of genes (Table 3). Ubb was ranked as most stable by BestKeeper and CV methods. ΔCt determined Hmg1 as the most stable gene, and Cycb was the most appropriate reference gene according to NormFinder analysis. geNorm revealed Cycb/GAPDH as the most stable pair. Only one gene, Ubb, was found among the most stable genes in two separate analyses of total RNA and mRNA. 28S ranked as the least stable gene during analyses of both type of RNA samples.

Table 3

Stability ranking of candidate reference genes given upon BestKeeper, CV, ΔCt, geNorm and NormFinder.

Ranking	1	2	3	4	5	6	7
total RNA
BestKeeper	Ubb	Smtnl1	Ebr1	Cycb	GAPDH	Hmg1	28S
CV	Smtnl1	Ubb	Ebr1	Cycb	Hmg1	GAPDH	28S
ΔCt	Ebr1	Ubb	Smtnl1	Hmg1	GAPDH	Cycb	28S
geNorm	Smtnl1/Ubb		Ebr1`	Hmg1	GAPDH	Cycb	28S
NormFinder	Ebr1	Hmg1	Ubb	Smtnl1	GAPDH	Cycb	28S
mRNA
BestKeeper	Ubb	Ebr1	GAPDH	Hmg1	Cycb	Smtnl1	28S
CV	Ubb	Ebr1	Smtnl1	Cycb	Hmg1	GAPDH	28S
ΔCt	Hmg1	Cycb	GAPDH	Ubb	Ebr1	Smtnl1	28S
geNorm	Cycb/GAPDH		Hmg1	Ubb	Ebr1	Smtnl1	28S
NormFinder	Cycb	GAPDH	Ubb	Hmg1	Ebr1	Smtnl1	28S

Validation of candidate reference genes

To validate the reliability of recommended reference genes, Daglb-2 was selected from the list of cortically-enriched transcripts. Normalization of signal intensity was done using top-ranked genes and least stable 28S. Ebr1, Smtnl1 and Ubb were found to be most appropriate reference genes for total RNA samples (Table 3). After normalization to Ebr1, Smtnl1, Ubb and pair Smtnl1/Ubb reference genes, the levels of Daglb-2 in egg cortices were found to be mildly lower than in eggs (Fig 5A), but these differences between samples and reference genes were statistically insignificant. Normalization to the least stable 28S gene showed 5.64-fold higher level of Daglb-2 in cortices. In total RNA samples, we could not confirm that Daglb-2 is cortically-enriched transcript. Nevertheless, nearly equal Daglb-2 signals normalized to the top-ranked genes in cortices indicate the reliability of chosen reference genes. Daglb-2 levels measured in mRNA samples were normalized to appropriate top-ranked genes, Cycb, Hmg1, Ubb and Cycb/GAPDH (Table 3). In contrast to values calculated in total RNA samples, mRNA analysis showed increased levels of Daglb-2 in cortices (Fig 5A), from 2.18-fold higher level in case of Cycb to 2.65-fold higher level in case of Ubb. Although values normalized to Cycb, Hmg1 and Cycb/GAPDH in cortices were higher than in eggs, they did not reveal statistical significance, which indicate variable Ct values of these genes (Fig 2B). Only values normalized to Ubb, with Ct in narrow range, were statistically significant (Fig 5A). We compared relative levels of Daglb-2 normalized to Ubb in total RNA and mRNA (Fig 5B). Total RNA samples did not detect significant difference in mRNA levels between eggs and isolated cortices, while purified mRNA allowed detection of significant enrichment of Daglb-2 in cortices. This finding suggested that analysis of mRNA is more sensitive than total RNA. 28S which is the worst reference gene in both types of RNA samples showed high Daglb-2 levels in cortices due to its low levels in cortices.

Fig 5

Comparison of the normalized relative levels of Daglb-2 between eggs and isolated cortices.

(A) To normalize values, three most stable genes and best pair of genes were selected. Also, data were normalized to least stable gene (28S). (B) Relative levels of Daglb-2 normalized to Ubb. P-values indicate statistical significance between columns based on t-test.

Discussion

RT-qPCR is a convenient method to estimate expression of genes in different biological contexts. The primarily goal of this study is to design an approach based on RT-qPCR for quantitative analysis of cortically-associated maternal transcripts of sea urchin eggs. The proposed approach is based on comparison the levels of genes of interest between eggs and isolated egg cortices. The first necessary prerequisite to perform this analysis is a suitable method for RNA isolation. We adapted column-based RNA isolation protocol for isolated egg cortices. Isolated total RNA may be subsequently processed to obtain purified poly(A) RNA. Second prerequisite for accurate RT-qPCR analysis is usage of appropriate reference transcripts (genes), the levels of which are less variable among eggs and isolated cortices. We analyzed four candidate reference genes selected from known reference genes and three relatively abundant transcripts detected in both entire eggs of S. intermedius and their isolated cortices. To evaluate comprehensively the stability of selected genes, 28S, GAPDH, Hmg1, Ubb, Cycb, Ebr1 and Smtnl1, we used five different methods and compared the derived results. During analysis of total RNA samples, three programs, BestKeper, ΔCt and geNorm, showed similar results. According to these programs, Ebr1, Smtnl1 and Ubb were the three most stable genes (Table 3). Each program ranked these genes differently, but in each case, these genes ranked top 3 as most stable. Results of NormFinder were different, giving Ebr1, Hmg1 and Ubb as most stable genes. We decided to designate Ebr1, Ubb and Smtnl1 as the most suitable reference genes upon analysis by BestKeper, ΔCt and geNorm. Estimation of level of stability in mRNA samples ranked candidate reference genes differently than in total RNA samples. According to BestKeeper and CV methods Ubb was the most stable gene, while other methods showed Hmg1 (ΔCt), Cycb (NormFinder) and Cycb/GAPDH pair (geNorm) as best reference genes.

