| Literature DB >> 35574489 |
Ao Li1, Yaqi Gu1, Xiuzhen Zhang1, Hairui Yu2, Dongwu Liu1,3, Qiuxiang Pang1.
Abstract
When fish are under oxidative stress, levels of reactive oxygen species (ROS) are chronically elevated, which play a crucial role in fish innate immunity. In the present study, the mechanism by which betaine regulates ROS production via Wnt10b/β-catenin signaling was investigated in zebrafish liver. Our results showed that betaine enrichment of diet at 0.1, 0.2 and 0.4 g/kg induced Wnt10b and β-catenin gene expression, but suppressed GSK-3β expression in zebrafish liver. In addition, the content of superoxide anion (O2 ·-), hydrogen peroxide (H2O2) and hydroxyl radical (·OH) was decreased by all of the experimental betaine treatments. However, betaine enrichment of diet at 0.1, 0.2 and 0.4 g/kg enhanced gene expression and activity of superoxide dismutase (SOD), glutathione peroxidase (GSH-PX) and catalase (CAT) in zebrafish liver. In addition, Wnt10b RNA was further interfered in zebrafish, and the results of Wnt10b RNAi indicated that Wnt10b plays a key role in regulating ROS production and antioxidant enzyme activity. In conclusion, betaine can inhibit ROS production in zebrafish liver through the Wnt10b/β-catenin signaling pathway.Entities:
Keywords: Wnt10b; betaine; reactive oxygen species; zebrafish; β-catenin
Year: 2022 PMID: 35574489 PMCID: PMC9096094 DOI: 10.3389/fphys.2022.877178
Source DB: PubMed Journal: Front Physiol ISSN: 1664-042X Impact factor: 4.755
Composition and proximate analysis of the experimental diets.
| Items | Betaine level (g/kg diet) | |||
|---|---|---|---|---|
| 0 | 0.1 | 0.2 | 0.4 | |
| Ingredients (g/kg diet) | ||||
| Casein | 420 | 420 | 420 | 420 |
| Gelatin | 105 | 105 | 105 | 105 |
| Dextrin | 190 | 190 | 190 | 190 |
| Lard oil | 83 | 83 | 83 | 83 |
| Linseed oil | 17 | 17 | 17 | 17 |
| Cellulose | 100 | 99.9 | 99.8 | 99.6 |
| Sodium carboxymethylcellulose | 20 | 20 | 20 | 20 |
| Vitamin premix | 10 | 10 | 10 | 10 |
| Mineral premix | 40 | 40 | 40 | 40 |
| Ca2(H2PO4)2 | 10 | 10 | 10 | 10 |
| Choline chloride | 5 | 5 | 5 | 5 |
| Betaine | 0 | 0.1 | 0.2 | 0.4 |
| Total | 1,000 | 1,000 | 1,000 | 1,000 |
| Proximate composition | ||||
| Moisture (g/kg diet) | 97.4 | 98.2 | 96.6 | 98.1 |
| Crude protein (g/kg diet) | 480.6 | 481.2 | 482.6 | 482.4 |
| Crude lipid (g/kg diet) | 103.4 | 102.9 | 104.5 | 103.5 |
| Crude ash (g/kg diet) | 61.2 | 63.2 | 63.8 | 63.2 |
Notes.
Vitamin premix contained (mg/g mixer) thiamin hydrochloride, 5 mg; riboflavin, 5 mg; calcium pantothenate, 10 mg; nicotic acid, 6.05 mg; L-ascorbyl-2-monophosphate-Mg, 3.95 mg; alpha-tocopherol acetate, 50 mg; pyridoxine hydrochloride, 4 mg; folic acid, 1.5 mg; inositol, 200 mg; menadione, 4 mg; retinyl acetate, 60 mg; biotin, 0.6 mg. All ingredients were diluted with alpha-cellulose to 1 g.
Mineral premix contained (g/kg diet) calcium biphosphate, 13.58 g; calcium lactate, 32.7 g; FeSO4·6H2O, 2.97 g; magnesium sulfate, 13.7 g; potassium phosphate dibasic, 23.98 g; sodium biphosphate, 8.72 g; sodium chloride, 4.35 g; AlCl3·6H2O, 0.015 g; KI, 0.015 g; CuCl2, 0.01 g; MnSO4·H2O, 0.08 g; CoCl2·6H2O, 0.1 g; ZnSO4·7H2O, 0.3 g.
