Isolation and molecular characterization of extended spectrum beta lactamase producing Escherichia coli from chicken meat in Pakistan.

The goal of this study was to find E. coli, a prevalent pathogen that causes food-borne illnesses, in chicken samples (n = 500) collected from three districts in KhyberPukhtunkhwa: Mardan, Swabi, and Swat. The E. coli isolates were identified by Gram staining, API strips and Universal Stress Protein. A total of 412 samples tested positive for E. coli and were sensitive to MEM, TZP, and FOS as evidenced by disc diffusion method. The isolates were resistant to TE, NOR, and NA with statistically significant results (P≤0.05). The isolates showed the presence of different antibiotic resistance genes; blaOXA-1, blaCTX-M15, blaTEM-1, QnrS, TetA, AAC, AAD, Sul1 and Sul2. The results revealed mutations in blaOXA-1 gene (H81Q), blaTEM-1 (C108Y, T214A, K284E and P301S), QnrS (H95R) and Sul2 (E66A). The findings of this study may be helpful in better management of E. coli infections by physicians.

Introduction

Worldwide poultry meat is the consumers’ first choice due to its high reproductive ability, nutritional value and relatively low sales prices [1]. Currently poultry meat production and consumption are rapidly growing in almost every developing and developed countries around the globe [2]. People all over the world enjoy chicken meat products and is a better choice for consumers because they can be prepared fast and paired with a range of cuisines. Because of their lifestyles, modern consumers in both developed and developing countries rely on chicken meat products as their primary source of protein. The biggest advantage of chicken meat over red meat is its low-calorie content and low saturated fat content. Due to its nutritional profile, chicken can also be consumed by people who suffer from coronary/cardiac illnesses. Chicken meat has low collagen content, making it easier to digest [3]. In comparison to other varieties of meat, chicken meat is a rich source of vitamins such as niacin (vitamin B3), vitamin B6, and vitamin A, and it is also cost effective all over the world [4].

Many pathogenic microorganisms, such as fungus and bacteria, continue to pose a serious threat to humans. Among the bacterial pathogens, E. coli, is a common cause of many human diseases. Antibiotics are commonly used to treat infections caused by E. coli and can reduce morbidity and mortality rates. Unfortunately, as a result of self-medication and the overuse of antibiotics in the poultry business to increase the population, these harmful bacteria are becoming resistant to various first line antibiotics, rendering them ineffective [5]. The production of different enzymes, most importantly β-lactamases, which degrade the β-lactam ring of β-lactam antibiotics, is one of the mechanisms conferring antibiotic resistance.

In developed countries many regulations have been established to minimize the risk of antimicrobial resistance in poultry [6] however, in developing countries the problem is drastically increasing [7] resulting in major health problems. The current study was therefore aimed to determine the prevalence of E. coli in chicken meat, its antibiotic resistance pattern and its molecular basis, hence giving clues to the physicians for better management and treatment of food borne diseases caused by E. coli.

Materials and methods

Sample collection and transportation

A total of 500 chicken samples (spleen, liver and meat) were aseptically collected from different poultry shops and farms of district Mardan, Swabi and Swat in sterilized zipper bags, tightly sealed, labelled and transported for bacteriological analysis. A complete flow chart of the methodology has been presented in Fig 1. To isolate a single colony from the collected chicken samples, the technique of serial dilution was used. For each chicken sample, 9mL of peptone water was placed in three test tubes. 1mL chicken sample (spleen, liver, and meat) was added to the first test tube. 1mL peptone water was added to the second, from the first tube, followed by addition of 1mL from second to third test tube. The inoculum was distributed with a spreader from the third test tube onto sterilized Petri plates containing MacConkey agar for easily countable bacterial colonies in chicken samples [8].

Fig 1

Flowchart of the methods used in the study.

No ethical approval was deemed necessary for this study. Verbal permission was obtained from the shopkeeper as well as the slaughterhouse/farms manager before sampling.

Detection of Escherichia coli

The media (EMB agar) was added to 1000mL of distilled water, heated for 1 minute to completely dissolve the materials, and was then autoclaved for 15 minutes at 121°C. After autoclaving, the media was introduced to sterilized Petri plates and incubated at 37°C for 24 hours for sterility check [9]. The samples were streaked on sterile Eosin Methylene Blue (EMB) agar plates and incubated at 37°C for 24 hours. E. coli was detected as metallic sheen color colony on EMB agar [10].

Gram staining and biochemical identification of bacterial isolates

The E. coli isolates were identified as Gram-Negative Rods (GNR) by Gram staining. The biochemical identification of E. coli isolates was carried out by Analytical Profile Index (API 20E) kit. Pure bacterial culture suspension was inoculated in the wells of the strips, incubated at 37°C for 24 hours followed by identification using the codes provided with the API strips and API reading scale [11].