Among all the tested genes, only Ubb showed suitability for quantitative RNA analysis of total RNA and mRNA samples from isolated egg cortices. Ubb, which encodes polyubiquitin, is a well-known reference gene in quantitative expression analysis of sea urchin embryos, as level of Ubb mRNA is relatively stable during sea urchin development [39,45]. Also, Ubb is suitable for both qualitative and quantitative expression analysis during sea urchin gametogenesis [46,47]. Two new candidate reference genes found by our transcriptomic analysis with abundant transcripts in both eggs and egg cortices, Ebr1 and Smtnl1, previously have not been used as internal control. These two genes were shown to be suitable only for total RNA. Ebr1 encodes egg cell-surface protein. It is one of proteins that are responsible for species-specific sperm adhesion to sea urchin eggs via interaction with Bindin localized on spermatozoan surface [48,49]. Smtnl1 encodes a muscle protein that participates in regulation of muscle contraction and adaptation in mammals [50], while in sea urchin embryos its functions remain unstudied.

A main goal of this study was testing the reliability of quantitative approach to analyze transcripts that anchored in subcortical area of eggs. To test the reliability of our approach, we evaluated the expression of any gene of interest that could potentially be associated with egg cortex. Unfortunately, we excluded from our analysis the transcripts have been found to be presumably localized in cortex, that is, Panda and Coup-TF [14,17]. We have not found Panda homolog in S. intermedius egg transcriptome. Assembled part of Coup-TF is a GC-rich region, which was poorly amplified by RT-qPCR. To find cortex-associated transcript for our analysis, we selected transcripts in transcriptome, the levels (in FPKM) of which were higher in cortices than in eggs. Daglb-2 was chosen as a transcript that may be localized in egg cortex according to transcriptomic analysis. Daglb-2 encodes the homolog of mammal transmembrane enzyme diacylglycerol lipase beta. Diacylglycerol lipases alpha and beta localized in plasma membrane generate endocannabinoids from membrane lipids, primarily 2-arachidonoylglycerol. Endocannabinoids are ligands of cannabinoid receptors. Binding endocannabinoids with receptors activate inflammatory response in macrophages and neural cells and inhibit the release of neurotransmitters in central and peripheral nervous systems [51-53]. Endocanabinoids also play a significant role in many reproductive events of invertebrates and vertebrates [54]. Experiments that showed inhibition of acrosomal reaction by either synthetic or natural cannabinoids from marihuana suggest the presence of cannabinoid receptors on sea urchin spermatozoan surface and their significance in polyspermy blockage [55,56]. Later on, transcriptome analysis confirmed the presence of mRNA sequence of cannabinoid receptor 1 in sea urchin testes [57]. Sea urchin ovaries contain endocannabinoid, anandamide, which is other common ligand for cannabinoid receptors [58]. Although the presence of 2-arachidonoylglycerol have not studied in sea urchin eggs, Daglb-2 may be necessary for the synthesis of 2-arachidonoylglycerol, which is probably required to prevent polyspermy.

In unfertilized eggs, cortical localization of Daglb-2 may be necessary for local translation of the encoded putative transmembrane protein, which is integrated in plasma membrane. Although translation is significantly increased after fertilization, slow rate of protein synthesis has been found in unfertilized eggs [59,60]. Eggs can be stored in ovaries for weeks to months until spawning [61] and translation may require maintaining metabolism via renewed protein pool during long-term egg storage. Local translation probably takes place in mitotic spindles of early sea urchin embryos [62], but is unknown for cortical regions of sea urchin eggs and early embryos. Commonly, transmembrane proteins are translated on ribosomes associated with rough endoplasmic reticulum. Transmembrane proteins are introduced and subsequently folded in endoplasmic reticulum membrane. Plasma membrane proteins are translocated to Golgi apparatus and then to cell membrane. The presence of rough endoplasmic reticulum and Golgi bodies in cortical region of sea urchin eggs [19,63-66] suggest that transmembrane Daglb-2 may be translated in cortical area. Taking into account our transcriptomic analysis and predicted functions of Daglb-2, we propose this gene to be suitable as a gene of interest to approbate approach of quantitative evaluation of cortex-associated transcripts in sea urchin eggs.

