Literature DB >> 35536038

Prevalence, Antimicrobial Resistance, and Molecular Characterization of Campylobacter Isolated from Broilers and Broiler Meat Raised without Antibiotics.

Sabin Poudel1, Tianmin Li1,2, Saijuan Chen3,4, Xue Zhang5, Wen-Hsing Cheng5, Anuraj T Sukumaran1, Aaron S Kiess6, Li Zhang1.   

Abstract

Campylobacter is one of the main bacterial pathogens that cause campylobacteriosis in the United States. Poultry is considered a major reservoir for the transmission of Campylobacter to humans. This study aimed to determine the prevalence and molecular characteristics of Campylobacter in the no-antibiotics-ever (NAE) broilers. A total of 414 samples were collected, among which 160 retail chicken samples were purchased from grocery stores and 254 samples were collected from broiler farms located in Mississippi State. The overall prevalence of Campylobacter was 25.4%, and a significantly higher prevalence was observed in retail chicken than in the farm samples (36.3% versus 18.5%; P < 0.0001), respectively. The prevalence of Campylobacter was not different (P = 0.263) between conventional retail (40.0%) and NAE (31.4%) retail chicken. Campylobacter jejuni was the predominant species among the positive isolates, accounting for 78.1%. Among the 82 C. jejuni isolates, 52.4% of the isolates carried the gyrA gene followed by the tet(O) gene (14.6%), whereas toxin-producing genes cdtA, cdtB, and cdtC were carried by 43.9%, 46.3%, and 43.9%, respectively. However, none of these virulence genes were detected in C. jejuni isolated from litter samples. Among tested C. jejuni, 13.6% of the isolates were multidrug resistant. The highest resistance was observed against nalidixic acid (49.2%), followed by tetracycline (23.7%). Our study suggests that the prevalence of Campylobacter was higher in retail meat samples than in environmental samples obtained from farms, and there was no difference in Campylobacter prevalence among conventional and NAE retail chicken. IMPORTANCE The FDA antibiotic withdrawal policy has led to a shift in the production system, from conventional antibiotics fed birds to no antibiotics ever (NAE) raised birds. However, the impact of this shift to NAE on the prevalence and characteristics of Campylobacter has not been studied on the farm or in retail chicken meats. The objective of this study was to determine the current prevalence of Campylobacter and the distribution of their antimicrobial resistance and virulence genes in NAE-raised broilers. The findings of this study will help the industry to take necessary action to develop effective mitigation strategies for reducing Campylobacter contamination in NAE broilers.

Entities:  

Keywords:  Campylobacter; antibiotic resistance; food safety; no antibiotics ever; virulence gene

Mesh:

Substances:

Year:  2022        PMID: 35536038      PMCID: PMC9241809          DOI: 10.1128/spectrum.00251-22

Source DB:  PubMed          Journal:  Microbiol Spectr        ISSN: 2165-0497


INTRODUCTION

Infection with Campylobacter is one of the leading causes of bacterial gastroenteritis worldwide (1). The incidence rate of campylobacteriosis in the United States was 19.5 cases for every 100,000 people, and the annual estimated number of infections was 1.5 million cases (2). The economic impact caused by the disease outbreaks and hospitalizations in the United States was estimated to be $1.4 to 6.9 billion (3). Similarly, a total of 220,682 confirmed human cases of campylobacteriosis were reported by 28 European Union countries in 2019 (4). Acute gastroenteritis, abdominal cramps, vomiting, and diarrhea are the most common symptoms of Campylobacter infections (5). In addition, Campylobacter infections can be more invasive and lead to severe extragastrointestinal diseases like Guillain-Barré syndrome (6), reactive arthritis (7), and irritable bowel syndrome (8). Campylobacter commonly exists in the gastrointestinal tract of food animals, including swine, cattle, and especially poultry (chicken and turkey) (9, 10). Poultry provides optimal growth conditions for the bacteria, as the physiological temperature of the birds is 42°C and Campylobacter proliferates maximally at a 42°C temperature (11, 12). Therefore, the gastrointestinal tract of poultry harbors a much higher abundance of Campylobacter and acts as an ultimate host. Most Campylobacter spp. colonize and proliferate in the chicken gastrointestinal tract without any clinical symptoms (13), which allows this pathogen to easily contaminate the carcass during processing, which can ultimately lead to the transmission of Campylobacter to humans (14). Therefore, handling and consuming contaminated raw or undercooked chicken meat is considered the primary source of human Campylobacter infection (15). Moreover, epidemiological studies have shown that consumption of contaminated poultry products accounted for 56.5% of human Campylobacter infections (16). Supportive antimicrobial treatments are not generally required for a human Campylobacter infection; however, immunocompromised individuals, like patients with predisposing conditions, pregnant women, children, and the elderly, may require antibiotic therapy. During these instances, fluoroquinolones (i.e., ciprofloxacin), aminoglycoside, and macrolides (azithromycin, erythromycin) are the most prescribed drugs for human campylobacteriosis (5, 17). These antibiotics commonly used in humans are also frequently used in food animals, like poultry, in order to control bacterial infections on the farms to enhance the growth performance of the animals (18). Although debatable, extensive use of antimicrobials for growth promotion in food animals is considered one of the major contributing factors for increased antimicrobial resistance worldwide (19). A study has shown the close association between the antibiotics fed to animals and the development and spread of antimicrobial resistance (AMR) in humans (20). In order to prevent a further increase and the spread of AMR, the medically important antibiotics for humans have been prohibited from poultry diets or other farm animal diets (21–23) in the United States, and they have been banned in the European Union since 2006 (24). The Food and Drug Administration’s (FDA) antibiotic withdrawal policy has led to a shift in the poultry production system, from conventional antibiotics-fed birds to no-antibiotics-ever (NAE)-raised birds (25, 26). Broiler production under NAE systems has increased exponentially in recent years, and it accounted for almost 50% of total broiler production in the United States in 2020 (27). However, the impact of this shift to NAE on the prevalence and characteristics of Campylobacter has not been studied on the farm or in retail chicken meats. Therefore, it is essential to determine the current prevalence of Campylobacter and the distribution of its antimicrobial resistance and virulence genes in NAE-raised broilers to develop effective mitigation strategies. The objective of the present study was to investigate the prevalence of Campylobacter in conventional retail chicken, NAE retail chicken, and farm samples obtained from NAE broiler houses and to identify the antimicrobial resistance and virulence genes.

RESULTS

Prevalence of Campylobacter in retail chicken and broiler farm samples.