Extraction of DNA and molecular level identification

For molecular level identification of E. coli isolates and detection of antibiotic resistance genes, DNA was extracted by Vivantis Genome extraction kit. Specific primer for Universal Stress Protein (USP), was amplified by Polymerase Chain Reaction (PCR) for identification of the E. coli isolates [12]. On 1.5% agarose gel, the amplified PCR product stained with ethidium bromide were run and was visualized with the help of gel documentation system [13]. The positive control used in the current study was E. coli ATCC25922.

Antibiotic susceptibility pattern of bacterial isolates

The E. coli isolates were inoculated in nutrient broth and incubated for 24 hours at 37°C. 0.5 McFarland solution was used to standardize the broth cultures. A sterile spreader was used to spread 0.1mL of bacterial suspension on a sterile MHA plate, which was then allowed to dry for 10 minutes. The antibiotic discs were placed at an equal distance on the agar plates and incubated for 24 hours at 37°C. After incubation, the zone of inhibition (mm) for each antibiotic disc was measured (Table 1). As per Clinical and Laboratory Standard Institute (CLSI) 2019 standards, the results were interpreted as sensitive, resistant and intermediate [14].

Table 1

List of antibiotics used in the present study.

S. No	Antibacterial Agent	Sensitive (mm)	Intermediate (mm)	Resistant (mm)
1	Cefotaxime	≥ = 26	23–25	≤ = 22
2	Colistin	≥ = 2	---	≤ = 2
3	Amikacin	≥ = 17	15–16	≤ = 14
4	Cefepime	≥ = 25	19–24	≤ = 18
5	Meropenem	≥ = 23	20–22	≤ = 19
6	Amoxicillin + Clavulanic acid	≥ = 18	14–17	≤ = 13
7	Trimethoprim-Sulfamethoxazole	≥ = 16	11–15	≤ = 10
8	Fosfomycin	≥ = 16	13–15	≤ = 12
9	Norfloxacin	≥ = 17	13–16	≤ = 12
10	Gentamicin	≥ = 15	13–14	≤ = 12
11	Cefoperazone/Sulbactam	≤ 10	11–15	≥ 16
12	Ceftriaxone	≥ = 23	20–22	≤ = 19
13	Ciprofloxacin	≥ = 21	16–20	≤ = 15
14	Nalidixic Acid	≥ = 19	14–18	≤ = 13
15	Piperacillin/Tazobactam	≥ = 21	18–20	≤ = 17
16	Ceftazidime	≥ = 21	18–20	≤ = 17
17	Tetracycline	≥ = 15	12–14	≤ = 11

Determination of Minimum Inhibitory Concentrations

Minimum Inhibitory Concentrations (MICs) of the selected antibiotics (Table 2) were determined using the MICs test strips. On inoculated MHA agar plate, exponential gradient of antimicrobial agents test strips were placed and incubated at 37°C for 24hrs and MIC was measured [15].

Table 2

Determination of MICs using different E-test strips.

Antibiotics	Symbols	MIC Strips	Breakpoints
			S	I	R
Cefotaxime	CTX	E–CT	≤ 1	2	≥ 4
Co-Trimoxazole	SXT	E–TS	≤ 2/38	-	≥ 4/76
Meropenem	MEM	E–MP	≤ 1	2	≥ 4
Ciprofloxacin	CIP	E–CL	≤0.25	0.5	≥ 1
Amikacin	AK	E–AK	≤ 16	-	64
Gentamicin	CN	E–GM	≤ 4	8	≥ 16
Ceftazidime	CAZ	E–TZ	≤ 4	8	≥ 16

Key: S = Sensitive, I = Intermediate, R = Resistant

Phenotypic analysis of resistant pattern

For phenotypic determination of ESBL producing E. coli isolates, synergy test was performed using discs of CRO, AUG and TZP as per reported procedure while phenotypic determination of carbapenemase production was determined by Modified Hodge test [16].

Detection of antibiotic resistant genes

After phenotypic detection, the presence of antibiotic resistant genes (bla OXA-1, bla TEM-1, bla CTX-M15, AAD, AAC, Sul 1, Sul 2, QnrS and TET-A) in E. coli isolates was detected with the help of PCR using specific primers (Table 3) under optimized conditions [17]. The PCR products were run on 1.5% agarose gel along with 100bp DNA ladder followed by visualization in gel documentation system (Bio Rad (Universal Hood II) [18].

Table 3

Sequences of primers, along with optimized conditions, used in the current study [19].

