Pleocatenatachiangraiensis gen. et. sp. nov. (Pleosporales, Dothideomycetes) from medicinal plants in northern Thailand.

Pleocatenata, a new genus, is introduced with its type species, Pleocatenatachiangraiensis, which was isolated from withered twigs of two medicinal plants, Clerodendrumquadriloculare (Blanco) Merr (Verbenaceae) and Tarennastellulata (Hook.f.) Ridl (Rubiaceae) in northern Thailand. The genus is characterized by mononematous, septate, brown or dark brown conidiophores, monotretic conidiogenous cells and catenate, obclavate, olivaceous to blackish brown conidia. Phylogenetic analysis of combined LSU, SSU, tef1-α, rpb2 and ITS sequence data showed Pleocatenata forms a distinct phylogenetic lineage in Pleosporales, Dothideomycetes. Therefore, we treat Pleocatenata as Pleosporales genera incertae sedis based on morphology and phylogenetic analyses. Descriptions and illustrations of the new taxa are provided, and it is compared with morphologically similar genera. Ya-Ru Sun, Ning-Guo Liu, Kevin D. Hyde, Ruvishika S. Jayawardena, Yong Wang.

Introduction

Medicinal plants are a rich source of natural products with biological and chemical properties. They are used in health care or treatment of human ailments and have been used since prehistoric times worldwide (Rasool-Hassan 2012). Many fungi have been found on medicinal plants and are members of and (Bhagat et al. 2012; Long et al. 2019; Ma et al. 2019; Hyde et al. 2020; Tennakoon et al. 2021). They form important associations with medicinal plants and as pathogens or saprobes (Long et al. 2019; Tennakoon et al. 2021), sources of medicines (Strobel et al. 1993; Huang et al. 2008; Hyde et al. 2019), involved in nutrient recycling (Bonnardeaux et al. 2007) and some are used in biological control (Hyde et al. 2019).

is the largest order in , which accounts for about a quarter of the class (Zhang et al. 2012; Hyde et al. 2013; Hongsanan et al. 2020a). They have a worldwide distribution with diverse lifestyles, including saprobes, pathogens of plants and humans, endophytes, epiphytes and hyperparasites (Ramesh 2003; Kirk et al. 2008; Zhang et al. 2012; Hyde et al. 2013; Sun et al. 2019; Ferdinandez et al. 2021). Many species in Nees, Boedijn and Güssow, can invade medicinal plants and cause leaf spots and other diseases, as economically important plant pathogens (Mathiyazhagan et al. 2004; Abtahi and Nourani 2017; Zhang et al. 2020), and some also pose a threat to human health (Hyde et al. 2018; Iturrieta-González et al. 2020). Endophytes in also show important biocontrol value (Su et al. 2014; De Silva et al. 2019; Hyde et al. 2019), for example, an extract from R.R. Nelson has mosquito-larvicidal activity (Abutaha et al. 2015).

The sexual morph of is characterized by uniloculate ascomata typically with papillae, ostioles and pseudoparaphyses, generally fissitunicate asci bearing mostly septate ascospores of different colours and shapes (Ramesh 2003; Kirk et al. 2008; Zhang et al. 2012; Hyde et al. 2013). and hyphomycetes are the asexual morphs of pleosporalean taxa (Zhang et al. 2012; Hongsanan et al. 2020a). Recent comprehensive studies on treated 91 families in (Hongsanan et al. 2020a). More than 40 genera are recognized as genera incertae sedis in (Hongsanan et al. 2020a; Wijayawardene et al. 2020, 2021). This uncertainty in genetic placement occurs for the following reasons: 1) some genera lack sufficient collections even though molecular data is available, they are not included in any families in phylogenetic analyses, eg. E.B.G. Jones & Abdel-Wahab, A. Hashim. & Kaz. Tanaka and Crous (Li et al. 2016; Abdel-Wahab et al. 2017; Crous et al. 2017); 2) due to the diverse morphology of hyphomycetous asexual morphs, it is difficult to determine their familial placement without the sexual morph and molecular data. Examples are R.F. Castañeda, Minter & Saikawa, Tzean & J.L. Chen, Sacc. & P. Syd and Naumov & Czerepan (Obrist 1959; Tóth 1975; Tzean and Chen 1990; Castañeda-Ruiz et al. 2004).

During the examination of collections from medicinal plants in northern Thailand (Sun et al. 2021), two isolates representing a new species were obtained from and . Morphology and phylogenetic analyses confirmed that it was distinct in , but its familial placement was uncertain. Thus, we introduced a new genus, (, genera incertae sedis) to accommodate the new species, .

Materials and methods

Collection, examination and isolation

The isolates used in this study were collected from decaying twigs of and from Mae Fah Luang University, Chiang Rai, Thailand during June to July 2020 in terrestrial habitat. The samples were packaged in envelopes and returned to the laboratory as described in Senanayake et al. (2020). The fruiting bodies on natural substrates were observed and photographed using a stereo-microscope (SteREO Discovery, V12, Carl Zeiss Microscopy GmBH, Germany). Morphological characters were observed using a Nikon ECLIPSE Ni compound microscope (Nikon, Japan) and photographed with a Nikon DS-Ri2 digital camera (Nikon, Japan). The Adobe Photoshop CS6 Extended v. 13.0 software was used to make photo-plates. Measurements were done with the Tarosoft (R) Image Frame Work software.