Many researchers normalize signal intensities of studied genes against a single reference gene. Nevertheless, it is necessary to confirm invariant expression of potential reference gene under all experimental conditions. Alternatively, usage of two or more reference genes is the better choice [27,67]. geNorm allows determination of number of reference genes for reliable normalization (two genes is minimal number). Our analysis did not show significant difference among one type of samples (total RNA or mRNA). Fundamental differences were found between total RNA and mRNA data. Total RNA samples did not show significant differences of Daglb-2 levels between eggs and their cortices. Analysis of purified mRNA revealed increased Daglb-2 levels in cortices supporting our differential expression results. While normalization to any suitable reference gene showed similar ratios of Daglb-2 levels between eggs and cortices, only using Ubb exhibited significant differences. Taking into account these results and lowest Ct variation of Ubb among evaluated genes, we propose that Ubb is the best choice for intensity signal normalization. Ubb was defined as the most stable gene by Best Keeper and CV methods. Different methods for evaluation of expression stability are based on different principles. They may well define gene as a least stable, but the most stable genes are different [68]. In case of total RNA samples, we propose to use any of the following genes: Ubb, Ebr1 and Smtnl.

An important question is why Daglb-2 cortical enrichment is detected only in case of poly(A) RNA analysis. Increased levels of Daglb-2 in isolated cortexes were detected by mRNA transcriptome analysis and also by RT-qPCR using poly(A)-enriched samples, while RT-qPCR of total RNA samples showed similar levels of Daglb-2 in both eggs and cortices. Evidently, a major cause of different ratios of Daglb-2 levels between total and mRNA templates is different amounts of polyadenylated RNAs in eggs and cortices. According to our data, percentage of mRNA in cortex-associated RNA pool is 0.64%, which 2.27-fold lower than in entire eggs. Hence, total RNA templates from eggs and cortices are markedly differ by mRNA amounts, which led to misrepresentation of Daglb-2 levels. Also, analysis of poly(A) RNA offers additional advantage in comparison to total RNA. It is known that usage of mRNA templates may result in greater sensitivity of RT-qPCR, which improve measurements of transcript levels [69,70]. Lower sensitivity of RT-qPCR with total RNA may also affect quantification of Daglb-2 levels in eggs and cortices.

Conclusions

This study provided the first report on efficacy of RT-qPCR analysis of maternal transcript to verify its association with egg cortex in sea urchin eggs. Firstly, optimization of RNA isolation method using isolated cortices indicated feasibility of extracting adequate levels of RNA required for cDNA synthesis. Next, evaluation of possible reference genes allowed the determination of appropriate genes that can be used for signal intensity normalization either for total RNA or mRNA samples. Finally, RT-qPCR analysis of presumably cortex-associated Daglb-2 showed increased levels of its transcript in egg cortices revealing its correlation with transcriptomic analysis. Thereby, RT-qPCR may be utilized as one of methods to verify cortex association of mRNAs in sea urchin eggs using poly(A) RNA templates.

Melt curve analysis of PCR products from one biological replicate.

Egg and cortex melt curves are given together for each gene. Negative control (template-free) is marked by Neg.

(TIF)

Click here for additional data file.

Raw Ct values, calculated means and standard deviations in all samples.

(XLSX)

Click here for additional data file.

22 Dec 2021

A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). You should upload this letter as a separate file labeled 'Response to Reviewers'.

A marked-up copy of your manuscript that highlights changes made to the original version. You should upload this as a separate file labeled 'Revised Manuscript with Track Changes'.

An unmarked version of your revised paper without tracked changes. You should upload this as a separate file labeled 'Manuscript'.

If you would like to make changes to your financial disclosure, please include your updated statement in your cover letter. Guidelines for resubmitting your figure files are available below the reviewer comments at the end of this letter.

If applicable, we recommend that you deposit your laboratory protocols in protocols.io to enhance the reproducibility of your results. Protocols.io assigns your protocol its own identifier (DOI) so that it can be cited independently in the future. For instructions see: https://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocols. Additionally, PLOS ONE offers an option for publishing peer-reviewed Lab Protocol articles, which describe protocols hosted on protocols.io. Read more information on sharing protocols at https://plos.org/protocols?utm_medium=editorial-email&utm_source=authorletters&utm_campaign=protocols.

We look forward to receiving your revised manuscript.

Kind regards,

Wei Cui, Ph.D.

Academic Editor

PLOS ONE

Journal Requirements:

When submitting your revision, we need you to address these additional requirements.

1. Please ensure that your manuscript meets PLOS ONE's style requirements, including those for file naming. The PLOS ONE style templates can be found at

https://journals.plos.org/plosone/s/file?id=wjVg/PLOSOne_formatting_sample_main_body.pdf and

https://journals.plos.org/plosone/s/file?id=ba62/PLOSOne_formatting_sample_title_authors_affiliations.pdf.

2. We note that the grant information you provided in the ‘Funding Information’ and ‘Financial Disclosure’ sections do not match.

When you resubmit, please ensure that you provide the correct grant numbers for the awards you received for your study in the ‘Funding Information’ section.

3. Thank you for stating the following in the Acknowledgments Section of your manuscript:

[This work was supported by the Russian Foundation for Basic Research (Grant number: 20-04-00332). The authors are grateful to Dr. Andrey Kukhlevsky for Sanger sequencing.]