Gene	Specific Primers	Product Size (bp)	Annealing Temperature (°C)	Cycles
bla TEM 1	F: TGCGGTATTATCCCGTGTTGR: TCGTCGTTTGGTATGGCTTC	297	55 for 30 sec	35
Qnr-S	F: ACGACATTCGTCAACTGCAAR: TAAATTGGCACCCTGTAGGC	550	55 for 30 sec	35
TET-A	F: GGTTCACTCGAACGACGTCAR: CTGTCCGACAAGTTGCATGA	577	58 for 30 sec	35
bla CTX-M 15	F: CGATGTGCAGTACCAGTAAR: TTAGTGACCAGAATCAGCGG	586	52 for 30 sec	35
bla OXA 1	F: ACACAATACATATCAACTTCGCR: AGTGTGTTTAGAATGGTGATC	814	57 for 30 sec	35
AAC	F: TTGCGATGCTCTATGAGTGGCTAR: CTCGAATGCCTGGCGTGTTT	482	58 for 30 sec	35
Sul 1	F: TTCGGCATTCTGAATCTCACR: ATGATCTAACCCTCGGTCTC	822	58 for 30 sec	35
Sul 2	F: CCTGTTCGTCCGACACAGAR: GAAGCGCAGCCGCAATTCAT	435	58 for 30 sec	35
AAD	F: GCAGCGCAATGACATTCTTGR: ATCCTCGGCGCGATTTTG	282	58 for 30 sec	35

DNA sequencing and mutational analysis

The amplified PCR products of antibiotic resistant genes, after purification through Purification Kit (Thermo Scientific™ GeneJET PCR Purification Kit), were sequenced at Rehman Medical Institute (RMI), Peshawar, Pakistan. After sequencing, the FASTA sequences of the selected genes were recovered from GenBank–National Center for Biotechnology Information (NCBI) database. Through Basic Local Alignment Search Tool (BLAST) and BioEdit Software the sequence of PCR products was compared with FASTA sequences of the selected genes to confirm its presence in E. coli isolates and its mutational analysis [20]. After sequencing of the antibiotic resistant genes, the data was further analyzed for non-synonymous mutations and by using I-mutant software the pathogenic effects of the identified mutations were predicted.

Statistical analysis

To determine the relationship between the predicted E. coli value and the observed (p ≤ 0.05), a chi-square analysis was performed using SPSS version 20. The number of samples (n) was set to 150 and the degree of freedom was set to n-1 for this purpose. One way analysis of variance (ANOVA) was used to compare the continuous values of antibiotics with E. coli and P≤ 0.05 values were regarded statistically significant.

Results

Isolation of bacterial isolates

Different bacterial isolates, from the collected chicken samples (spleen, meat and liver), in district Mardan, Swabi and Swat are mentioned in Fig 2A–2C.

Fig 2

A. Different bacterial isolates from district Mardan. B. Different bacterial isolates from district Swabi. C. Different bacterial isolates from district Swat.

Identification of E. coli isolates

As E. coli was the most common of all isolates, further analysis was focused on it. After identification by Gram staining (pink coloured rods in microscope) and API strips (as per API codes and reading scale), the Universal Stress Protein (USP), amplified by PCR, confirmed the E. coli isolates on molecular level (Fig 3).

Fig 3

Products of PCR for the detection of USP (884bp) gene on 1.5% EB-stained agarose gel amplified from E. coli isolates from broilers, where L 100 bp DNA ladder; +ve is positive control (E. coli ATCC 25922); lane 1–7: E. coli isolates.

Antibiotic sensitivity pattern of E. coli isolates

The results of antibiotic sensitivity pattern of E. coli isolates from different districts revealed resistance to TE, NOR and NA and sensitivity to MEM, TZP and FOS (Table 4).

Table 4

Percentage of antibiotic sensitivity pattern of E. coli isolates.