Single spore isolations were used to obtain pure cultures following the methods described by Senanayake et al. (2020). Germinated conidia were transferred to new potato dextrose agar (PDA) plates and incubated at 26 °C for four weeks. The pure cultures obtained were deposited in Mae Fah Luang University Culture Collection (MFLUCC), Chiang Rai, Thailand. Herbaria materials were deposited in the herbarium of Mae Fah Luang University (MFLU), Chiang Rai, Thailand. Facesoffungi (FoF) and Index Fungorum numbers were acquired as described in Jayasiri et al. (2015) and Index Fungorum (2022).

DNA extraction, PCR amplification and sequencing

Fresh fungal mycelia grown on PDA medium for 4 weeks at 26 °C were scraped with a sterile scalpel. Genomic DNA was extracted from scraped mycelia using the BIOMIGA Fungus Genomic DNA Extraction Kit (GD2416, BIOMIGA, San Diego, California, USA) following the manufacture’s protocol. Five genes were selected in this study: the 28S subunit rDNA (LSU), the 18S subunit rDNA (SSU), the internal transcribed spacers (ITS), the translation elongation factor 1 (), and the RNA polymerase II subunit 2 (). Polymerase chain reaction (PCR) was carried out in 20 μL reaction volume which contained 10 μL 2 × PCR Master Mix, 7 μL ddH2O, 1 μL of each primer, and 1 μL template DNA. The PCR thermal cycle program and primers are given (Table 1). Purification and sequencing of PCR products were carried out at SinoGenoMax (Beijing) Co., China.

Table 1.

Primers and PCR procedures used in this study.

Locus	Primers		PCR procedures	References
	Name	Sequence (5’–3’)
Large subunit (LSU)	LR0R	ACCCGCTGAACTTAAGC	94 °C 3 min; 35 cycles of 94 °C 30 s, 52 °C 30 s, 72 °C 1 min; 72 °C 8 min; 4 °C on hold	Vilgalys and Hester (1990), Rehner and Samuels (1994)
	LR5	TCCTGAGGGAAACTTCG
Small subunit (SSU)	NS1	GTAGTCATATGCTTGTCTC		White et al. (1990)
	NS4	CTTCCGTCAATTCCTTTAAG
Internal transcribed spacer (ITS)	ITS5	GGAAGTAAAAGTCGTAACAAGG
	ITS4	TCCTCCGCTTATTGATATGC
Elongation factor-1 alpha (tef1-α)	EF1-983F	GCYCCYGGHCAYCGTGAYTTYAT	94 °C 2 min; 36 cycles of 66 °C – 56 °C (touchdown 9 cycles), 94 °C 30 sec, 56 °C 1 min, 72 °C 1 min; 72 °C 10 min; 4 °C on hold	Rehner and Buckley (2005)
	EF1-2218R	ATGACACCRACRGCRACRGTYTG
RNA polymerase II subunit (rpb2)	fRPB2-5F	GAYGAYMGWGATCAYTTYGG	94 °C 3 min; 40 cycles of 94 °C 20 sec, 55 °C 30 sec, 72 °C 1 min; 72 °C 10 min; 4 °C on hold	Liu et al. 1999
	fRPB2-7cR	CCCATRGCTTGYTTRCCCAT

Phylogenetic analyses

BLASTn (https://blast.ncbi.nlm.nih.gov//Blast.cgi) was used to evaluate closely related strains to our new taxa. Other sequences used in this study were obtained from GenBank referring to Zhang et al. (2012, 2018) and Hongsanan et al. (2020a, 2021) (Table 2). The single gene sequences were viewed using BioEdit v. 7.0.9.0 (Hall 1999). Alignments for each locus were generated with MAFFT v.7 (https://mafft.cbrc.jp/alignment/server/) and manually improved using AliView (Larsson 2014) for maximum alignment and minimum gaps. The final single gene alignments were combined by SequenceMatrix 1.7.8 (Vaidya et al. 2011).

Table 2.

Taxa of used in the phylogenetic analysis with the corresponding GenBank accession numbers. The newly generated strains are indicated in bold. N/A: Not available.