We note that you have provided funding information that is not currently declared in your Funding Statement. However, funding information should not appear in the Acknowledgments section or other areas of your manuscript. We will only publish funding information present in the Funding Statement section of the online submission form.

Please remove any funding-related text from the manuscript and let us know how you would like to update your Funding Statement. Currently, your Funding Statement reads as follows:

[NO]

Please include your amended statements within your cover letter; we will change the online submission form on your behalf.

4. We note that you have indicated that data from this study are available upon request. PLOS only allows data to be available upon request if there are legal or ethical restrictions on sharing data publicly. For more information on unacceptable data access restrictions, please see http://journals.plos.org/plosone/s/data-availability#loc-unacceptable-data-access-restrictions.

In your revised cover letter, please address the following prompts:

a) If there are ethical or legal restrictions on sharing a de-identified data set, please explain them in detail (e.g., data contain potentially sensitive information, data are owned by a third-party organization, etc.) and who has imposed them (e.g., an ethics committee). Please also provide contact information for a data access committee, ethics committee, or other institutional body to which data requests may be sent.

b) If there are no restrictions, please upload the minimal anonymized data set necessary to replicate your study findings as either Supporting Information files or to a stable, public repository and provide us with the relevant URLs, DOIs, or accession numbers. For a list of acceptable repositories, please see http://journals.plos.org/plosone/s/data-availability#loc-recommended-repositories.

We will update your Data Availability statement on your behalf to reflect the information you provide.

5. Please include your full ethics statement in the ‘Methods’ section of your manuscript file. In your statement, please include the full name of the IRB or ethics committee who approved or waived your study, as well as whether or not you obtained informed written or verbal consent. If consent was waived for your study, please include this information in your statement as well.

6. Please include captions for your Supporting Information files at the end of your manuscript, and update any in-text citations to match accordingly. Please see our Supporting Information guidelines for more information: http://journals.plos.org/plosone/s/supporting-information.

Additional Editor Comments:

Both expert reviewers found this manuscript interesting. However, several major questions were also pointed out and authors need to address them in their revision. Please refer to the reviewers' comments for details.

[Note: HTML markup is below. Please do not edit.]

Reviewers' comments:

Reviewer's Responses to Questions

Comments to the Author

1. Is the manuscript technically sound, and do the data support the conclusions?

The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented.

Reviewer #1: Partly

Reviewer #2: Partly

**********

2. Has the statistical analysis been performed appropriately and rigorously?

Reviewer #1: I Don't Know

Reviewer #2: N/A

**********

3. Have the authors made all data underlying the findings in their manuscript fully available?

The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified.

Reviewer #1: Yes

Reviewer #2: Yes

**********

4. Is the manuscript presented in an intelligible fashion and written in standard English?

PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here.

Reviewer #1: No

Reviewer #2: Yes

**********

5. Review Comments to the Author

Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters)

Reviewer #1: This study attempts to use RT-qPCR as a means of quantitating maternal mRNA transcripts in the cortex of sea urchin eggs. The paper concentrates on the evaluation of seven potential reference genes that are ranked based on the results of five different methods and then indicates that the gene of interest Daglb-2 shows increased levels of mRNA in cortices relative to the best reference genes. I have the following comments about this research.

Major Points:

1) Unlike the case with Xenopus, C. elegans or Drosophila eggs, very few polarized maternal proteins or mRNAs have been identified in sea urchin eggs. This despite extensive research effort over several decades. The sea urchin early embryo is often cited as a prime example of a highly regulative embryo with irreversible polarization setting up only once the embryo has reached the 16 cell stage. The authors suggest that RT-qPCR would be useful for the identification of maternal mRNAs that are potentially enriched in the cortex. They indicate that the mRNA for the genes Panda (ref 14) and Coup-TF (refs 16, 17) are associated with subcortical areas of oocytes, eggs, and embryos. However, although in situ hybridization (ISH) imaging does suggest a gradient of Panda in oocytes, cortical association is not clear and even the Panda gradient itself is not obvious in eggs (Fig 5 in ref 14). In addition, the apparent cortical association of Coup-TF in the oocyte/egg appears to be present in only two of three sea urchin species tested (refs 16, 17). Given that these mRNAs have some literature precedence for cortical association it would make sense to use then as targets for the RT-qPCR experiment that the authors conduct in the present study. However, the authors indicate that they excluded these transcripts because they were unable to identify a Panda homologue in their species and that the G-C rich nature of Coup-TF made it difficult to amplify via RT-qPCR. Instead they choose to focus on the transcript of the gene Daglb-2 which they indicate was identified by transcriptomic analysis. The authors need to provide additional details about the nature of how this transcriptomic analysis was performed and what were the results. For example, were cortices isolated in a similar manner? Did other transcripts show cortical enrichment? Also, a biological role for the suggested cortical localization of the Daglb-2 protein is not provided. Do the authors have a hypothetical rationale why endocannabinoid signaling would be subject to polarized maternal distribution? They suggest that the transcript is localized in the cortex because of a need for local translation and integration into the membrane. Are the authors aware of precedence in the sea urchin for the localized cortical translation of membrane proteins? In general, the authors need to provide a better argument about why they ended up focusing on Daglb-2.