PCR primers for Wnt10b RNA interference.
| PCR primers | Forward (5′-3′) | Reverse (5′-3′) |
|---|---|---|
| ORF | CAATGACATCCTCGGCCTGAAG | TCACTTGCACACATTAACCCACTC |
| dsRNA | GATCACTAATACGACTCACTATAGGGGAGACCAGCGCTGGAACTGCTC | GATCACTAATACGACTCACTATAGGGCCACTCTGTTATTACGAATCC |
Real-time quantitative PCR primers for genes of zebrafish.
| Target gene | Forward (5′-3′) | Reverse (5′-3′) | Size (bp) | GenBank |
|---|---|---|---|---|
| Wnt10b | TCCTGAAACAGGCTCGAAGT | GCTGCTCACTTGCACACATT | 112 | AY182171.1 |
| GSK-3β | TCTGCTCACCGTTTCCTTTC | CTCCGACCCACTTAACTCCA | 115 | NM_131381.1 |
| β-catenin | GGAGCTCACCAGCTCTCTGT | TAGCTTGGGTCGTCCTGTCT | 120 | NM_001001889.1 |
| CAT | CAAGGTCTGGTCCCATAAA | TGACTGGTAGTTGGAGGTAA | 227 | BC051626 |
| SOD | GTCCGCACTTCAACCCTCA | TCCTCATTGCCACCCTTCC | 217 | BC055516 |
| GSH-PX | AGATGTCATTCCTGCACACG | AAGGAGAAGCTTCCTCAGCC | 94 | AW232474 |
| β-actin | CCGTGACATCAAGGAGAAGC | TACCGCAAGATTCCATACCC | 194 | AF057040.1 |
FIGURE 1Effect of betaine on the mRNA expression of Wnt10b, GSK-3β, and β-catenin in the liver of zebrafish. (A) The mRNA expression of Wnt10b; (B) The mRNA expression of GSK-3β; (C) The mRNA expression of β-catenin. Values are expressed as means ± sem (n = 3). Statistically significant differences are denoted by different letters (p < 0.05).
FIGURE 2Effect of betaine on the mRNA expression of CAT, SOD, and GSH-PX in the liver of zebrafish. (A) The mRNA expression of CAT; (B) The mRNA expression of SOD; (C) The mRNA expression of GSH-PX. Values are expressed as means ± sem (n = 3). Statistically significant differences are denoted by different letters (p < 0.05).
FIGURE 3Effect of betaine on the level of ROS in the liver of zebrafish. (A) The level of O2 ·−; (B) The level of ·OH; (C) The level of H2O2. Values are expressed as means ± sem (n = 3). Statistically significant differences are denoted by different letters (p < 0.05).
FIGURE 4Effect of betaine on the activities of antioxidant enzymes in the liver of zebrafish. (A) The activity of CAT; (B) The activity of SOD; (C) The activity of GSH-PX. Values are expressed as means ± sem (n = 3). Statistically significant differences are denoted by different letters (p < 0.05).
Effect of Wnt10b RNA interference on the gene expression level in the liver of zebrafish.
| Genes | Control group (0.4 g/kg betaine) | RNAi group (Wnt10b RNAi and 0.4 g/kg betaine) |
|
|---|---|---|---|
| Wnt10b | 1.02 ± 0.23 | 0.42 ± 0.09 | <0.05 |
| GSK-3β | 1.01 ± 0.19 | 3.32 ± 0.82 | <0.05 |
| β-catenin | 1.02 ± 0.25 | 0.57 ± 0.06 | <0.05 |
| CAT | 1.03 ± 0.27 | 0.47 ± 0.05 | <0.05 |
| SOD | 1.00 ± 0.03 | 0.51 ± 0.11 | <0.05 |
| GSH-PX | 1.01 ± 0.13 | 0.48 ± 0.03 | <0.05 |
Values are expressed as means ± sem (n = 3). Statistically significant differences are denoted by p values.
Effect of Wnt10b RNA interference on the level of ROS and activities of antioxidant enzymes in the liver of zebrafish.
| ROS level and antioxidant enzyme activity | Control group (0.4 g/kg betaine) | RNAi group (Wnt10b RNAi and 0.4 g/kg betaine) |
|
|---|---|---|---|
| O2 ·− level (U/g protein) | 54.30 ± 3.73 | 64.63 ± 4.01 | <0.05 |
| ·OH level (U/g protein) | 132.50 ± 6.21 | 150.54 ± 4.94 | <0.05 |
| H2O2 level (mmol/g protein) | 3.48 ± 0.38 | 4.50 ± 0.15 | <0.05 |
| CAT activity (U/g protein) | 10.90 ± 0.40 | 9.03 ± 0.33 | <0.05 |
| SOD activity (U/g protein) | 6.85 ± 0.68 | 5.38 ± 0.39 | <0.05 |
| GSH-PX activity (U/g protein) | 12.30 ± 1.01 | 10.27 ± 0.57 | <0.05 |
Values are expressed as means ± sem (n = 3). Statistically significant differences are denoted by p values.
FIGURE 5The mechanism by which betaine regulates the production of ROS through Wnt10b/β-catenin signaling pathway in the zebrafish liver.