Species names	Strain number	LSU	SSU	ITS	tef1-α	rpb2
Acrocalymmaaquatica	MFLUCC 11-0208	JX276952	JX276953	JX276951	N/A	N/A
Acrocalymmapterocarpi	MFLUCC 17-0926	MK347949	MK347840	MK347732	MK360040	N/A
Acuminatisporapalmarum	MFLUCC 18-0264	MH390437	MH390401	NR_163327	MH399248	N/A
	MFLUCC 18-0460	MH390438	MH390402	MN749106	MH399249	N/A
Aigialusgrandis	BCC 20000	GU479775	GU479739	N/A	GU479839	N/A
Alternariaalternata	AFTOL ID-1610	DQ678082	KC584507	KF465761	KC584634	KC584375
Amniculicolaaquatica	MFLUCC 16-1123	MK106096	MK106108	N/A	MK109800	N/A
Amorocoelophomacassia	MFLUCC 17-2283	MK347956	NG_065775	MK347739	MK360041	MK434894
Angustimassarinalonicerae	MFLUCC 15-0087	KY496724	N/A	KY496759	N/A	N/A
Anteagloniumparvulum	SMH5223	GQ221909	N/A	N/A	GQ221918	N/A
Aquasubmersajaponica	HHUF 30469	NG_057138	NG_062426	NR_154739	LC194384	LC194421
Aquasubmersamircensis	MFLUCC 11-0401	NG_042699	NG_061141	JX276954	N/A	N/A
Ascocylindricamarina	MD6011	KT252905	KT252907	N/A	N/A	N/A
	MF416	MK007123	MK007124	N/A	N/A	N/A
Astragalicolavasilyevae	MFLUCC 17-0832	MG828986	MG829098	NR_157504	MG829193	MG829248
Astrosphaeriellafusispora	MFLUCC 10-0555	KT955462	KT955443	N/A	KT955425	KT955413
Atrocalyxacutisporus	KT 2436	LC194341	LC194299	LC194475	LC194386	LC194423
Bahusandhikaindica	GUFCC 18001	KF460274	N/A	KF460273	N/A	N/A
Bambusicolabambusae	MFLUCC 11-0614	JX442035	JX442039	JX442031	N/A	KP761718
Berkleasmiumcrunisia	BCC 17023	DQ280271	N/A	DQ280265	N/A	N/A
Berkleasmiumtyphae	BCC 12536	DQ280275	N/A	DQ280264	N/A	N/A
Brevicollumhyalosporum	MFLUCC 17-0071	MG602200	MG602202	MG602204	MG739516	N/A
Brevicollumversicolor	HHUF 30591	NG_058716	NG_065124	NR_156335	LC271246	LC271250
Camarosporidiellacaraganicola	MFLUCCC 14-0605	KP711381	KP711382	KP711380	N/A	N/A
Camarosporiumquaternatum	CPC 31081	NG_064442	KY929123	NR_159756	KY929201	N/A
Camarosporomycesflavigenus	CBS 314.80	GU238076	NG_061093	MH861266	N/A	N/A
Coniothyriumpalmarum	CBS 400.71	JX681084	EU754054	MH860184	N/A	KT389592
Corynesporacassiicola	CBS 100822	GU301808	GU296144	N/A	GU349052	GU371742
Corynesporatorulosa	CPC 15989	KF777207	N/A	NR_145181	N/A	N/A
Crassiperidiumoctosporum	MAFF 246406	LC373116	LC373092	LC373104	LC373128	LC373140
Cryptocoryneumjaponicum	HHUF 30482	NG_059035	NG_065118	NR_153938	LC096144	LC194438
Cryptocoryneumpseudorilstonei	CBS 113641	NG_059036	LC194322	NR_153941	LC096152	LC194446
Cucurbitariaberberidis	MFLUCC 11-0387	KC506796	KC506800	N/A	N/A	N/A
Cyclothyriellarubronotata	CBS 141486	KX650544	NG_061252	NR_147651	KX650519	KX650574
Cylindroaseptosporaleucaenicola	MFLUCC 17-2424	MK347966	MK347856	NR_163333	MK360047	N/A
Dacampiaengeliana	Hafellner 72868	KT383791	N/A	N/A	N/A	N/A
Dacampiahookeri	Hafellner 73897	KT383792	N/A	N/A	N/A	N/A
Delitschiachaetomioides	SMH 3253.2	GU390656	N/A	N/A	GU327753	N/A
Delitschiawinteri	AFTOL ID-1599	DQ678077	DQ678026	N/A	DQ677922	DQ677975
Dendryphionfluminicola	MFLUCC 17-1689	MG208141	N/A	NR_157490	MG207992	N/A
Dictyocheirosporabannica	KH 332	AB807513	AB797223	LC014543	AB808489	N/A
Dictyosporiumelegans	NBRC 32502	DQ018100	DQ018079	DQ018087	N/A	N/A
Didymellaexigua	CBS 183.55	MH868977	GU296147	MH857436	N/A	N/A
Didymellarumicicola	CBS 683.79	MH873007	N/A	KT389503	N/A	KT389622
Didymosphaeriarubi-ulmifolii	MFLUCC 14-0023	KJ436586	KJ436588	MK646049	N/A	N/A
Dimorphosporicolatragani	CBS 570.85	KU728536	N/A	KU728497	N/A	N/A
Dothidotthiaaceris	MFLUCC 16-1183	MK751816	MK751761	MK751726	N/A	N/A
Fissuromacalami	MFLUCC 13-0836	MF588993	NG_062430	N/A	MF588975	N/A
Flammeascomabambusae	MFLU 11-0143	NG_059553	KP753952	NR_132915	N/A	N/A
Flavomycesfulophazii	CBS 135761	NG_058131	NG_061191	NR_137960	N/A	N/A
Foliophomafallens	CBS 161.78	GU238074	GU238215	KY940772	N/A	KC584502
	CBS 284.70	GU238078	GU238218	MH859609	N/A	N/A
Fuscostagonosporacytisi	MFLUCC 16-0622	KY770978	KY770977	N/A	KY770979	N/A
Fuscostagonosporasasae	HHUF 29106	AB807548	AB797258	AB809636	AB808524	N/A
Fusculinaeucalypti	CBS 120083	DQ923531	N/A	DQ923531	N/A	N/A
Fusculinaeucalyptorum	CBS 145083	MK047499	N/A	NR_161140	N/A	N/A
Halojulellaavicenniae	BCC 20173	GU371822	GU371830	N/A	GU371815	GU371786
Halotthiaposidoniae	BBH 22481	GU479786	GU479752	N/A	N/A	N/A
Hazslinszkyomycesaloes	CBS 136437	KF777198	N/A	KF777142	N/A	N/A