2) Given that this is a “proof-of-concept” study it is important that the authors provide the appropriate documentation of their methods. The description that they give in the Materials and Methods section of the cortex isolation process (page 5-6) is inadequate and incomplete. In addition, they need to provide low and high magnification phase contrast microscopy images of the cortical preparations that they generate for RNA isolation. These images would make it clear how intact the cortices were, to include the presence or absence of cortical granules.

3) This study would be greatly improved by providing RNA FISH localization evidence of the cortical association of Daglb-2. This evidence would help validate the results of their RT-qPCR results. The senior author has previously published work involving confocal microscopy of the immunofluorescent localization of proteins in sea urchin egg cortices (ref 19) so the expertise and imaging instrumentation is available. In addition, it would be important to provide FISH and/or ISH images of Daglb-2 in whole oocytes, eggs and early embryos.

Minor Points:

1) The paper needs to be carefully edited for proper English grammar, word choice and sentence structure. In its current form, it is sometimes difficult to decipher the meaning of what is written.

2) What type of statistical analysis was performed on the data in Fig 4? T tests? ANOVA?

3) The fact that Daglb-2 transcripts were found to be cortex-enriched only in mRNA and not in total RNA analysis is puzzling. The authors should speculate on what might be causing this difference.

Reviewer #2: In this manuscript, authors tried to establish a method for quantitate maternal genes in eggs of a sea urchin, Strongylocentrotus intermedius. Especially, authors tried to find the stable reference gene, which is essential for the qPCR analysis. Personally, I recognize this interesting, but I also have concerns.

Obtaining RNA and the usage of template RNA for cDNA synthesis look not appropriate. For example, authors showed Ct in Fig1, in which authors treat the data as absolute quantity. However, authors obtained RNA from countless eggs and set RNA to 1 µg to synthesize cDNA. If the authors need the absolute quantity, the authors need to count the number of eggs, to use one/two step RT-qPCR kit, by which we do not have to change tubes, and same egg-number volume of cDNA should be applied into each qPCR tube. In another example, the protocol of cortex isolation is not stable (although the authors described it stable). This is because nobody can expect how much % of egg cortex are remained on the coverslip. In addition, RNA composition might be different between each pole of the egg since the protein localization is different between animal and vegetal poles. I also have a question how much maternal mRNA is trapped by poly(A) selection. It is well known that poly-adenylation system starts at the fertilization, meaning that un-fertilized eggs contain a number of non-poly(A) RNA. So, it is better for authors to explain such RNA characteristics (if I were wrong, please ignore this point).

Therefore, if the authors intend to make “standard” methods for maternal RT-qPCR for eggs/cortex, initially it is necessary to set the protocol much more precisely in each step.

**********

6. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.

If you choose “no”, your identity will remain anonymous but your review may still be made public.

Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.

Reviewer #1: No

Reviewer #2: No

[NOTE: If reviewer comments were submitted as an attachment file, they will be attached to this email and accessible via the submission site. Please log into your account, locate the manuscript record, and check for the action link "View Attachments". If this link does not appear, there are no attachment files.]

While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com/. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Registration is free. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email PLOS at figures@plos.org. Please note that Supporting Information files do not need this step.

6 Apr 2022

Comments concerning the Journal Requirements:

"When submitting your revision, we need you to address these additional requirements.

1. Please ensure that your manuscript meets PLOS ONE's style requirements, including those for file naming. The PLOS ONE style templates can be found at

https://journals.plos.org/plosone/s/file?id=wjVg/PLOSOne_formatting_sample_main_body.pdf and

https://journals.plos.org/plosone/s/file?id=ba62/PLOSOne_formatting_sample_title_authors_affiliations.pdf."

- We re-formatted the Manuscript according to the PLOS ONE’s requirements.

"2. We note that the grant information you provided in the ‘Funding Information’ and ‘Financial Disclosure’ sections do not match.

When you resubmit, please ensure that you provide the correct grant numbers for the awards you received for your study in the ‘Funding Information’ section.

3. Thank you for stating the following in the Acknowledgments Section of your manuscript:

[This work was supported by the Russian Foundation for Basic Research (Grant number: 20-04-00332). The authors are grateful to Dr. Andrey Kukhlevsky for Sanger sequencing.]

We note that you have provided funding information that is not currently declared in your Funding Statement. However, funding information should not appear in the Acknowledgments section or other areas of your manuscript. We will only publish funding information present in the Funding Statement section of the online submission form.

Please remove any funding-related text from the manuscript and let us know how you would like to update your Funding Statement. Currently, your Funding Statement reads as follows: [NO]

Please include your amended statements within your cover letter; we will change the online submission form on your behalf."

- We removed funding information in Acknowledgments and provide a grant number in Funding Information section and in the Cover Letter.

"4. We note that you have indicated that data from this study are available upon request. PLOS only allows data to be available upon request if there are legal or ethical restrictions on sharing data publicly. For more information on unacceptable data access restrictions, please see http://journals.plos.org/plosone/s/data-availability#loc-unacceptable-data-access-restrictions.