S.No	Abbreviations	Sensitive (%)			Resistant (%)			Intermediate (%)
		S	L	M	S	L	M	S	L	M
Mardan
1	MEM	32.7	40	31.6	58.6	53.3	61.6	8.6	8.6	6.6
2	CAZ	20.6	16.6	13.3	75.8	83.3	86.6	3.4	0	0
3	CTX	13.7	21.6	16.6	86.2	78.3	83.3	0	0	0
4	AK	0	6.6	3.3	100	93.3	93.3	0	0	3.3
5	SCF	6.8	3.3	10	93	96.6	90	0	0	0
6	NA	0	0	0	100	100	100	0	0	0
7	CT	0	0	0	100	100	100	0	0	0
8	TE	0	0	0	100	100	100	0	0	0
9	AMC	0	0	0	100	100	100	0	0	0
10	SXT	0	0	0	100	100	100	0	0	0
11	CIP	0	0	0	100	100	100	0	0	0
12	CRO	0	10	18.3	100	90	81.6	0	0	0
13	NOR	0	0	0	100	100	100	0	0	0
14	TZP	24.1	20	10	72.4	76.6	90	3.4	3.3	0
15	FOS	6.8	3.3	16.6	93.1	96.6	80	0	0	3.3
16	FEP	22.4	20	26.6	74	76.6	73.3	3.4	3.3	0
17	CN	0	0	0	100	100	100	0	0	0
Swabi
1	MEM	39	35.8	38.6	56.2	53.8	61.3	4.3	10.2	0
2	CAZ	28.2	5.1	13.6	67.3	94.8	86.3	4.3	0	4.5
3	CTX	15.2	15.3	11.3	84.7	84.6	88.6	0	0	0
4	AK	0	3.3	4.5	100	97.4	93.1	0	0	2.3
5	SCF	6.5	3.3	6.8	93.4	97.4	93.1	0	0	0
6	NA	0	0	0	100	100	100	0	0	0
7	CT	0	0	0	100	100	100	0	0	0
8	TE	0	0	0	100	100	100	0	0	0
9	AMC	0	0	0	100	100	100	0	0	0
10	SXT	0	0	0	100	100	100	0	0	0
11	CIP	0	0	0	100	100	100	0	0	0
12	CRO	0	5.1	20.4	100	94.8	79.5	0	0	0
13	NOR	0	0	0	100	100	100	0	0	0
14	TZP	23.9	12.8	6.8	71.7	82	93.1	4.3	5.1	0
15	FOS	4.3	2.5	13.6	95.6	97.4	81.8	0	0	4.5
16	FEP	19.5	7.6	20.4	80.4	87	79.5	0	5	0
17	CN	0	5.1	0	100	94.8	100	0	0	0
Swat
1	MEM	20.5	36.3	33.3	71.7	51.5	57.5	7.6	12.1	9
2	CAZ	12	21.2	12.1	87.8	78.7	87.8	0	0	0
3	CTX	12	15	18	89.7	71.7	81.8	0	0	0
4	AK	0	6	0	100	93.9	100	0	0	0
5	SCF	7.6	3	9	92.3	90.9	90.9	0	0	0
6	NA	0	0	0	100	100	100	0	0	0
7	CT	0	0	0	100	100	100	0	0	0
8	TE	0	0	0	100	100	100	0	0	0
9	AMC	0	0	0	100	100	100	0	0	0
10	SXT	0	0	0	100	100	100	0	0	0
11	CIP	0	0	0	100	100	100	0	0	0
12	CRO	0	12.1	21.2	100	87.8	78.7	0	0	0
13	NOR	0	0	0	100	100	100	0	0	0
14	TZP	30.7	12.1	6	69.2	69.2	93.9	0	6	0
15	FOS	12.1	3	15.1	89.7	96.9	78.7	0	0	6
16	FEP	17.9	12.1	27.2	79.4	81.8	72.7	2.5	6	0
17	CN	0	0	0	100	100	100	0	0	0

Minimum Inhibitory Concentration

The potency of an antibiotic depends on MIC values; the lower the MICs value the drug will be more powerful and vice versa. The MICs values of β-lactam drugs were high against ESBLs producing E. coli isolates showing their resistance but all the isolates were sensitive to MEM as indicted by low MIC value (Table 5).

Table 5

Minimum Inhibitory Concentration of different antibiotics against ESBL producing E. coli.

Antibiotics	MIC50 (μg/ml)	MIC90 (μg/ml)	MIC Range (μg/ml)
CTX	64	256	4–256
CAZ	128	256	16–256
MEM	0.19	0.75	0.25–1
CN	4	16	0.38–140
AK	32	256	0.25–256
CIP	16	256	0.38–256
SXT	24	256	1.0–256

In synergy test, the zone of inhibition of corner antibiotics (AUG and TZP) diffused into the center antibiotic (CRO) showing positive result for ESBL production (20-25mm from corner to center). For Carbapenemase production, the two antibiotics disc (MEM and IPM), after incubation, presented a leaf like flattening at the center showing positive results as shown in Figs 4 and 5.

Fig 4

Synergy test for ESBL producing E. coli.

Fig 5

Modified Hodge test for carbapenamase production.

Detection of antibiotic resistant genes by Polymerase Chain Reaction

The representative images of different antibiotic resistant genes along with their band sizes are depicted in (Fig 6A–6I) while Table 6 is showing the number of antibiotic resistant genes in E. coli isolates.

Fig 6

A.CTXM 15: 1; DNA Ladder, 2; positive control, 3–9; positive for CTXM-15 (bp = 586), B. TEM 1: 1; DNA Ladder, 2–9; positive for TEM 1 (bp = 297), C. OXA 1: 1; DNA Ladder, 2; positive control, 3–9 positive for OXA 1 (bp = 814), D.TET A: 1; DNA Ladder, 2; positive control, 3–9; positive isolates for TET A (bp = 577), E. QNRS: 1; DNA Ladder, 2–9; positive isolate for QNR S (bp = 550), F. AAC(6)-Ib-cr: 1; DNA Ladder, 2–9 positive isolate for AAC(6)-Ib-cr (bp = 482), G. SUL 1: 1; DNA Ladder, 2–9; positive isolate for SUL 1 (bp = 822), H. SUL 2: 1; DNA Ladder, 2–9 positive isolate for SUL 2 (bp = 435), I. aad A1: 1; DNA Ladder, 2–9 positive isolate for aad A1(bp = 282).