Helminthosporiumvelutinum	L131	KY984352	KY984432	KY984352	KY984463	KY984413
Hermatomycesiriomotensis	HHUF 30518	LC194367	LC194325	LC194483	LC194394	LC194449
Hermatomycestectonae	MFLUCC 14-1140	KU764695	KU712465	KU144917	KU872757	KU712486
Hypsostromacaimitalense	GKM1165	GU385180	N/A	N/A	N/A	N/A
Hypsostromasaxicola	SMH5005	GU385181	N/A	N/A	N/A	N/A
Hysteriumangustatum	CBS 123334	FJ161207	N/A	N/A	N/A	N/A
Hysterobreviumsmilacis	CBS 114601	FJ161174	FJ161135	N/A	FJ161091	FJ161114
Latoruacaligans	CBS 576.65	NG_058180	N/A	N/A	N/A	N/A
Latoruagrootfonteinensis	CBS 369.72	NG_058181	N/A	N/A	N/A	N/A
Lentimurisporaurniformis	MFLUCC 18-0497	MH179144	MH179160	N/A	MH188055	N/A
Lentitheciumclioninum	HHUF 28199	NG_059391	NG_064845	NR_154137	AB808515	N/A
Lentitheciumpseudoclioninum	HHUF 29055	NG_059392	NG_064847	AB809633	AB808521	N/A
Lepidosphaerianicotiae	AFTOL ID-1576	DQ678067	N/A	N/A	DQ677910	DQ677963
Leptosphaeriacichorium	MFLUCC 14-1063	KT454712	KT454728	KT454720	N/A	N/A
Leucaenicolaphraeana	MFLUCC 18-0472	MK348003	NG_065784	MK347785	MK360060	MK434867
Libertasomycesmyopori	CPC 27354	NG_058241	N/A	KX228281	N/A	N/A
Ligninsphaeriajonesii	MFLUCC 15-0641	NG_059642	N/A	N/A	N/A	N/A
Lindgomycescigarospora	G619	KX655804	KX655805	KX655794	N/A	N/A
Lindgomycesingoldianus	ATCC 200398	AB521736	NG_016531	NR_119938	N/A	N/A
Longiostiolumtectonae	MFLUCC 12-0562	KU764700	N/A	KU712447	N/A	N/A
Longipedicellataaptrootii	MFLU 10-0297	KU238894	KU238895	KU238893	KU238892	KU238891
Lophiostomamacrostomum	KT508	AB619010	AB618691	N/A	LC001751	N/A
Lophiotremaeburnoides	KT 1424.1	LC001707	LC001706	LC001709	LC194403	LC194458
Macrodiplodiopsisdesmazieri	CBS 140062	NG_058182	N/A	NR_132924	N/A	N/A
Massariaanomia	CBS 59178	GU301839	GU296169	N/A	N/A	GU371769
Massariainquinans	M19	N/A	HQ599444	HQ599402	HQ599342	HQ599460
Melanommajaponicum	MAFF 239634	NG_060360	NG_065122	NR_154215	LC203367	LC203395
Melanommapulvispyrius	CBS 124080	MH874873	GU456302	MH863349	GU456265	GU456350
Misturatosphaeriaaurantonotata	GKM 1238	NG_059927	N/A	N/A	GU327761	N/A
Morosphaeriamuthupetensis	NFCCI4219	MF614796	MF614797	MF614795	MF614798	N/A
Morosphaeriavelatispora	KH221	AB807556	AB797266	LC014572	AB808532	N/A
Multiloculariabambusae	MFLUCC 11-0180	KU693438	KU693442	KU693446	N/A	N/A
Murisporagalii	MFLUCC 13-0819	KT709175	KT709182	KT736081	KT709189	N/A
Neocamarosporiumgoegapense	CPC 23676	KJ869220	N/A	KJ869163	N/A	N/A
Neoconiothyriumpersooniae	CBS 143175	MG386094	N/A	MG386041	N/A	N/A
Neomassariafabacearum	MFLUCC 16-1875	KX524145	NG_061245	N/A	KX524149	N/A
Neomassariaformosana	NTUCC 17-007	MH714756	MH714759	N/A	MH714762	MH714765
Neomassarinathailandica	MFLU 11-0144	NG_059718	N/A	NR154244	N/A	N/A
	MFLUCC 17-1432	MT214467	MT214420	MT214373	N/A	N/A
Neopaucisporarosaecae	MFLUCC 17-0807	MG829033	NG_061293	MG828924	MG829217	N/A
Neophaeosphaeriaagaves	CPC 21264	KF777227	N/A	KF777174	N/A	N/A
Neophaeosphaeriafilamentosa	CBS 102202	GQ387577	GQ387516	JF740259	GU349084	GU371773
Neophaeosphaeriaphragmiticola	KUMCC 16-0216	MG837009	NG_065735	N/A	MG838020	N/A
Neoplatysporoidesaloes	CPC 36068	MN567619	N/A	NR_166316	N/A	N/A
Neopyrenochaetacercidis	MFLUCC 18-2089	MK347932	MK347823	MK347718	N/A	MK434908
Neopyrenochaetopsishominis	UTHSC DI16 238	LN907381	N/A	LT592923	N/A	LT593061
Neoroussoellabambusae	MFLUCC 11-0124	KJ474839	N/A	KJ474827	KJ474848	KJ474856
Neotestudinarosatii	CBS 690.82	DQ384107	DQ384069	N/A	N/A	N/A
Neoyrenochaetaacicola	CBS 812.95	GQ387602	GQ387541	NR_160055	N/A	LT623271
Nigrogranafuscidula	CBS 141556	KX650550	N/A	NR_147653	KX650525	N/A
Nigrogranamackinnonii	CBS 674.75	GQ387613	NG_061081	NR_132037	KF407986	KF015703
Occultibambusabambusae	MFLUCC 13-0855	KU863112	N/A	KU940123	KU940193	KU940170
Occultibambusajonesii	GZCC 16-0117	KY628322	KY628324	N/A	KY814756	KY814758
Parabambusicolabambusina	KH 139	AB807537	AB797247	LC014579	AB808512	N/A
Paradictyoarthriniumaquatica	MFLUCC 16-1116	NG_064501	N/A	NR_158861	N/A	N/A
Paradictyoarthriniumdiffractum	MFLUCC 13-0466	KP744498	KP753960	KP744455	N/A	KX437764
Paralophiostomahysterioides	PUFNI 17617	MT912850	MN582762	MN582758	N/A	MT926117
Parapyrenochaetaprotearum	CBS 131315	JQ044453	N/A	JQ044434	N/A	LT717683
Periconiadelonicis	MFLUCC 17-2584	NG_068611	NG_065770	N/A	N/A	MK434901
Periconiapseudodigitata	KT 1395	AB807564	AB797274	LC014591	N/A	N/A
Phaeoseptummali	MFLUCC 17-2108	MK625197	N/A	MK659580	MK647990	MK647991
Phaeoseptumterricola	MFLUCC 10-0102	MH105779	MH105780	MH105778	MH105781	MH105782
Phaeosphaeriaoryzae	CBS 110110	KF251689	GQ387530	KF251186	N/A	KF252193
Phaeosphaeriopsistriseptata	MFLUCC 13-0271	KJ522479	KJ522484	KJ522475	MG520919	KJ522485
Plenodomussalvia	MFLUCC 13-0219	KT454717	KT454732	KT454725	N/A	N/A
Pleocatenatiumchiangraiense	MFLUCC 21-0222	OL986398	N/A	OL986396	OM240638	OM117709
	MFLUCC 21-0223	OL986399	N/A	OL986397	OM240637	OM117708
Pleohelicoonrichonis	CBS 282.54	N/A	AY856952	MH857332	N/A	N/A
Pleomonodictysdescalsii	FMR 12716	KY853522	N/A	KY853461	N/A	N/A
Preussiafuniculate	CBS 659.74	GU301864	GU296187	N/A	GU349032	GU371799
Pseudoastrosphaeriellalongicolla	MFLUCC 11-0171	KT955476	N/A	N/A	KT955438	KT955420
Pseudoastrosphaeriellathailandensis	MFLUCC 11-0144	KT955478	KT955457	N/A	KT955440	KT955416
Pseudoberkleasmiumchiangmaiense	MFLUCC 17-1809	MK131260	N/A	MK131259	MK131261	N/A
Pseudoberkleasmiumpandanicola	KUMCC 17-0178	MH260304	MH260344	MH275071	N/A	N/A
Pseudocoleodictyosporatectonae	MFLUCC 12-0385	KU764709	NG_061232	NR_154338	N/A	KU712491
Pseudocoleodictyosporathailandica	MFLUCC 12-0565	KU764701	NG_062417	NR_154337	N/A	KU712494
Pseudodidymosphaeriaspartii	MFLUCC 13-0273	KP325436	KP325438	KP325434	N/A	N/A
Pseudopyrenochaetalycopersici	FMR 15746	EU754205	NG_062728	NR_103581	N/A	LT717680
Pseudopyrenochaetaterretris	FMR 15327	LT623216	N/A	LT623228	N/A	LT623287
Pseudotetraploalongissima	HC 4933	AB524612	AB524471	AB524796	AB524827	N/A
Pseudoxylomyceselegans	KT 2887	AB807598	AB797308	LC014593	AB808576	N/A
Pyrenochaetopsisleptospora	CBS 101635	GQ387627	NG_063097	JF740262	MF795881	LT623282
Pyrenochaetopsistabarestanensis	IBRC M 30051	KF803343	NG_065034	NR_155636	N/A	N/A
Quadricrurabicornis	yone 153	AB524613	AB524472	AB524797	AB524828	N/A
Quercicolafusiformis	MFLUCC 18-0479	MK348009	MK347898	MK347790	MK360085	MK434864
Quercicolaguttulospora	MFLUCC 18-0481	MK348010	MK347899	MK347791	MK360086	N/A
Quixadomycescearensis	HUEFS 238438	MG970695	N/A	NR_160606	N/A	N/A
Roussoellanitidula	MFLUCC 11-0634	KJ474842	N/A	KJ474834	KJ474851	KJ474858
Salsugineaphoenicis	MFLU 19-0015	MK405280	N/A	N/A	MK404650	N/A
Salsuginearamicola	KT 2597.2	GU479801	GU479768	N/A	GU479862	GU479834
Seltsamiaulmi	CBS 143002	MF795794	MF795794	MF795794	MF795882	MF795836
Shiraiabambusicola	GZAAS2.629	KC460980	N/A	GQ845415	N/A	N/A
Splanchnonemaplatani	CBS 222.37	KR909316	KR909318	MH855895	KR909319	KR909322
Sporormiafimetaria	UPS Dissing Gr.81.194	GQ203729	N/A	GQ203769	N/A	N/A
Sporormiellaisomera	CBS 166.73	MH872355	N/A	AY943053	N/A	N/A
Stemphyliumherbarum	CBS 191.86	GU238160	GU238232	NR_111243	KC584731	DQ247794
Striatiguttulanypae	MFLUCC 18-0265	MK035992	MK035977	MK035969	MK034432	MK034440
Striatiguttulaphoenicis	MFLUCC 18-0266	MK035995	MK035980	MK035972	MK034435	MK034442
Sublophiostomathailandica	MFLUCC 11-0185	KX534216	KX534222	MW136275	KX550080	MW088718
	MFLUCC 11-0207	KX534212	KX534218	MW136257	KX550077	MW088714
Subplenodomusviolicola	CBS 306.68	MH870849	GU238231	MH859138	N/A	N/A
Sulcatisporaacerina	KT 2982	LC014610	LC014605	LC014597	LC014615	N/A
Sulcatisporaberchemiae	KT 1607	AB807534	AB797244	AB809635	AB808509	N/A
Sulcosporiumthailandica	MFLUCC 12-0004	KT426563	KT426564	MG520958	N/A	N/A
Teichosporatrabicola	C134	KU601591	N/A	KU601591	KU601601	KU601600
Tetraplosphaeriasasicola	KT 563	AB524631	AB524490	AB524807	AB524838	N/A
Thyridariaacaciae	CBS 138873	NG_058127	N/A	KP004469	N/A	N/A
Thyridariabroussonetiae	TB1	KX650568	KX650515	KX650568	KX650539	KX650586
Torulaaquatica	MFLUCC 16-1115	MG208146	N/A	MG208167	N/A	MG207977
Torulapluriseptata	MFLUCC 14-0437	KY197855	KY197862	MN061338	KY197875	KY197869
Tremateiaarundicola	MFLU 16-1275	KX274248	KX274254	KX274241	KX284706	N/A
Trematosphaeriagrisea	CBS 332.50	NG_057979	NG_062930	NR_132039	KF015698	KF015720
Trematosphaeriapertusa	CBS 122368	NG_057809	FJ201991	NR_132040	KF015701	FJ795476
Tzeananiataiwanensis	NTUCC 17-006	MH461121	MH461127	MH461124	MH461131	N/A
Wicklowiaaquatica	CBS 125634	MH875044	NG_061099	N/A	N/A	N/A
Wicklowiasubmersa	MFLUCC 18-0373	MK637644	MK637643	N/A	N/A	N/A
Xenopyrenochaetopsispratorum	CBS 445.81	GU238136	NG_062792	MH861363	N/A	KT389671