In your revised cover letter, please address the following prompts:

a) If there are ethical or legal restrictions on sharing a de-identified data set, please explain them in detail (e.g., data contain potentially sensitive information, data are owned by a third-party organization, etc.) and who has imposed them (e.g., an ethics committee). Please also provide contact information for a data access committee, ethics committee, or other institutional body to which data requests may be sent.

b) If there are no restrictions, please upload the minimal anonymized data set necessary to replicate your study findings as either Supporting Information files or to a stable, public repository and provide us with the relevant URLs, DOIs, or accession numbers. For a list of acceptable repositories, please see http://journals.plos.org/plosone/s/data-availability#loc-recommended-repositories.

We will update your Data Availability statement on your behalf to reflect the information you provide."

- We have no restrictions to provide our data. We uploaded all required data in GenBank (SRAs and assembled transcriptome are available in BioProject PRJNA686841).

"5. Please include your full ethics statement in the ‘Methods’ section of your manuscript file. In your statement, please include the full name of the IRB or ethics committee who approved or waived your study, as well as whether or not you obtained informed written or verbal consent. If consent was waived for your study, please include this information in your statement as well."

- In our case, the type of ethics statement is Field Research. We added number of Permission and name of agency in Materials and Methods. Also, this information is given in online submission form.

"6. Please include captions for your Supporting Information files at the end of your manuscript, and update any in-text citations to match accordingly. Please see our Supporting Information guidelines for more information: http://journals.plos.org/plosone/s/supporting-information."

- We fitted Supporting Information captions to the PLOS ONE’s requirements and included these captions at the end of the manuscript.

Additional Editor Comments:

Both expert reviewers found this manuscript interesting. However, several major questions were also pointed out and authors need to address them in their revision. Please refer to the reviewers' comments for details.

Answers to the reviewers’ comments

Reviewer #1: This study attempts to use RT-qPCR as a means of quantitating maternal mRNA transcripts in the cortex of sea urchin eggs. The paper concentrates on the evaluation of seven potential reference genes that are ranked based on the results of five different methods and then indicates that the gene of interest Daglb-2 shows increased levels of mRNA in cortices relative to the best reference genes. I have the following comments about this research.

Major Points:

"1) Unlike the case with Xenopus, C. elegans or Drosophila eggs, very few polarized maternal proteins or mRNAs have been identified in sea urchin eggs. This despite extensive research effort over several decades. The sea urchin early embryo is often cited as a prime example of a highly regulative embryo with irreversible polarization setting up only once the embryo has reached the 16 cell stage."

- Indeed, sea urchin early development is often referred as regulative. Though, this point of view is not common and debate is still going on. We believe that both induction and determination (or reversive specification) take place in early sea urchin embryos. It suggests that several localized maternal factors should be involved in development regulation.

"The authors suggest that RT-qPCR would be useful for the identification of maternal mRNAs that are potentially enriched in the cortex. They indicate that the mRNA for the genes Panda (ref 14) and Coup-TF (refs 16, 17) are associated with subcortical areas of oocytes, eggs, and embryos. However, although in situ hybridization (ISH) imaging does suggest a gradient of Panda in oocytes, cortical association is not clear and even the Panda gradient itself is not obvious in eggs (Fig 5 in ref 14). In addition, the apparent cortical association of Coup-TF in the oocyte/egg appears to be present in only two of three sea urchin species tested (refs 16, 17). Given that these mRNAs have some literature precedence for cortical association it would make sense to use then as targets for the RT-qPCR experiment that the authors conduct in the present study. However, the authors indicate that they excluded these transcripts because they were unable to identify a Panda homologue in their species and that the G-C rich nature of Coup-TF made it difficult to amplify via RT-qPCR. Instead they choose to focus on the transcript of the gene Daglb-2 which they indicate was identified by transcriptomic analysis.

The authors need to provide additional details about the nature of how this transcriptomic analysis was performed and what were the results. For example, were cortices isolated in a similar manner? Did other transcripts show cortical enrichment?"

- Cortex preparation for transcriptomic analysis and subsequent RNA isolation were done as described in Materials and Methods. Now, we provide more detailed description of transcriptomic analysis. SRAs and assembled transcriptome were submitted to GenBank. We give only a part of our results concerning expression of reference genes and Dagbl-2 (Table 1). We found a number of cortex-associated transcripts and will prepare separate paper, which will include full transcriptomic data. In the manuscript, we present approach, which allow to find out cortical association of transcript by RT-qPCR. This approach we will use to verify cortical association of mRNAs discovered by transcriptomic analysis.

"Also, a biological role for the suggested cortical localization of the Daglb-2 protein is not provided. Do the authors have a hypothetical rationale why endocannabinoid signaling would be subject to polarized maternal distribution? They suggest that the transcript is localized in the cortex because of a need for local translation and integration into the membrane. Are the authors aware of precedence in the sea urchin for the localized cortical translation of membrane proteins? In general, the authors need to provide a better argument about why they ended up focusing on Daglb-2."

- In Discussion, we give explanation of biological role of Daglb-2 in plasma membrane of unfertilized eggs. We also cite data that point to the existence of local translation in sea urchin egg cortex.

"2) Given that this is a “proof-of-concept” study it is important that the authors provide the appropriate documentation of their methods. The description that they give in the Materials and Methods section of the cortex isolation process (page 5-6) is inadequate and incomplete."