Table 6

No of antibiotic resistant genes in E. coli isolates.

Sample No	blaCTX-M15	blaTEM 1	blaOXA 1	TET A	QnrS	Sul 1	Sul 2	AAC	AAD
Mardan
2S	-	-	+	+	+	+	-	+	+
3L	+	+	-	+	+	-	-	+	+
4M	-	+	+	+	+	+	+	-	+
7S	-	-	+	+	+	-	-	+	-
11L	-	-	+	+	+	-	-	-	-
11M	+	+	-	+	+	+	+	-	+
15S	+	-	-	+	+	+	-	+	-
17L	+	-	+	+	-	-	+	+	+
18M	+	-	+	+	+	+	+	+	+
22S	+	-	+	+	+	+	-	-	+
24L	-	+	-	+	+	+	-	-	-
26M	-	+	-	+	+	-	-	-	-
29S	+	-	-	+	+	-	-	+	-
30L	+	+	-	+	+	-	+	+	+
34M	+	-	+	+	+	+	+	+	+
40S	+	-	+	+	+	+	+	+	+
42L	-	+	+	+	+	+	+	-	+
44M	-	+	-	+	+	-	-	+	+
50M	+	-	-	+	+	-	-	-	+
55L	+	-	+	+	+	-	+	-	+
Swabi
1M	+	-	-	+	+	+	+	+	-
4S	+	-	+	+	+	+	+	+	-
6L	+	+	-	+	+	-	+	-	+
9S	-	+	+	+	+	-	+	-	-
12M	+	-	-	+	+	-	+	+	-
14M	-	-	+	+	+	-	+	+	-
18S	-	+	+	+	+	-	-	+	+
19L	+	-	-	+	+	+	-	-	-
21M	-	+	-	+	+	-	-	+	+
26L	+	+	+	+	+	+	-	+	+
31L	-	+	+	+	+	+	-	-	+
35S	-	-	-	+	+	-	-	+	-
37L	-	+	+	+	+	+	+	+	-
41M	+	+	-	+	+	-	+	-	-
49M	-	+	+	+	+	-	+	+	+
Swat
3L	+	+	+	+	+	-	+	+	+
6S	+	+	+	+	+	-	+	-	+
7M	+	-	+	+	+	+	-	-	+
14S	-	+	-	+	+	-	-	+	+
15M	-	+	-	+	+	-	+	+	-
20S	-	-	-	+	+	+	-	+	-
24L	+	+	-	+	+	+	+	+	-
28M	+	-	-	+	+	-	-	+	-
30L	+	+	+	+	+	+	+	-	+
33M	+	+	+	+	+	+	+	-	+
37L	-	+	+	+	+	-	+	-	+
38S	-	-	-	+	+	+	-	+	-
42L	+	+	-	+	+	+	-	+	-
44S	+	+	-	+	+	+	+	+	-
50M	+	-	+	+	+	-	+	+	-

Sequencing and mutational analysis of antibiotic resistant genes

The results of non-synonymous mutations are presented in Tables 7 and 8.

Table 7

Non-synonymous mutations.

Codon position	Reference amino acid	Altered amino acid	Altered Amino acid Position
blaOXA-1 gene
243	H (CAT)	Q (CAA)	81
blaTEM-1 gene
323	C (TGC)	Y (TAC)	108
640	T (ACC)	A (GCC)	214
850	K (AAA)	E (GAA)	284
901	P (CCA)	S (TCA)	301
QnrS gene
284	H (CAC)	R (CGC)	95
Sul 2 gene
197	E (GAG)	A (GCG)	66

Table 8

I-Mutant software prediction result.

Wild type	New type	I-Mutant prediction effect	Reliability Index (RI)	pH	Temperature
blaOXA-1 gene
A	Q	Decrease	1	7	25
blaTEM -1 gene
A	Y	Increase	1	7	25
G	A	Decrease	6	7	25
A	E	Decrease	0	7	25
C	S	Increase	3	7	25
QnrS gene
G	R	Decrease	4	7	25
Sul 2 gene
C	A	Decrease	5	7	25

The Chi square test showed a significance level of association between type of bacteria in different districts and hence proved our null hypothesis where p≤ 0.05. One way ANOVA test presented a significant association of dependent to independent value.

Discussion

The important antimicrobials characterized for human and veterinary use are third-generation cephalosporins [21] and their use in veterinary has led to an increased prevalence of antibiotic resistance. The challenge of the 21st century is antibiotic resistance, is a major threat to human health [22] and the veterinarians are advised to use the antimicrobials as a risk management option to reduce the emergence and spreading of antibiotic resistance. A study revealed that resistance to the cephalosporins is due to the production of β-lactamase enzymes; a class of enzymes which inactivate β-lactam antibiotics [20]. The results of this study revealed that the chicken samples (meat, spleen, and liver) were contaminated with E. coli as 412 (82%) of 500 collected samples showed the growth of E. coli. In this study, E. coli showed 100% resistance to NA, TE, and NOR, but resistance to CRO, AK, CTX, SCF, FEP, CAZ, TZP, FOS, and MEM was variable. The resistance reported in our study is mainly because of the production of β-lactamase enzymes. According to a published study, the QnrS gene was predominantly identified in E. coli isolates from chickens, which is consistent with our findings [23]. According to Portugal’s National Central Drug Plan, the use of tetracycline, quinolones and Sulfonamide in veterinary medicine has resulted in the emergence of antibiotic resistance. In poultry, E. coli isolates showed high resistance to ampicillin (69.4%), trimethoprim (66.7%), Tetracycline (88.9%) and Sulfonamide (75.0%) [24]. Resistance to different antibiotics like ampicillin (98.9%) and TE (97.6%) was found in E. coli isolates from chickens in China due to the production of β-lactamases [25]. Resistance of E. coli to several antibiotics in poultry meat is gradually growing in many countries including Brazil, India, Canada, and China [26], which is consistent with the findings of this investigation. The high prevalence of ESBL genes in chicken meat is consistent with findings of other investigators. Doi et al. reported that 67% of retail meat samples in Seville, Spain, contained ESBL or ESBL-like resistance genes [27]. A survey of imported raw chicken in the United Kingdom reported ESBL genes in 10 of 27 samples, concluding that ESBL genes in meat pose a potential threat to humans [28]. For decades, scientists have recognized the dangers of high antimicrobial drug usage in food-producing animals and the emergence of drug resistance in zoonotic infections. Our group and others found that most samples of retail chicken meat contain transmissible drug resistance genes in bacterial species that are part of the normal human intestinal flora. This finding may have a profound effect on future treatment options for a wide range of infections with gram-negative bacteria. Globally, studies have documented that E. coli isolated from food-producing animals particularly chickens are usually resistant to β-lactam antimicrobial agents [29]. Our findings show a significant prevalence of ESBL-producing E. coli in chickens, suggesting that poultry farms and their meat products could be a major source of ESBL-producing E. coli. The ESBL producing E. coli cause a variety of infections in humans which are difficult to treat. Our study concluded that the E. coli isolates were resistant to many first line antibiotics due to the production of β-lactamases. One of the major limitations of the study was that risk factors for drug resistance was not properly addressed, due to inability to get enough information from people who brought chickens to market. We hereby recommend that the use of antimicrobials should be properly monitored by the government organizations to tackle the problem of antibiotic resistance.

(PDF)

Click here for additional data file.

Transfer Alert

This paper was transferred from another journal. As a result, its full editorial history (including decision letters, peer reviews and author responses) may not be present.

11 Mar 2022

A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). You should upload this letter as a separate file labeled 'Response to Reviewers'.

A marked-up copy of your manuscript that highlights changes made to the original version. You should upload this as a separate file labeled 'Revised Manuscript with Track Changes'.

An unmarked version of your revised paper without tracked changes. You should upload this as a separate file labeled 'Manuscript'.

If you would like to make changes to your financial disclosure, please include your updated statement in your cover letter. Guidelines for resubmitting your figure files are available below the reviewer comments at the end of this letter.

If applicable, we recommend that you deposit your laboratory protocols in protocols.io to enhance the reproducibility of your results. Protocols.io assigns your protocol its own identifier (DOI) so that it can be cited independently in the future. For instructions see: https://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocols. Additionally, PLOS ONE offers an option for publishing peer-reviewed Lab Protocol articles, which describe protocols hosted on protocols.io. Read more information on sharing protocols at https://plos.org/protocols?utm_medium=editorial-email&utm_source=authorletters&utm_campaign=protocols.

We look forward to receiving your revised manuscript.

Kind regards,

Yung-Fu Chang

Academic Editor

PLOS ONE

Journal Requirements:

When submitting your revision, we need you to address these additional requirements.

1. Please ensure that your manuscript meets PLOS ONE's style requirements, including those for file naming. The PLOS ONE style templates can be found at

https://journals.plos.org/plosone/s/file?id=wjVg/PLOSOne_formatting_sample_main_body.pdf and

https://journals.plos.org/plosone/s/file?id=ba62/PLOSOne_formatting_sample_title_authors_affiliations.pdf

2. We understand that you collected chicken samples from local shops and farms for this study. In your Methods section, please provide additional details regarding the source of the materials. Please provide the geographic coordinates and names of the purchase locations to ensure reproducibility of the analyses.