The overall prevalence of Campylobacter among 414 poultry samples was 25.4% (105/414). The retail chicken samples had a significantly higher prevalence of Campylobacter than farm samples (36.3% versus 18.5%; P < 0.0001) (Table 1). Although conventional retail chicken samples had a numerically higher prevalence (40.0%) than NAE-raised retail chicken samples (31.4%), the difference was not significant (P = 0.263). Prevalence of Campylobacter in litter, feces, and cloacal swab samples was 13.6%, 21.6%, and 22.1%, respectively (P = 0.250) (Table 1). Prevalence of Campylobacter in conventional retail carcass and giblet was 44%, and prevalence in NAE retail carcass and giblet was 57.1% and 45.7%, respectively, whereas no Campylobacter was detected in drumsticks samples obtained from both conventional and NAE retail chicken samples. However, there was no significant difference in the prevalence of Campylobacter among the carcass and giblet samples obtained from both NAE and conventionally raised broilers (Table 2).
TABLE 1

Prevalence of Campylobacter species isolates from chicken samples obtained from broilers raised in conventional or NAE system and farm samples obtained from NAE houses

Sample sourceSample no.Positive Campylobacter isolates (n)Prevalenceb (%)
Retail
 NAE702231.4
 Con903640.0
P0.263
Farm
 Litter1031413.6
 Feces741621.6
 Cloacal swab771722.1
P0.250
Total
 Retail1605836.3 A
 Farm2544718.5 B
P<0.0001
 Total41410525.4

NAE, no-antibiotics-ever-raised chicken. Con, conventionally raised chicken.

Data were analyzed using Chi-square test. Means in cells not sharing a common letter were significantly different (P < 0.05).

TABLE 2

Recovery of Campylobacter isolates from chicken meat samples obtained from broilers raised in conventional or NAE systems

Sample sourceNo. of samplesNo. of positive isolatesPrevalenceb (%)
NAE
 Drumstick2000 B
 Carcass251144.0 A
 Giblet251144.0 A
P0.0016
Con
 Drumstick2000 B
 Carcass352057.1 A
 Giblet351645.7 A
P0.0001

NAE, no-antibiotics-ever-raised chicken. Con, conventionally raised chicken.

Data were analyzed using Chi-square test. Means not sharing a common letter were significantly different (P < 0.05).

Prevalence of Campylobacter species isolates from chicken samples obtained from broilers raised in conventional or NAE system and farm samples obtained from NAE houses NAE, no-antibiotics-ever-raised chicken. Con, conventionally raised chicken. Data were analyzed using Chi-square test. Means in cells not sharing a common letter were significantly different (P < 0.05). Recovery of Campylobacter isolates from chicken meat samples obtained from broilers raised in conventional or NAE systems NAE, no-antibiotics-ever-raised chicken. Con, conventionally raised chicken. Data were analyzed using Chi-square test. Means not sharing a common letter were significantly different (P < 0.05).

Identification of Campylobacter species.

A total of 105 Campylobacter isolates from conventional chicken samples (36 isolates), NAE chicken samples (22 isolates), and farm samples (47 isolates) (Table 3) were tested. C. jejuni was the predominant species in all three types of samples collected: 22 (61.1%) isolates from conventional chicken samples, 20 (90.9%) isolates from NAE chicken samples, 40 (85.1%) isolates from farm samples, and 82 (78.1%) isolates in total. A total of 7 (6.7%) isolates were Campylobacter lari, among which 4 (11.1%) were isolated from conventional chicken samples, none were isolated from NAE chicken samples, and 3 (13.6%) were isolated from farm samples. Only 2 (1.9%) isolates were Campylobacter volucris, and 2 (5.6%) were isolated from conventional chicken samples, whereas C. volucris was absent in both NAE chicken samples and farm samples. Other species accounted for 14 (13.3%) isolates in total (Table 3).
TABLE 3

Number and percentage of different species of Campylobacter isolated from chicken meat samples obtained from broilers raised in conventional or NAE systems and farm samples obtained from NAE houses

Campylobacter spp.No. of positive isolates (%) in:
Retail conventional samples (n = 36)Retail NAE samples (n = 22)Farm samples (n = 47)Total incidence (n = 105)
C. jejuni 22 (61.1)20 (90.9)40 (85.1)82 (78.1)
C. lari 4 (11.1)0 (0.0)3 (6.4)7 (6.7)
C. volucris 2 (5.6)0 (0.0)0 (0.0)2 (1.9)
Otherb8 (22.2)2 (9.1)4 (8.5)14 (13.3)

NAE, no-antibiotics-ever-raised chicken.

Campylobacter strains unidentified while performing the NCBI BLAST.

Number and percentage of different species of Campylobacter isolated from chicken meat samples obtained from broilers raised in conventional or NAE systems and farm samples obtained from NAE houses NAE, no-antibiotics-ever-raised chicken. Campylobacter strains unidentified while performing the NCBI BLAST.

Detection of virulence genes.

The Campylobacter isolated in this study were tested for the presence of 13 different virulence genes (cadF, jlpA, pebA, porA, pldA, ciaB, cdtA, cdtB, cdtC, flaAB, flgB, and flhB). The prevalence of each gene in tested Campylobacter isolates is summarized in Table 4. The type IV secretion system virulence factor virB9 was absent in all 105 of the Campylobacter isolates. Among the C. jejuni isolates, 43 (52.4%) isolates tested positive for flgB and pldA genes. Cytolethal distending toxin gene cdtB and Campylobacter adherence factor gene cadF were tested positive for in 38 (46.3%) C. jejuni isolates. Flagellar motility genes flaAB and flhB were possessed by 36 (43.9%) C. jejuni isolates. Five of 7 (71.4%) C. lari isolates tested positive for cadF, pldA, cdtA, cdtB, cdtC, flgB, and flaAB genes, whereas none of them possessed the virB9 gene. Although only two C. volucris isolates were isolated in this study, both isolates tested positive for two virulence genes, pldA, and flaAB (Table 4). Interestingly, the C. jejuni isolates obtained from litter did not possess any of the tested 13 virulence genes (Table 5).
TABLE 4

Number and percentage of virulence genes present in Campylobacter isolated from conventional and NAE chicken meat samples and NAE farm samples

Virulence genesNo. of positive isolates (%) of:
C. jejuni (n = 82)C. lari (n = 7)C. volucris (n = 2)Otherb (n = 14)Total incidence (n = 105)
cadF 38 (46.3)5 (71.4)0 (0.0)7 (50.0)50 (47.6)
jlpA 36 (43.9)4 (57.1)0 (0.0)8 (57.1)48 (45.7)
pebA 24 (29.3)3 (42.9)0 (0.0)5 (35.7)32 (30.5)
porA 24 (29.3)4 (57.1)0 (0.0)7 (50.0)36 (34.2)
pldA 43 (52.4)5 (71.4)2 (100)11 (78.6)61(58.1)
ciaB 33 (40.2)6 (85.7)0 (0.0)8 (57.1)47 (44.8)
cdtA 36 (43.9)5 (71.4)0 (0.0)8 (57.1)49 (46.6)
cdtB 38 (46.3)5 (71.4)0 (0.0)8 (57.1)51 (48.6)
cdtC 36 (43.9)5 (71.4)0 (0.0)8 (57.1)49 (46.6)
flaAB 36 (43.9)5 (71.4)2 (100)9 (64.3)52 (49.5)
flgB 43 (52.4)5 (71.4)0 (0.0)11 (78.6)61 (58.1)
flhB 36 (43.9)4 (57.1)0 (0.0)8 (57.1)48 (45.7)
virB9 0 (0.0)0 (0.0)0 (0.0)0 (0.0)0 (0.0)

NAE, no-antibiotics-ever-raised chicken.

Campylobacter strains unidentified while performing the NCBI BLAST.

TABLE 5

Number and percentage of virulence genes present in C. jejuni isolated from conventional and NAE chicken meat samples and NAE farm samples

Virulence geneNo. of positive isolates (%) in:
Conb meat (n = 22)NAE meat (n = 20)Cloaca swab (n = 12)Feces (n = 15)Litter (n = 13)
cadF 16 (72.7)16 (80.0)2 (16.7)4 (26.7)0 (0.0)
jlpA 15 (68.2)15 (75.0)2 (16.7)4 (26.7)0 (0.0)
pebA 9 (40.9)12 (60.0)2 (16.7)1 (6.7)0 (0.0)
porA 10 (45.5)11 (55.0)2 (16.7)1 (6.7)0 (0.0)
pldA 21 (95.5)17 (85.0)2 (16.7)3 (20.0)0 (0.0)
ciaB 16 (72.7)11 (55.0)2 (16.7)4 (26.7)0 (0.0)
cdtA 16 (72.7)14 (70.0)2 (16.7)4 (26.7)0 (0.0)
cdtB 18 (81.8)14 (70.0)2 (16.7)4 (26.7)0 (0.0)
cdtC 16 (72.7)14 (70.0)2 (16.7)4 (26.7)0 (0.0)
flaAB 16 (72.7)16 (80.0)2 (16.7)2 (13.3)0 (0.0)
flgB 21 (95.5)17 (85.0)2 (16.7)3 (20.0)0 (0.0)
flhB 15 (68.2)15 (75.0)2 (16.7)4 (26.7)0 (0.0)
virB9 0 (0.0)0 (0.0)0 (0.0)0 (0.0)0 (0.0)

NAE, no-antibiotics-ever-raised chicken.

Con, conventionally raised chicken.

Number and percentage of virulence genes present in Campylobacter isolated from conventional and NAE chicken meat samples and NAE farm samples NAE, no-antibiotics-ever-raised chicken. Campylobacter strains unidentified while performing the NCBI BLAST. Number and percentage of virulence genes present in C. jejuni isolated from conventional and NAE chicken meat samples and NAE farm samples NAE, no-antibiotics-ever-raised chicken. Con, conventionally raised chicken.

Detection of ARGs.

The presence of seven antibiotics resistance genes [ARGs; aph(3′)-IIIa, aph(2′′)-Ig, blaOXA-61, blaOXA-184, tet(O), gyrA, and ermB] were evaluated in this study; the results are shown in Tables 6 and 7. Two resistance genes, aph(2′′)-Ig and ermB, were not present in any of the Campylobacter isolates. The gyrA gene, which confers fluoroquinolones resistance, was the most prevalent resistance gene and was detected in 43 (52.43%) C. jejuni isolates, 7 (100%) C. lari isolates, and 2 (100%) C. volucris isolates. The tetracycline resistance gene tet(O) was the second most prevalent resistance gene detected and was present in 12 (14.6%) C. jejuni isolates, and a total of 17 (16.2%) isolates possessed tet(O) gene out of 105 total Campylobacter isolates. The gene aph(3′)-IIIa was present in 9 (11.0%) C. jejuni isolates and absent in C. lari and C. volucris. The β-lactamase resistance gene blaOXA-184 was found in 3 (2.9%) C. jejuni isolates and was absent in C. lari and C. volucris. Another β-lactamase resistance gene, blaOXA-61, was found in all three Campylobacter spp., 7 (8.5%) C. jejuni isolates, 1 (14.2%) C. lari isolate, 1 (50%) C. volucris isolate, and 14 (13.3%) of all Campylobacter isolates (Table 6). Among the C. jejuni isolates, gyrA resistance was observed to be higher in isolates obtained from NAE chicken samples than in those from conventional chicken samples (95.0% versus 81.8%); the lowest gyrA resistance was observed in the cloacal swab, 8.3% (Table 7).
TABLE 6

Number and percentage of antibiotic resistance genes (ARGs) of Campylobacter species isolated from chicken meat samples obtained from broiler raised in conventional or NAE system and farm samples obtained from NAE house

Antibiotic resistance genesExpected resistanceNo. of positive isolates (%) of:
C. jejuni (n = 82)C. lari (n = 7)C. volucris (n = 2)Otherb (n = 14)Total (n = 105)
aph(3′)-IIIa Aminoglycoside9 (11.0)0 (0.0)0 (0.0)2 (14.2)11 (10.5)
aph(2′′)-Ig Aminoglycoside0 (0.0)0 (0.0)0 (0.0)0 (0.0)0 (0.0)
bla OXA-184 β-Lactamases3 (3.7)0 (0.0)0 (0.0)0 (0.0)3 (2.8)
bla OXA-61 β-Lactamases7 (8.5)1 (14.2)1 (50.0)5 (35.7)14 (13.3)
tet(O)Tetracycline12 (14.6)0 (0.0)0 (0.0)5 (35.7)17 (16.2)
gyrA Fluoroquinolones43 (52.4)7 (100)2 (100)10 (71.4)62 (59.0)
ermB Erythromycin0 (0.0)0 (0.0)0 (0.0)0 (0.0)0 (0.0)

NAE, no-antibiotics-ever-raised chicken.

Campylobacter strains unidentified while performing the NCBI BLAST.

TABLE 7

Number and percentage of antibiotics resistance genes (ARGs) of C. jejuni isolates from chicken meat samples obtained from broilers raised in conventional or NAE systems and farm samples obtained from NAE houses

Antibiotic resistance genesExpected resistanceNo. of positive isolates (%) in:
Conb meat (n = 22)NAE meat (n = 20)Cloacal swab (n = 12)Feces (n = 15)Litter (n = 13)
aph(3′)-IIIa Aminoglycoside9 (40.9)0 (0.0)0 (0.0)0 (0.0)0 (0.0)
aph(2′′)-Ig Aminoglycoside0 (0.0)0 (0.0)0 (0.0)0 (0.0)0 (0.0)
bla OXA-184 β-Lactamases1 (4.5)2 (10.0)0 (0.0)0 (0.0)0 (0.0)
bla OXA-61 β-Lactamases1 (4.5)6 (30.0)0 (0.0)0 (0.0)0 (0.0)
tet(O)Tetracycline6 (27.2)6 (30.0)0 (0.0)0 (0.0)0 (0.0)
gyrA Fluoroquinolones18 (81.8)19 (95.0)1 (8.3)3 (20.0)2 (15.3)
ermB Erythromycin0 (0.0)0 (0.0)0 (0.0)0 (0.0)0 (0.0)

NAE, no-antibiotics-ever raised chicken.

Con, conventionally raised chicken.

Number and percentage of antibiotic resistance genes (ARGs) of Campylobacter species isolated from chicken meat samples obtained from broiler raised in conventional or NAE system and farm samples obtained from NAE house NAE, no-antibiotics-ever-raised chicken. Campylobacter strains unidentified while performing the NCBI BLAST. Number and percentage of antibiotics resistance genes (ARGs) of C. jejuni isolates from chicken meat samples obtained from broilers raised in conventional or NAE systems and farm samples obtained from NAE houses NAE, no-antibiotics-ever raised chicken. Con, conventionally raised chicken.

Phenotypic antimicrobial susceptibility testing.

Isolates of C. jejuni (n = 59), C. lari (n = 7), and C. volucris (n = 2) were tested for phenotypic antimicrobial resistance, and the results are shown in Tables 8 and 9. Among them, 9 (13.6%) C. jejuni isolates and 2 (28.6%) C. lari isolates were multidrug-resistant (MDR) strains. Overall, 57.6%, 71.4%, and 100% of C. jejuni, C. lari, and C. volucris isolates were resistant to at least one tested antibiotic. The results from C. jejuni showed that the highest resistance was observed for nalidixic acid (49.2%), followed by tetracycline (23.7%), clindamycin (16.9%), erythromycin (16.9%), and ciprofloxacin (15.3%), and the lowest resistance was observed in gentamicin (6.8%; Table 8). The results from C. lari showed that the highest resistance was observed in nalidixic acid (71.4%), followed by ciprofloxacin (57.1%) and tetracycline (57.1%), and the lowest resistance was observed in erythromycin, azithromycin, and gentamicin (14.3%), respectively. Of two C. volucris isolates, one was resistant to ciprofloxacin and tetracycline (Table 8). Among the C. jejuni isolates from retail chicken samples, resistance was observed to be higher in conventional samples than in NAE samples (nalidixic acid, 47.6% versus 15.0%; tetracycline, 23.8% versus 10.0%; ciprofloxacin, 9.5% versus 0%), whereas azithromycin (4.8% versus 10.0%), clindamycin (9.5% versus 10.0%), and erythromycin (9.5% versus 10.0%) had higher resistance in NAE samples than in conventional chicken samples (Table 9). Among the C. jejuni isolates from farm samples, 100% of the cloacal swab and feces isolates were resistant to nalidixic acid, and 66.7% of the litter isolates were resistant to nalidixic acid (Table 9).
TABLE 8

Number and percentage of isolates with phenotypic antibiotics resistance (AST) of Campylobacter spp. isolated from chicken meat samples obtained from broilers raised in conventional or NAE systems and farm samples obtained from NAE houses

AntibioticsNo. of positive isolates (%) of:
C. jejuni (n = 59)
C. lari (n = 7)
C. volucris (n = 2)
Other (n = 11)
Total (n = 79)
RbIcSdRbIcSdRbIcSdRbIcSdRbIcSd
Azithromycin8(11.9)1(1.7)50(84.7)1(14.3)0(0.0)6(85.7)0(0.0)0(0.0)2(100)2(18.2)0(0.0)9(81.8)11(13.9)1(1.3)67(84.8)
Ciprofloxacin9(15.3)9(15.3)41(69.5)4(57.1)0(0.0)3(42.9)1(50.0)1(50.0)0(0.0)5(45.5)0(0.0)6(54.5)19(24.1)10(13.0)50(63.3)
Clindamycin10(16.9)10(16.9)39(66.1)3(42.9)2(28.6)2(28.6)0(0.0)1(50.0)1(50.0)3(27.3)2(18.2)6(54.5)16(20.3)15(19.0)48(60.8)
Erythromycin10(16.9)2(3.4)47(79.7)1(14.3)1(14.3)5(71.4)0(0.0)1(50.0)1(50.0)2(18.2)1(9.1)8(72.7)13(16.5)5(6.3)61(77.2)
Gentamicin4(6.8)1(1.7)54(91.5)1(14.3)0(0.0)6(85.7)0(0.0)0(0.0)2(100)1(9.1)0(0.0)10(90.9)6(7.6)1(1.3)72(91.1)
Nalidixic acid29(49.2)0(0.0)30(50.8)5(71.4)0(0.0)2(28.6)0(0.0)0(0.0)2(100)8(72.7)0(0.0)3(27.3)42(53.2)0(0.0)37(46.8)
Tetracycline14(23.7)8(13.6)37(62.7)4(57.1)0(0.0)3(42.9)1(50.0)0(0.0)1(50.0)4(36.4)1(9.1)6(54.5)23(29.1)9(11.4)47(59.5)

The cutoff values for the demarcation of resistance, intermediate, and susceptibility are listed in Table 12.

R, resistance.

I, intermediate.

S, susceptibility.

TABLE 9

Number and percentage of phenotypic antibiotics resistance (AST) of C. jejuni isolated from chicken meat samples obtained from broilers raised in conventional or NAE systems and farm samples obtained from NAE houses

AntibioticsNo. of positive isolates (%) in:
Conb meat (n = 21)NAE meat (n = 20)Cloacal swab (n = 4)Feces (n = 8)Litter (n = 6)
Azithromycin1 (4.8)2 (10.0)0 (0.0)3 (37.5)1 (16.7)
Ciprofloxacin2 (9.5)0 (0.0)2 (50.0)3 (37.5)2 (33.3)
Clindamycin2 (9.5)2 (10.0)0 (0.0)3 (37.5)2 (33.3)
Erythromycin2 (9.5)2 (10.0)0 (0.0)3 (37.5)2 (33.3)
Gentamicin1 (4.8)0 (0.0)0 (0.0)2 (25.0)1 (16.7)
Nalidixic acid10 (47.6)3 (15.0)4 (100)8 (100)4 (66.7)
Tetracycline5 (23.8)2 (10.0)2 (50.0)2 (25.0)3 (50.0)

NAE, no-antibiotics-ever-raised chicken.

Con, conventionally raised chicken.

Number and percentage of isolates with phenotypic antibiotics resistance (AST) of Campylobacter spp. isolated from chicken meat samples obtained from broilers raised in conventional or NAE systems and farm samples obtained from NAE houses The cutoff values for the demarcation of resistance, intermediate, and susceptibility are listed in Table 12.
TABLE 12

Cutoff values used to determine the antibiotic resistance of Campylobacter along with the information about the concentration of the disc used

Antibiotics usedDisc contentCutoff value of interpretive criteria group:
Reference source
ResistanceIntermediateSusceptible
Azithromycin (AZI)15 μg≤1213–15≥16 56
Ciprofloxacin (CIP)5 μg≤2021–23≥24 56
Clindamycin (CLI)2 μg≤1415–20≥21 57
Erythromycin (ERY)15 μg≤1213–15≥16 56
Gentamicin (GEN)10 μg≤1213–14≥15 50
Nalidixic acid (NAL)30 μg≤19≥20 50
Tetracycline (TET)30 μg≤2223–25≥26 56
R, resistance. I, intermediate. S, susceptibility. Number and percentage of phenotypic antibiotics resistance (AST) of C. jejuni isolated from chicken meat samples obtained from broilers raised in conventional or NAE systems and farm samples obtained from NAE houses NAE, no-antibiotics-ever-raised chicken. Con, conventionally raised chicken.

DISCUSSION

This study evaluates the prevalence, virulence, ARGs, and antimicrobial susceptibility testing (AST) of Campylobacter isolates from retail NAE and conventional chicken samples and NAE broiler farm samples. The results indicated that the prevalence of Campylobacter varied in different meat samples and the commercial farm samples. Irrespective of NAE-raised or conventionally raised broiler, 36.3% of retail chicken samples tested positive for Campylobacter. The result from this study was a number of positive isolates slightly higher than that obtained in Georgia (30%) (28). Although Campylobacter was frequently recovered from retail chicken carcass and giblet samples, no Campylobacter contamination was detected in tested drumstick samples. The variation in the results from different sample types might be due to the different sample handling, sanitation, postchill decontamination, and packaging methods during processing. In contrast to our results, Kudirkienė et al. found that 45.5% of drumsticks were contaminated with Campylobacter (29). Finally, no significant difference in the Campylobacter incidence was observed among the NAE and conventional chicken samples in this study. This result indicates that removal of the antibiotics diet did not increase the prevalence of Campylobacter in poultry meat, which was opposite to the previous prediction (30). Cox (30) had predicted that the removal of the antibiotic (virginiamycin) from animal diets would increase the prevalence in poultry meat and ultimately lead to an increase of human infection by 40,000 annually in the United States. The fecal and cloacal samples obtained from the poultry houses were considered the representative indicator of the farm environment (31, 32). In farm samples obtained from the NAE-raised broiler, the overall incidence of Campylobacter was 18.5%. This Campylobacter incidence was similar to previously predicted prevalence by a meta-analysis in the conventional environment samples, 15.8% (33). This result indicates that even though there was a shift in the broiler rearing system, the prevalence of Campylobacter had not altered between the conventional and NAE rearing systems. It is noteworthy that the prevalence of Campylobacter in the meat product samples was higher than that in farm samples. It indicates the possibility of cross-contamination during the processing and distribution of retail meat. This finding is also consistent with the study conducted by Rivoal et al., who reported that the large amount of Campylobacter distribution in the poultry product might be due to cross-contamination during processing (34). Among 25 Campylobacter spp., C. jejuni is the most prevalent species causing human infections, followed by C. coli (35). In this study, C. jejuni was the predominantly isolated species, which accounted for 78.1% of total Campylobacter isolates. Similar to previous studies, we have demonstrated identical isolation rates of C. jejuni from poultry samples ranging from 68.7% to 91% (10, 36, 37). However, C. coli was the second predominant species in broiler flocks (10, 36) and the most prevalent species in turkey flocks (38). However, in our study, C. coli was not detected from either broiler farm or meat samples. The presence of the virulence genes involved in adhesion (cadF, jlpA, pebA, porA, and pldA), invasion (ciaB), toxin production (cdtA, cdtB, and cdtC), secretion (virB9), and motility (flaAB, flgB, and flhB) were tested. The adhesion genes play a crucial role in bacterial colonization, and the latter genes assist with the invasion of the host cells by the bacteria (39, 40). The prevalence of adhesion and invasion virulence factors varied between different samples. In previous studies, Biswas et al. and Wieczorek et al. found a higher prevalence of these adhesion and invasion genes in clinical samples than in nonclinical samples (41, 42). In this study, the prevalence of adhesion and invasion virulence factors was higher in the meat samples than in the farm samples. This indicated that C. jejuni isolated from the meat samples has a higher potential for adhesion and invasion than C. jejuni isolated from the farm samples. The cytolethal distending toxin (CDT) encoded by genes cdtA, cdtB, and cdtC plays an important role in toxin production and helps in the pathogenesis of Campylobacter (43). Among these three subunits of the cdt gene cluster, cdtB is an active toxin; the other two subunits, cdtA and cdtC, help bind and deliver the toxic gene cdtB (44, 45). In this study, cdt gene clusters were abundantly present in the isolates from conventional and NAE chicken samples compared to those from farm samples. The cdt gene clusters were found to be higher in patients with diarrhea (96.2%) than in the patient without diarrhea (76.5%) (46). Interestingly, the C. jejuni isolated from the litter samples tested negative for these virulence genes, which suggested that C. jejuni isolated from the meat samples is potentially more pathogenic than litter samples. Furthermore, higher prevalence of the virulence genes in the retail isolates than in those from farm samples also indicates the potential for a different source of contamination in the retail isolates. The potential sources might be transport coops, rinse water, slaughter line, and handling during processing (47). Regarding the prevalence of antimicrobial resistance phenotypes, 13.6% of C. jejuni isolates demonstrated multidrug resistance to 3 or more different classes of antimicrobials, and 57.6% of C. jejuni isolates were resistant to at least one antimicrobial tested. The number of MDR C. jejuni isolates reported in this study was higher than the result (<3%) previously reported by NARMS integrated report and the results (3.5%) reported by Mathew et al. (48, 49), which may indicate that antibiotic resistance is spreading or increasing among the Campylobacter in poultry. However, in a survey conducted in human patients, C. jejuni isolates showed much higher MDR 56.8% (50). Increased MDR in Campylobacter might cause serious public health concerns, as it may pose a severe health issue to patients, leading to increase health care costs. Among the C. jejuni isolates, phenotypic resistance was observed in 15.3% of ciprofloxacin, whereas 52.43% of C. jejuni isolates possess gyrA gene in their genome, which is responsible for fluoroquinolone resistance. In this study, ciprofloxacin resistance observed in C. jejuni was lower than the national average of 28% in 2017 (51). The phenotypic resistance observed in azithromycin and erythromycin was 11.9% and 16.9%, respectively, whereas 11.0% of C. jejuni isolates possess aph(3′)-IIIa gene, which is responsible for aminoglycoside resistance. Phenotypic tetracycline resistance was observed in 23.7% C. jejuni isolates, whereas only 14.6% possess tet(O) genes in their genome. One possible reason is that other genes encoding tetracycline resistance may be present in these bacteria. These results suggested that more related genes should be examined to explore the genotypic-phenotypic discrepancies between antibiotic resistance characteristics of these Campylobacter isolates.

Conclusion.

The present study showed that the predominant species of Campylobacter present in the processed retail chicken and on the farm was C. jejuni within Mississippi State. This study highlights the field status of antibiotic resistance and virulence of Campylobacter. The Campylobacter isolated in this study showed higher resistance to azithromycin, tetracycline, and fluoroquinolone antibiotics, and these are the most common antibiotics used for the treatment of human Campylobacter infection. The high level of antimicrobial resistance from the isolated Campylobacter strains represents a public health threat due to the potential transmission to humans. The higher prevalence of the antimicrobial resistance and virulence genes in the meat samples compared to that in the farm samples indicates that the potentially pathogenic strains of C. jejuni are circulating in retail meat, suggesting that there remains a public health and food safety threat due to potential transmission to humans. The results obtained in this study provide valuable information about the prevalence, phenotypic and genotypic antibiotics resistance, and virulence genes of Campylobacter present on NAE farm and retail meat, which is essential for developing effective intervention methods to control Campylobacter on the NAE farm and reduce foodborne infections caused by Campylobacter species transmitted through poultry products.

MATERIALS AND METHODS

Sample collection.

Retail raw chicken samples (whole chicken carcass, giblets, and drumstick) were randomly collected from 10 grocery stores within the state of Mississippi between April and July 2019. A total of 70 NAE-raised chicken samples and 90 conventional chicken samples were obtained. The samples were transported in a cooler with ice to the laboratory and processed within 12 h. A total of 254 farm samples, including litter (n = 103), feces (n = 74), and cloacal swabs (n = 77), were collected randomly from four commercial broiler farms under an NAE program in the state of Mississippi between April and July 2019. The ages of the broilers for the collection of samples were between 28 to 56 days. Approximately 10 g of litter and fresh feces was aseptically collected into prelabeled sterile Whirl-Pak filter bags (Nasco Whirl-Pak standard sample bags). Cloacal swabs were taken from randomly selected birds and immersed in a sterile culture tube with 5 mL of double-strength blood-free Bolton broth (2× BF-BB) (Oxoid, CM0983).

Bacterial isolation.

The bacterial isolation was performed based on the Microbiology Laboratory Guidebook (MLG) 41.04 method provided by the United States Department of Agriculture-Food Safety and Inspection Service (USDA-FSIS) with some modifications (52, 53). The raw poultry product samples (carcass, giblets, and drumstick) were weighed, and five times the volume of buffered peptone water (BPW) was added and mixed thoroughly by hand massaging and stomaching for 60 s. For the litter and feces samples, 10 g was prepared for Campylobacter enrichment by adding 90 mL of BPW, and then the sample was mixed thoroughly by gently shaking for 60 s. After preenrichment, 20 mL of the homogenized mixture was transferred into a 20 mL, 2× BF-BB supplemented with Oxoid Bolton Broth Selective supplements consisting of vancomycin, cefoperazone, trimethoprim, and amphotericin B (Oxoid, SR0183E). For the cloaca swab samples, an additional 5 mL of the 2× BF-BB supplements with antibiotics was added to the initial 5 mL of BPW, making the total volume 10 mL. The cultures were incubated at 42°C for 48 h under microaerobic conditions (85% nitrogen, 10% carbon dioxide, and 5% oxygen) using Mart anaerobic jars with an Anoxomat II system (Mart Microbiology B.V., Netherlands). After the enrichment, each sample was streaked onto duplicate Campylobacter selective agar media plates. C. jejuni ATCC 33560 and C. jejuni ATCC 29428 were used as positive controls. The Campylobacter selective agar contained Campylobacter agar base (Oxoid, CM0689), selective supplements (Oxoid, SR0204E), and 5% laked horse blood (Remel, R54072). The agar plates were then incubated under the microaerophilic condition at 42°C for 48 h. All agar plates were subsequently checked for the presence of typical colonies (small to medium, grayish in coloration with an irregular or round edge, and mucoid appearance) of Campylobacter. One completely independent single colony was selected per sample, and the suspected colony was subcultured twice on the Campylobacter selective agar to obtain the pure culture.

Identification of Campylobacter.

The confirmation was conducted via real-time PCR using Campylobacter genus-specific primers. Suspected Campylobacter-positive colonies were resuspended in nuclease-free water. As described previously, DNA was prepared using boiled lysates with some modification (54). Briefly, a sterile plastic needle was used to touch a portion of the suspect colony, which was then suspended in 100 μL of phosphate-buffered solution (1× PBS) solution and then centrifuged at 3,884 relative centrifugal force (rcf) using VWR mini centrifuge for 2 min to obtain a bacterial pellet. The supernatant was discarded, and 100 μL of nuclease-free water was added and mixed via vortexing. The bacterial suspension was boiled at 95°C for 5 min. The resulting solution was centrifuged at 3,884 rcf using VWR mini centrifuge for 2 min, and the supernatant was transferred into a new tube and served as the DNA template. The real-time PCR assay was performed using forward primer R-campF2 (5′-CACGTGCTACAATGGCATAT-3′) and reverse primer R-campR2 (5′-GGCTTCATGCTCTCGAGTT-3′). Each reaction contained 5 μL of PowerUp SYBR green master mix (Applied Biosystems, USA), 3.5 μL of nuclease-free water, 0.25 μL of each forward and reverse primer (10 μM), and 1 μL of template DNA. Real-time PCR was performed using a Quant Studio 3 (Applied Biosystems, USA) with the following conditions: the initial denature step was 95°C for 20 s, 40 cycles at 95°C for 3 s, and 60°C for 20 s. Melting curve analysis was performed in the range of 60°C to 95°C at 0.5°C per 5-s increment to analyze the specificity of the primers.

Identification of Campylobacter spp.

The 16S rRNA gene has been used to rapidly detect and identify bacterial species (55). The 16S rRNA gene was amplified from the DNA of the isolates by PCR using the universal forward primer 27F (5′-AGAGTTTGATCCTGGCTCAG-3′) and reverse primer 1492R (5′-CGGTTACCTTGTTACGACTT-3′). PCR was conducted by using GoTaq green master mix (Promega, Madison, WI), and an Eppendorf master cycler (Eppendorf, Westbury, NY) thermocycler was used under the following conditions: 2 min at 95°C and 35 cycles of 30 s denaturation at 95°C, 30 s annealing at 60°C, and 90 s for the extension at 72°C. The PCR products were purified using a PCR purification kit (GeneJet PCR purification kit, K0701) following the manufacturer’s instructions. The purified PCR products were Sanger sequenced by Eurofins Genomics (Eurofins, Louisville, KY). The DNA sequences obtained were compared to information in the GenBank database using the Basic Local Alignment Search Tool (BLAST) program available through the National Center for Biotechnology Information (NCBI) website (www.ncbi.nlm.nih.gov/BLAST). Based on the result of BLAST comparison, Campylobacter isolates were assigned to different species; however, if the BLAST hit showed a mixture of different species, then those strains were classified as others.

Screening of virulence genes.

Two pentaplex (set A and B) and one triplex PCR (set C) assays were designed to test 13 virulence genes that are highly associated with the pathogenesis of Campylobacter. The gene name, thermocycler condition, primers used, and product size are listed in Table 10. The PCR products were visualized via gel electrophoresis using a 2% agarose gel stained with SYBR safe DNA gel stain (Invitrogen, Carlsbad, CA). The images were visualized using a Kodak Gel Logic 200 imaging system (Eastman Kodak Co., Rochester, NY).
TABLE 10

List of primers used and thermocycler setting used for the amplification of the virulence genes

SetTarget geneAccession no.Primer nameSequence (5′ to 3′)Length (nt)dTemp (°C)Amplicon size (bp)
Ab ciaB NP_282066ciaB.F335 GGTCTAACTTCATCAACCCTTTGC 2462.9658
ciaB.R992 CTCATGCGGTGGCATTAGAATG 2262.7
cadF NP_282616cadF.F20 GCATCCACTCTTCTATTATCCGC 2362.8543
cadF.R562 ATTCCGTCTTAGTGATTCTTTGGC 2461.2
cdtA NP_281292cdtA.F3 ATCGTACCTCTCCTTGGCG 1962.3440
cdtAR442 CGGAGCAGCTTTAACGGTTTG 2162.6
cdtC NP_281290cdtC.F260 GCTCCAAAGGTTCCATCTTCTAAG 2462.9263
cdtC.R522 GCAACTCCTACTGGAGATTTGAAAG 2562.9
cdtB NP_281291cdtB.F152 GCTTGAGTTGCGCTAGTTGG 2062.4180
cdtB.R331 TGGAGGAACAGATGTAGGAGC 2162.6
Bb virB9 YP_980061virB9.F429 AAGAACACGCTTTGCAATGGC 2160.6535
virB9.R964 CGATGATCCTAGTCTCTACTGGAC 2464.6
pebA NP_282073pebA.F40 GCTCTAGGTGCTTGTGTTGC 2062.4436
pebA.R476 GTAGTTGCAGCTTGAGCCAC 2062.4
porA NP_282406porA.F740 TCAACTGGACACTTGAAGGTGC 2262.7342
porA.R1082 CCACCATATACGAAGTCAGCACC 2364.8
flhB NP_281526flhB.F531 GGTTGCACAGCTTACTTGGC 2062.4257
flhB.R788 ACATCCGCACCTGCAACATC 2062.4
jlpA NP_282133jlpA.F998 GCACACAGGGAATCGACAGC 2064.5119
jlpA.R1116 AAATGACGCTCCGCCCATTAAC 2262.7
Cc flaAB NP_282485 (flaA), NP_282484 (flaB)flaA.R1094 CAGTTGGAACAGGACTTGGAG 2162.6~1,500
flaB.R253 GCTCATCCATAGCCTTATCAGCAG 2464.6
pldA Part of NC_002163pldA.F422 GCCTATACTCAAACTTCTTGGTGG 2460.6499
pldA.R940 AGTCTATAAGGCTTTCTCCATAGCC 2562.9
flgB NP_281712flgB.F25 GAACTGGTCACTGGTGCTTTAGC 2364.6224
flgB.R248 CTAGGATCAGGGAATTTCCAAGG 2362.8

PCR thermocycler condition was initial denaturation at 95°C for 3 min followed by 35 cycles of 95°C for 30 s, 60°C for 30 s, 72°C for 90 s, and a final extension step of 72°C for 5 min.

Antibiotics resistance genes run as a pentaplex PCR.

Antibiotics resistance gene run as a triplex PCR.

nt, nucleotide.

List of primers used and thermocycler setting used for the amplification of the virulence genes PCR thermocycler condition was initial denaturation at 95°C for 3 min followed by 35 cycles of 95°C for 30 s, 60°C for 30 s, 72°C for 90 s, and a final extension step of 72°C for 5 min. Antibiotics resistance genes run as a pentaplex PCR. Antibiotics resistance gene run as a triplex PCR. nt, nucleotide. Campylobacter isolates in this study were tested for the presence of ARGs. A pentaplex PCR was designed and used to detect ARGs for three different antibiotic classes: tetracycline [tet(O)], aminoglycosides [aph(2’)-Ig, aph(3′′)-IIIa], and β-lactam (blaOXA-61, blaOXA-184). For fluoroquinolone and erythromycin, gyrA and ermB genes were tested. The PCR mix (10 μL) comprised 5 μL GoTaq green master mix (Promega, Madison, WI), 3.5 μL of nuclease-free water, 0.25 μL of each forward and reverse primer (10 μM), and 1 μL of template DNA. The thermocycler condition and primers used for PCR are listed in Table 11. The PCR products were visualized via gel electrophoresis using a 2% agarose gel stained with SYBR safe DNA gel stain (Invitrogen, Carlsbad, CA). The images were visualized using a Kodak Gel Logic 200 imaging system (Eastman Kodak Co., Rochester, NY).
TABLE 11

List of primers used and thermocycler setting used for the amplification of the antimicrobial resistance genes

SetTarget genesAccession no.OrientationSequence (5′ to 3′)Length (nt)Temp (°C)Amplicon size (bp)Reference
Ab aph (3′)-IIIa NG_047420 Forward TGCACTTTGAACGGCATGATG 2156.5432This study
Reverse TGTCATACCACTTGTCCGCC 2057.3This study
aph (2′′)-Ig NG_047407 Forward GATTTACCTGCCTTGATTCCGG 2256.0523This study
Reverse TTCGCCGAAATCTTTCCCA 1954.6This study
bla OXA-184 NG_049485 Forward GCTCTCAAGTGCCTGCTTTT 2056.0317This study
Reverse AAATCCAACAATCCAAGCCAAA 2253.6This study
bla OXA-61 NG_049801 Forward CTTTCTCTCCCGCTTCCACT 2056.8203This study
Reverse ACCAATTCTTCTTGCCACTTCTTT 2455.3This study
tet(O) NG_048260 Forward AATATTCAGAGAAAAGGCGGCG 2255.7686This study
Reverse GCAGCCATAAAGAACCCCCT 2057.6This study
Bc gyrA L04566 Forward GCTCTTGTTTTAGCTGATGCA 2160.6620 59
Reverse TTGTCGCCATACCTACAGCTA 2158.7 59
Cc ermB KC575115 Forward GGGCATTTAACGACGAAACTGG 2262.7421 60
Reverse CTGTGGTATGGCGGGTAAGT 2062.4 60

PCR thermocycler condition was initial denaturation at 95°C for 3 min followed by 35 cycles of 95°C for 30 s, 55°C for 30 s, 72°C for 60 s, and a final extension step of 72°C for 5 min.

Antibiotics resistance genes run as a pentaplex PCR.

Antibiotics resistance gene run individually for PCR.

List of primers used and thermocycler setting used for the amplification of the antimicrobial resistance genes PCR thermocycler condition was initial denaturation at 95°C for 3 min followed by 35 cycles of 95°C for 30 s, 55°C for 30 s, 72°C for 60 s, and a final extension step of 72°C for 5 min. Antibiotics resistance genes run as a pentaplex PCR. Antibiotics resistance gene run individually for PCR.

AST.

Isolates were lost during the stock and reculture process, so isolates that were successfully recultured were tested for AST. C. jejuni (n = 59), C. lari (n = 7), and C. volucris (n = 2) were recultured from the −80°C stock culture, and phenotypic AST was tested using the Kirby-Bauer disc diffusion method. AST was conducted against seven antibiotics, which included azithromycin (AZI; Oxoid, CT0906B), ciprofloxacin (CIP; Oxoid, CT0425B), clindamycin (CLI; Oxoid, CT0064B), erythromycin (ERY; Oxoid, CT0020B), gentamicin (GEN; Oxoid, CT0024B), nalidixic acid (NAL; Oxoid, CT0031B), and tetracycline (TET; Oxoid, CT0054B). Briefly, the bacterial colony was suspended in Mueller-Hinton broth (MHB) and compared to a 0.5 McFarland Standard solution using spectrophotometry (Thermo Scientific Sensititre Nephelometer, CatLog: V301). The standardized 100 μL of MHB solution was transferred to 11 mL cation-adjusted MHB with lysed horse blood (Thermo Scientific, CP114-10) and streaked on Mueller-Hinton agar (MHA; Oxoid, CM0405) plates supplemented with 5% lysed horse blood. Antibiotic discs were placed onto the MHA plates and then incubated at 42°C for 24 h. After incubation, zones of inhibition were measured in millimeters for each plated antibiotic. The breakpoint zone of diameter from Clinical and Laboratory Standards Institute (56) for azithromycin, erythromycin, ciprofloxacin, and tetracycline was used as a standard to interpret the results. Due to the unavailability of the established standardized interpretive criteria for other antibiotics (clindamycin, gentamicin, and nalidixic acid) for Campylobacter, the standard guidelines for family Enterobacteriaceae as previously mentioned by Luangtongkum et al. and Schiaffino et al. were utilized for the interpretation of results (Table 12) (50, 57). Cutoff values used to determine the antibiotic resistance of Campylobacter along with the information about the concentration of the disc used

Statistical analysis.

Statistical analysis was performed using the Chi-square test in SAS v9.4 software (58). The level of significance (α) was set at 0.05. Data for phenotypic antibiotic resistance were categorized into three categories, resistant, intermediate, and susceptible, and all three categories were presented as a percentage. For analysis of multidrug-resistant (MDR) isolates, tested antibiotics were grouped together based on the antibiotic classes, and strains possessing resistance to three or more classes of antibiotics were considered MDR.
  46 in total

1.  Assembly and function of a bacterial genotoxin.

Authors:  Dragana Nesić; Yun Hsu; C Erec Stebbins
Journal:  Nature       Date:  2004-05-27       Impact factor: 49.962

2.  Comparison of different sampling types across the rearing period in broiler flocks for isolation of Campylobacter spp.

Authors:  S Ingresa-Capaccioni; S González-Bodí; E Jiménez-Trigos; F Marco-Jiménez; P Catalá; S Vega; C Marin
Journal:  Poult Sci       Date:  2015-03-05       Impact factor: 3.352

3.  Colonization of gastrointestinal tracts of chicks by Campylobacter jejuni.

Authors:  J T Beery; M B Hugdahl; M P Doyle
Journal:  Appl Environ Microbiol       Date:  1988-10       Impact factor: 4.792

4.  Food Attribution and Economic Cost Estimates for Meat- and Poultry-Related Illnesses.

Authors:  Robert L Scharff
Journal:  J Food Prot       Date:  2020-06-01       Impact factor: 2.077

5.  The European Union One Health 2019 Zoonoses Report.

Authors: 
Journal:  EFSA J       Date:  2021-02-27

6.  Effect of conventional and organic production practices on the prevalence and antimicrobial resistance of Campylobacter spp. in poultry.

Authors:  Taradon Luangtongkum; Teresa Y Morishita; Aaron J Ison; Shouxiong Huang; Patrick F McDermott; Qijing Zhang
Journal:  Appl Environ Microbiol       Date:  2006-05       Impact factor: 4.792

7.  Estimates of on-farm antimicrobial usage in broiler chicken production in the United States, 2013-2017.

Authors:  Randall S Singer; Leah J Porter; Nora F D Schrag; Peter R Davies; Michael D Apley; Kathe Bjork
Journal:  Zoonoses Public Health       Date:  2020-11       Impact factor: 2.702

8.  PCR detection of seven virulence and toxin genes of Campylobacter jejuni and Campylobacter coli isolates from Danish pigs and cattle and cytolethal distending toxin production of the isolates.

Authors:  D D Bang; E Møller Nielsen; F Scheutz; K Pedersen; K Handberg; M Madsen
Journal:  J Appl Microbiol       Date:  2003       Impact factor: 3.772

Review 9.  Use of antibiotics in broiler production: Global impacts and alternatives.

Authors:  Youcef Mehdi; Marie-Pierre Létourneau-Montminy; Marie-Lou Gaucher; Younes Chorfi; Gayatri Suresh; Tarek Rouissi; Satinder Kaur Brar; Caroline Côté; Antonio Avalos Ramirez; Stéphane Godbout
Journal:  Anim Nutr       Date:  2018-04-03

10.  Point Deletion or Insertion in CmeR-Box, A2075G Substitution in 23S rRNA, and Presence of erm(B) Are Key Factors of Erythromycin Resistance in Campylobacter jejuni and Campylobacter coli Isolated From Central China.

Authors:  Yiluo Cheng; Wenting Zhang; Qin Lu; Guoyuan Wen; Zhongzheng Zhao; Qingping Luo; Huabin Shao; Tengfei Zhang
Journal:  Front Microbiol       Date:  2020-03-03       Impact factor: 5.640

View more
  2 in total

1.  Complete Genome Sequences of Four Campylobacter jejuni Strains Isolated from Retail Chicken Meat and Broiler Feces.

Authors:  Sabin Poudel; Tianmin Li; Mark A Arick; Chuan-Yu Hsu; Adam Thrash; Anuraj T Sukumaran; Pratima Adhikari; Aaron S Kiess; Li Zhang
Journal:  Microbiol Resour Announc       Date:  2022-09-15

2.  Improvement in the Immunity- and Vitamin D3-Activity-Related Gene Expression of Coccidiosis-Challenged Ross 708 Broilers in Response to the In Ovo Injection of 25-Hydroxyvitamin D3&amp;nbsp.

Authors:  Seyed Abolghasem Fatemi; Kenneth S Macklin; Li Zhang; Ayoub Mousstaaid; Sabin Poudel; Ishab Poudel; Edgar David Peebles
Journal:  Animals (Basel)       Date:  2022-09-22       Impact factor: 3.231

  2 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.