- At first, we decided do not give description of cortex isolation procedure in details, but now we provide all necessary information about this method. Three years ago, Henson and co-authors published methodological article about cortex isolation with following manipulation for microscopy [31, Henson JH, Samasa B, Burg EC. High resolution imaging of the cortex isolated from sea urchin eggs and embryos. Methods Cell Biol. 2019;151:419-32], which we missed to cite. We think that this article is excellent resource to study this method.

"In addition, they need to provide low and high magnification phase contrast microscopy images of the cortical preparations that they generate for RNA isolation. These images would make it clear how intact the cortices were, to include the presence or absence of cortical granules."

- Sure, for RNA isolation isolated cortices should be intact. We always do visual observation of coverslips with isolated cortices to check remaining undisrupted eggs. If necessary, we observe cortex samples by phase contrast at low magnifications (Fig. 1A). Integrity of cortical layers we verify by using DIC and confocal imaging at higher magnifications (Fig. 1B, C). We do not it each experiment because we found that underdisrupted eggs and overdisrupted cortices are visible at low magnifications. In the revised version, we give DIC and confocal images to confirm a good quality of cortical samples by the presence of cortical granules and pattern of actin staining. Description of sample preparation for microscopy we give in Materials and Methods section and results of our observation we added to Results (Quality of isolated cortices and measurement of RNA amount).

"3) This study would be greatly improved by providing RNA FISH localization evidence of the cortical association of Daglb-2. This evidence would help validate the results of their RT-qPCR results. The senior author has previously published work involving confocal microscopy of the immunofluorescent localization of proteins in sea urchin egg cortices (ref 19) so the expertise and imaging instrumentation is available. In addition, it would be important to provide FISH and/or ISH images of Daglb-2 in whole oocytes, eggs and early embryos."

- Study of RNA localization by in situ hybridization will be direct evidence of Daglb-2 cortical localization. In present work, we primarily focus on approach for detection of cortical association by RT-qPCR. Before RT-qPCR cortical association of Daglb-2 was found by transcriptomic analysis. We think that combination of these two methods is satisfactory to claim about cortical localization of Daglb-2 mRNA. We are planning to get data about cortical localization of Daglb-2 and other transcripts by in situ hybridization, which will be submitted as other paper.

Minor Points:

"1) The paper needs to be carefully edited for proper English grammar, word choice and sentence structure. In its current form, it is sometimes difficult to decipher the meaning of what is written."

- To fix grammatical and spelling errors, we used “ManuscriptEdit” editing service.

"2) What type of statistical analysis was performed on the data in Fig 4? T tests? ANOVA?"

- We determined a statistical significance by t-test between pairs of columns in each type of sample (total RNA and mRNA). Now, we give statistically significant P values above the columns in Fig. 5.

"3) The fact that Daglb-2 transcripts were found to be cortex-enriched only in mRNA and not in total RNA analysis is puzzling. The authors should speculate on what might be causing this difference."

- In the first version of the manuscript, we omitted speculations about this issue. Now, we concern this point in Discussion.

Reviewer #2: In this manuscript, authors tried to establish a method for quantitate maternal genes in eggs of a sea urchin, Strongylocentrotus intermedius. Especially, authors tried to find the stable reference gene, which is essential for the qPCR analysis. Personally, I recognize this interesting, but I also have concerns.

"Obtaining RNA and the usage of template RNA for cDNA synthesis look not appropriate. For example, authors showed Ct in Fig1, in which authors treat the data as absolute quantity. However, authors obtained RNA from countless eggs and set RNA to 1 µg to synthesize cDNA. If the authors need the absolute quantity, the authors need to count the number of eggs, to use one/two step RT-qPCR kit, by which we do not have to change tubes, and same egg-number volume of cDNA should be applied into each qPCR tube."

- The data represented in Figure 2 (Fig. 1 in previous version) illustrate a dispersion of Ct values among all samples for each reference gene and require for further gene expression stability analysis. This is a first stage for evaluation of gene stability. Genes that reveal narrow range of Ct values should be ranked as most appropriate reference genes in subsequent analysis using different methods (GeNorm, BestKeeper etc).

"In another example, the protocol of cortex isolation is not stable (although the authors described it stable). This is because nobody can expect how much % of egg cortex are remained on the coverslip. In addition, RNA composition might be different between each pole of the egg since the protein localization is different between animal and vegetal poles."

- We believe that the proposed approach cannot be considered as a tool for absolute measurements for the reasons noticed by the reviewer. Peng and Wikramanayake published article [13, Peng CJ, & Wikramanayake AH. Differential regulation of disheveled in a novel vegetal cortical domain in sea urchin eggs and embryos: implications for the localized activation of canonical Wnt signaling. PloS one. 2013; 8: e80693], where they provided localization of Disheveled in isolated cortices (Fig. 2), this protein is not present on all cortexes. It means that parts of the cortices that does not bind to the glass are removed during their isolation. This also means that not all cortexes will contain transcripts that can be localized to the animal or vegetative poles. The percentage of remaining egg cortex may also vary. For this reason, the cortex isolation method would be inappropriate in terms of determining absolute expression levels and counting how many of the studied transcripts are present in whole eggs and their isolated cortexes. On the other hand, the remaining part of the cortical layer of the oocytes on the slides remains intact and contains localized transcripts. Based on this, we believe that this cortex extraction protocol is unstable in terms of absolute calculations of the number of transcripts. Nevertheless, our data show that cortex isolation can be successfully used to obtain RNA followed by comparison of the relative levels of transcripts in oocytes and their isolated cortexes, as demonstrated in the manuscript. We suggest that our approach can be one of the ways for the association of the studied transcripts with the cortical layer, hence their cortical localization. We believe that eggs can bind to coverslip with different sides equally, which means that RNA samples will contain both vegetal and animal transcripts, if any.