3. Thank you for stating the following in the Acknowledgments Section of your manuscript:

"The authors are very thankful to the Higher Education Commission, Pakistan for funding the study under grant No. 6678"

We note that you have provided funding information that is not currently declared in your Funding Statement. However, funding information should not appear in the Acknowledgments section or other areas of your manuscript. We will only publish funding information present in the Funding Statement section of the online submission form.

Please remove any funding-related text from the manuscript and let us know how you would like to update your Funding Statement. Currently, your Funding Statement reads as follows:

"The authors are very thankful to the Higher Education Commission, Pakistan for funding the study under grant No. 6678. The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript."

Please include your amended statements within your cover letter; we will change the online submission form on your behalf.

4. In your Data Availability statement, you have not specified where the minimal data set underlying the results described in your manuscript can be found. PLOS defines a study's minimal data set as the underlying data used to reach the conclusions drawn in the manuscript and any additional data required to replicate the reported study findings in their entirety. All PLOS journals require that the minimal data set be made fully available. For more information about our data policy, please see http://journals.plos.org/plosone/s/data-availability.

"Upon re-submitting your revised manuscript, please upload your study’s minimal underlying data set as either Supporting Information files or to a stable, public repository and include the relevant URLs, DOIs, or accession numbers within your revised cover letter. For a list of acceptable repositories, please see http://journals.plos.org/plosone/s/data-availability#loc-recommended-repositories. Any potentially identifying patient information must be fully anonymized.

Important: If there are ethical or legal restrictions to sharing your data publicly, please explain these restrictions in detail. Please see our guidelines for more information on what we consider unacceptable restrictions to publicly sharing data: http://journals.plos.org/plosone/s/data-availability#loc-unacceptable-data-access-restrictions. Note that it is not acceptable for the authors to be the sole named individuals responsible for ensuring data access.

We will update your Data Availability statement to reflect the information you provide in your cover letter.

5. PLOS ONE now requires that authors provide the original uncropped and unadjusted images underlying all blot or gel results reported in a submission’s figures or Supporting Information files. This policy and the journal’s other requirements for blot/gel reporting and figure preparation are described in detail at https://journals.plos.org/plosone/s/figures#loc-blot-and-gel-reporting-requirements and https://journals.plos.org/plosone/s/figures#loc-preparing-figures-from-image-files. When you submit your revised manuscript, please ensure that your figures adhere fully to these guidelines and provide the original underlying images for all blot or gel data reported in your submission. See the following link for instructions on providing the original image data: https://journals.plos.org/plosone/s/figures#loc-original-images-for-blots-and-gels.

In your cover letter, please note whether your blot/gel image data are in Supporting Information or posted at a public data repository, provide the repository URL if relevant, and provide specific details as to which raw blot/gel images, if any, are not available. Email us at plosone@plos.org if you have any questions.

[Note: HTML markup is below. Please do not edit.]

Reviewers' comments:

Reviewer's Responses to Questions

Comments to the Author

1. Is the manuscript technically sound, and do the data support the conclusions?

The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented.

Reviewer #1: Partly

**********

2. Has the statistical analysis been performed appropriately and rigorously?

Reviewer #1: Yes

**********

3. Have the authors made all data underlying the findings in their manuscript fully available?

The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified.

Reviewer #1: Yes

**********

4. Is the manuscript presented in an intelligible fashion and written in standard English?

PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here.

Reviewer #1: Yes

**********

5. Review Comments to the Author

Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters)

Reviewer #1: This study reports the isolation and molecular characterization of ESBL E.coli from chicken meat in Pakistan.

Major comments

1. It might be useful to have a quick revision by a native English speaker.

2. In general, symbols for genes should be italicized. Please correct this all through the manuscript.

3. The methodology for E. coli isolation, antimicrobial susceptibility testing and sequencing is not sufficiently documented to allow replication studies. The authors need to mention the quality control strains used in identification of E. coli.

4. Figures 1-3 should be presented as one figure eg Figure 1: A, B and C

5. Images for ESBL and carbapenamase production should be provided for clarity.

6. In discussing the results, the authors need to provide possible explanations for their study observation. The results should not be repeated in the discussion section rather the results should be interpreted in the light of other studies. It is important to mention the implications of the study findings

7. The limitations of the study should be mentioned too.

8. The discussion section should end with the study conclusions and possible recommendations.

Minor comments

1. Title: The authors should clearly state in the title that samples were collected in Pakistan

2. Lines 19-20: Please rephrase. This sentence is not clear.

3. Line 23: Delete “which is the molecular…”

4. Rephrase lines 25-26 as “The results of the current study may be helpful for physicians in the management of E. coli infections”.

5. Line 33: “feeding treatment” what does this mean? This is not clear. Please rephrase sentence.

6. Line 52: Change “major tools” to “mechanisms”.

7. Line 60: Please rephrase. This sentence is not clear.

8. Lines 70-71: Please revise sentence.

9. Lines 99 – 102: Merge these with Statistical analysis (lines 177 -182) under Methods section

10. Lines 109 – 110: Please rephrase as the sentence is not clear

11. Lines 141-142: Should it be “for identification of the pathogen” instead of “isolates”?

**********

6. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.

If you choose “no”, your identity will remain anonymous but your review may still be made public.

Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.

Reviewer #1: No

[NOTE: If reviewer comments were submitted as an attachment file, they will be attached to this email and accessible via the submission site. Please log into your account, locate the manuscript record, and check for the action link "View Attachments". If this link does not appear, there are no attachment files.]

While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com/. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Registration is free. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email PLOS at figures@plos.org. Please note that Supporting Information files do not need this step.

Submitted filename: Reviewer Report_AWORH.docx

Click here for additional data file.

15 Apr 2022

All the changes suggested by the worthy reviewer has been addressed and have been highlighted in the revised manuscript

Submitted filename: Response to Reviewer.docx

Click here for additional data file.

1 May 2022

11 May 2022

Response to reviewer has been attached as a separate file

Submitted filename: Response to Reviewer.docx

Click here for additional data file.

17 May 2022

Isolation and Molecular Characterization of Extended Spectrum Beta Lactamase Producing Escherichia coli from Chicken Meat in Pakistan

PONE-D-22-05385R2

Dear Dr. Khan,

We’re pleased to inform you that your manuscript has been judged scientifically suitable for publication and will be formally accepted for publication once it meets all outstanding technical requirements.

Within one week, you’ll receive an e-mail detailing the required amendments. When these have been addressed, you’ll receive a formal acceptance letter and your manuscript will be scheduled for publication.

An invoice for payment will follow shortly after the formal acceptance. To ensure an efficient process, please log into Editorial Manager at http://www.editorialmanager.com/pone/, click the 'Update My Information' link at the top of the page, and double check that your user information is up-to-date. If you have any billing related questions, please contact our Author Billing department directly at authorbilling@plos.org.

If your institution or institutions have a press office, please notify them about your upcoming paper to help maximize its impact. If they’ll be preparing press materials, please inform our press team as soon as possible -- no later than 48 hours after receiving the formal acceptance. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information, please contact onepress@plos.org.

Kind regards,

Yung-Fu Chang

Academic Editor

PLOS ONE

Additional Editor Comments (optional):

Reviewers' comments:

Reviewer's Responses to Questions

Comments to the Author

1. If the authors have adequately addressed your comments raised in a previous round of review and you feel that this manuscript is now acceptable for publication, you may indicate that here to bypass the “Comments to the Author” section, enter your conflict of interest statement in the “Confidential to Editor” section, and submit your "Accept" recommendation.

Reviewer #1: All comments have been addressed

**********

2. Is the manuscript technically sound, and do the data support the conclusions?

The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented.

Reviewer #1: Yes

**********

3. Has the statistical analysis been performed appropriately and rigorously?

Reviewer #1: Yes

**********

4. Have the authors made all data underlying the findings in their manuscript fully available?

The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified.

Reviewer #1: Yes

**********

5. Is the manuscript presented in an intelligible fashion and written in standard English?

PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here.

Reviewer #1: Yes

**********

6. Review Comments to the Author

Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters)

Reviewer #1: All the initial comments suggested by the reviewer have been addressed. The manuscript now reads well.

**********

7. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.

If you choose “no”, your identity will remain anonymous but your review may still be made public.

Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.

Reviewer #1: Yes: Dr Mabel Kamweli Aworh

20 May 2022

PONE-D-22-05385R2

Isolation and Molecular Characterization of Extended Spectrum Beta Lactamase Producing Escherichia coli from Chicken Meat in Pakistan

Dear Dr. Khan:

I'm pleased to inform you that your manuscript has been deemed suitable for publication in PLOS ONE. Congratulations! Your manuscript is now with our production department.

If your institution or institutions have a press office, please let them know about your upcoming paper now to help maximize its impact. If they'll be preparing press materials, please inform our press team within the next 48 hours. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information please contact onepress@plos.org.

If we can help with anything else, please email us at plosone@plos.org.

Thank you for submitting your work to PLOS ONE and supporting open access.

Kind regards,

PLOS ONE Editorial Office Staff

on behalf of

Dr. Yung-Fu Chang

Academic Editor

PLOS ONE