The single locus and combined analyses were carried out for maximum likelihood (ML) and Bayesian posterior probability (BYPP). The ML analyses were carried out using IQ-TREE (Nguyen et al. 2015; Trifinopoulos et al. 2016) on the IQ-TREE web server (http://iqtree.cibiv.univie.ac.at, 30 September 2021) under partitioned models. The best-fit substitution models were determined by WIQ-TREE (Chernomor et al. 2016): SYM+I+G4 for LSU and SSU; TIM+F+I+G4 for tef1-α; GTR+F+I+G4 for ; TIM2+F+I+G4 for ITS. Ultrafast bootstrap analysis was implemented with 1,000 replicates (Minh et al. 2013; Hoang et al. 2018).

The BYPP analyses were performed in CIPRES (Miller et al. 2010) with MrBayes on XSEDE 3.2.7a (Ronquist et al. 2012). The best nucleotide substitution model for each data partition was evaluated by MrModeltest 2.2 (Nylander 2004). The substitution model GTR+I+G was decided for LSU, SSU, ITS, tef1-α and sequences. The Markov chain Monte Carlo (MCMC) sampling approach was used to calculate posterior probabilities (PP) (Rannala and Yang 1996). Six simultaneous Markov chains were run for 10 million generations and trees were sampled every 1,000th generation. The first 20% of trees, representing the burn-in phase of the analyses, were discarded and the remaining trees were used for calculating posterior probabilities (PP) in the majority rule consensus tree.

Phylogenetic trees were viewed using FigTree v1.4.0 (Rambaut and Drummond 2008) and modified in Microsoft Office PowerPoint 2010 and converted to jpg file using Adobe Photoshop CS6 Extended 10.0 (Adobe Systems, San Jose, CA, USA). The new sequences derived from this study were deposited in GenBank. The final alignment and tree were deposited in TreeBase (http://purl.org/phylo/treebase/phylows/study/TB2:S29199).

Results

Blast searches of LSU, tef1-α, and ITS sequences data in NCBI showed that our sequences were related to , , and . One hundred and seventy-six taxa, representing all families in , with Alb. & Schwein (CBS 123334) and (Schwein.) E. Boehm & C.L. Schoch (CBS 114601) as the outgroups, were selected for the analyses. The final combined dataset consisted of 4,953 characters (LSU: 1–850 bp, SSU: 851–1,851 bp, tef1-α: 1,852–2,720 bp, : 2,721–3,701 bp, ITS: 3,702–4,953 bp), including alignment gaps. Among them, 2,336 characters were constant, 608 variable characters were parsimony-uninformative, and 2,009 characters were parsimony informative. The most likely tree (-ln = 98,965.704) is presented (Figure. 1) to show the phylogenetic placement of the newly introduced genus and its relationship with other members in .

Maximum likelihood tree generated by IQ-Tree, based on analysis of a combined dataset of LSU, SSU, tef1-α, and ITS sequence data. Bootstrap support values for ML greater than 75% and Bayesian posterior probabilities greater than 0.95 are given near nodes, respectively. Ex-type strains are in bold, the new isolates are in red.

Analyses of both ML and BYPP (not shown) yielded almost identical results, and the topology of the trees were similar to previous studies (Zhang et al. 2018; Hongsanan et al. 2020a, 2021). The combined analyses showed that two suborders and were well-supported and formed an upper clade in . Our two newly obtained fungal isolates (MFLUCC 21-0222 and MFLUCC 21-0223) clustered together and formed a distinct clade with maximum support (ML-BS = 100%, BYPP = 1.00) and they grouped with , and with weak support.

Taxonomy

Y.R. Sun, Yong Wang bis & K.D. Hyde gen. nov.

402C64E6-8895-5501-81E8-069D0B58EF71

Index Fungorum number:IF559457

Facesoffungi number: FoF 10630

Etymology.

“Pleo-” an abbreviation of , the order in which this fungus is classified; “-catenata” refers to the catenate conidia of this fungus.

Description.

Saprobic on decaying twigs in terrestrial habitats. Asexual morph: Hyphomycetous. Colonies on natural substrate effuse, dark, velvety. Conidiophores macronematous, mononematous, straight or slightly curved, cylindrical, unbranched, septate, brown or dark brown. Conidiogenous cells monotretic, integrated, terminal, cylindrical, brown to dark brown. Conidia catenate, formed in acropetal chains, straight or bent, obclavate, olivaceous to dark brown, multi-euseptate, slightly constricted at septa, distal conidia rounded at apex, truncate at base, intercalary conidia truncate at both ends, with thickened and darkened scars at base or both ends. Sexual morph: Undetermined.

Type species.

Y.R. Sun, Yong Wang bis & K.D. Hyde

Notes.

The morphology of is distinguished from members in other families in by its tretic conidiogenous cells and catenate, euseptate conidia, and phylogenic analyses indicated it does not belong to any existing families. To avoid establishing a new family with only one species, is introduced as a new genus and assigned to , genera incertae sedis. is a monotypic genus reported from terrestrial habitats but without a known sexual morph. Further discovery of other species in or phylogenetic related genera with supported monophyly will determine the familial level of .

Y.R. Sun, Yong Wang bis & K.D. Hyde sp. nov.

6151EB30-06BB-56B1-A35A-7ACD4BB5427B

Index Fungorum number:IF559458

Facesoffungi number: FoF 10631

Fig. 2

Figure 2.

(MFLU 22-0002, holotype) a host () b, c colonies on natural substrate d, e conidiophores with conidia f conidiogenous cells g–k conidia l germinated conidium m, n colonies on PDA (upper view and lower view). Scale bars: 1 mm (b); 100 μm (c); 20 μm (d–l).

The epithet referring to the location in which the fungus was collected.

Holotype.

MFLU: 22-0002

Saprobic on twigs of and . Asexual morph: Hyphomycetous. Colonies on natural substrate effuse, dark, velvety. Mycelium immersed, composed of septate, branched, hyaline to subhyaline hyphae. Conidiophores macronematous, mononematous, erect, straight or slightly curved, cylindrical, unbranched, robust, 4–6-septate, brown or dark brown, rough, 35–100 µm long, 5.5–8.5 µm wide. Conidiogenous cells monotretic, integrated, terminal, determinate, cylindrical, dark brown. Conidia catenate, formed in acropetal chains of 2–3, straight or curved, obclavate, olivaceous to brown when young, blackish brown when mature, 5–8-euseptate, slightly constricted at septa, distal conidia rounded at apex, truncate at base, intercalary conidia truncate at both ends, with thickened and darkened scars at base or both ends, 34–70 µm long, 6.5–12 µm at the widest. Sexual morph: Unknown.

Culture characteristics.

Conidia germinated on PDA within 12 hours at 26 °C. Germ tubes were produced from both ends. Colony reached 20–25 mm diameter after 4 weeks at room temperature on PDA media. Mycelia superficial, irregularly circular, entire edge, dark brown from above, black from below, pigment produced which turns the media reddish brown.

Material examined.

Thailand, Chiang Rai Province, Mae Fah Luang University, on twigs of , 3 July 2020, Y.R. Sun, MFU5 (MFLU 22-0002, holotype, ex-type living culture MFLUCC 21-0222). Thailand, Chiang Rai Province, Medicinal Plants Garden, on twigs of , 7 June 2020, Y.R. Sun, B45 (MFLU 22-0001, living culture MFLUCC 21-0223).

Two isolates collected from different hosts share similar morphology and clustered together in the phylogenic tree. There are no base pair differences in LSU and tef1-α genes between these two isolates. One base pair and two base pair differences (without gaps) are observed in ITS and , respectively. Therefore, the two isolates MFLUCC 21-0222 and MFLUCC 21-0223 are identified as conspecific.

Discussion

is phylogenetically related to , , and in our multi-gene analyses, but their monophyly was not well-supported, indicating their uncertain phylogenetic affinities. No hyphomycetous asexual morph has been reported in or (Hongsanan et al. 2020a, 2021). However, in , only two known hyphomycetous genera, and , are characterized by micronematous to semimacronematous, pale brown conidiophores, monoblastic conidiogenous cells, and single, elongate-clavate conidia (Mantle et al. 2006; Thambugala et al. 2015; Hongsanan et al. 2020a). can be distinguished from these two genera by having monotretic conidiogenous cells and catenate, obclavate conidia.

A recently introduced species, Jian Ma, X.G. Zhang & R.F. Castañeda, resembles in its unbranched, cylindrical conidiophores and monotretic, terminal conidiogenous cells that produce catenate, obclavate conidia (Xu et al. 2020). Morphologically, is more similar to than to the type species of , (Berk. & M.A. Curtis) C.T. Wei (Wei 1950). Since (, ) is a polyphyletic genus (Schoch et al. 2009; Voglmayr and Jaklitsch 2017), and there is no available sequence data for , we presume that may belong to . However, due to lack of molecular data, and since morphology-based classification is not reliable for many hyphomycetous genera (Shenoy et al. 2006; Su et al. 2016; Yang et al. 2018), we retain the current classification. Sequences of are needed to resolve its phylogenetic placement. Detailed morphological comparison among , and is provided (Table 3).

Table 3.

Comparison between , , and .

Species	Conidiophores	Conidiogenous cells	Conidia	References
Corynesporacassiicola	Unbranched, cylindrical proliferations, pale to mid brown, up to 9 septate, 110–850 × 4–11 µm	Monotretic, cylindrical, pale to mid brown	Solitary or in chains of 2–6, obclavate to cylindrical, subhyaline to pale olivaceous brown or brown, 4–20 distoseptate, 40–220 × 9–22 µm	Wei 1950
Corynesporasinensis (HJAUP M0156)	Unbranched, cylindrical, brown to dark, 4–8-septate, 53–96.5 × 7–8.5 µm	Monotretic, cylindrical, brown,	In chains of 2, primary conidia obclavate or fusiform, 3(–4)-distoseptate, 31.5–42 × 8–9.5 µm. secondary conidia ellipsoid, 3-distoseptate, 21–28.5 × 8–9.5 µm	Xu et al. 2020
Pleocatenatachiangraiensis (MFLU 21-0222)	Unbranched, cylindrical, brown or dark brown, 4–6-septate, 35–100 × 5.5–8.5 µm	Monotretic, cylindrical, dark brown	In chains of 2–3, obclavate, olivaceous to brown when young, blackish brown when mature, 5–8-euseptate, 34–70 µm × 6.5–12 µm	This study

is similar to sensu stricto, which is characterized by distinctive, unbranched conidiophores, monoblastic, determinate or proliferating conidiogenous cells, and acrogenous, solitary, transversely septate conidia (Ellis 1958, 1971; Shenoy et al. 2006; Boonmee et al. 2012; Su et al. 2016; Yang et al. 2018). However, is different from by having catenate conidia. Additionally, is phylogenetically distinct from , supporting the introduction of the new genus.

The catenate, obclavate phragmoconidia of are similar to capnodendron asexual morph of Woron (, ) (Hughes 1976, 2000; Seifert et al. 2011). Although sequence data of is not available, morphological characters, such as holoblastic conidiogenous cells and branched conidiophores of , support its separation from (Hughes 1976, 2000; Seifert et al. 2011). is also similar to Subram (, incertae sedis) in having unbranched, robust conidiophores and catenate conidia (Seifert et al. 2011). However, they differ in that the distoseptate conidia form in basipetal chains in and euseptate conidia form in acropetal chains in .