"I also have a question how much maternal mRNA is trapped by poly(A) selection. It is well known that poly-adenylation system starts at the fertilization, meaning that un-fertilized eggs contain a number of non-poly(A) RNA. So, it is better for authors to explain such RNA characteristics (if I were wrong, please ignore this point)."

- This is reasonable question and we explain below why poly(A) selection should be valid for unfertilized egg analysis.

This is the case that rate of cytoplasmic polyadenylation increases after fertilization of sea urchin embryos. According to measurements of Wilt (Wilt FH. The dynamics of maternal poly (A)-containing mRNA in fertilized sea urchin eggs. Cell. 1977; 11: 673-681), average length of poly(A) tails was 45 nucleotides for unfertilized eggs and 60 nucleotides for zygotes. Possibly, some maternal transcripts can be presented in both polyadenylated and deadenylated forms in unfertilized sea urchin eggs that may misrepresent quantitative measurements after poly(A) selection. Though, usual mechanism for mRNA storage and masking is partial deadenylation of poly(A) tails to 20-40 nucleotides, which is known for mice, worms and some other animals. Taking into account these data, we think that poly(A) selection is suitable for analysis of most transcripts of sea urchin eggs. A one of successful examples of poly(A) RNA selection from eggs for NGS means that most maternal RNAs are not fully deadenylated (Tu Q, Cameron RA, Worley KC, Gibbs RA, & Davidson, EH. Gene structure in the sea urchin Strongylocentrotus purpuratus based on transcriptome analysis. Genome Research. 2012; 22: 2079-2087) and their poly(A) tails can bind to oligo(d)T primers.

The next point is about percentage of purified poly(A) RNA. We accounted percentage of poly(A) RNA purified from egg and cortex total RNA samples in each experiment. In egg samples, poly(A) RNA was 1.3-1.7% from total RNA before purification that correspond to approximate rate of mRNA in eukaryotic cells (1-5%). In cortex samples, poly(A) RNA percent was always lower than in eggs (0.5-0.72%). Lower rate of mRNA in cortices may be one of reasons of different ratios of Daglb-2 levels between total RNA and mRNA. We included our calculations in the Results (Quality of isolated cortices and measurement of RNA amount). Discussion of possible reasons of the difference in RT-qPCR data obtained from total RNA and mRNA we give in Discussion.

"Therefore, if the authors intend to make “standard” methods for maternal RT-qPCR for eggs/cortex, initially it is necessary to set the protocol much more precisely in each step."

- We think that we should not give particular description in each step, because our approach consists of set of well-know methods. Detailed description of cortex isolation procedure is presented in resent methodological article [31, Henson JH, Samasa B, Burg EC. High resolution imaging of the cortex isolated from sea urchin eggs and embryos. Methods Cell Biol. 2019;151:419-32]. Indeed, we omitted several key points in “Materials and Methods” that complicate understanding presented data. Now, we give all necessary information sufficient for deep analysis and to reproduce our results. Also, as we noted above, we changed title to be more relevant to the manuscript content.

General comments

We added and re-ordered citations in the text and some ones have been excluded. New and re-ordered cited articles we marked by track changes.

Submitted filename: Response to Reviewers.docx

Click here for additional data file.

14 Apr 2022

An approach to quantitate maternal transcripts localized in sea urchin egg cortex using RT-qPCR with accurate normalization

PONE-D-21-36401R1

Dear Dr. Yakovlev,

We’re pleased to inform you that your manuscript has been judged scientifically suitable for publication and will be formally accepted for publication once it meets all outstanding technical requirements.

Within one week, you’ll receive an e-mail detailing the required amendments. When these have been addressed, you’ll receive a formal acceptance letter and your manuscript will be scheduled for publication.

An invoice for payment will follow shortly after the formal acceptance. To ensure an efficient process, please log into Editorial Manager at http://www.editorialmanager.com/pone/, click the 'Update My Information' link at the top of the page, and double check that your user information is up-to-date. If you have any billing related questions, please contact our Author Billing department directly at authorbilling@plos.org.

If your institution or institutions have a press office, please notify them about your upcoming paper to help maximize its impact. If they’ll be preparing press materials, please inform our press team as soon as possible -- no later than 48 hours after receiving the formal acceptance. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information, please contact onepress@plos.org.

Kind regards,

Wei Cui, Ph.D.

Academic Editor

PLOS ONE

Additional Editor Comments (optional):

Questions and concerns have been addressed.

Reviewers' comments: