| Literature DB >> 35055083 |
Taja Jeseničnik1, Nataša Štajner1, Sebastjan Radišek2, Ajay Kumar Mishra3, Katarina Košmelj1, Urban Kunej1, Jernej Jakše1.
Abstract
Verticillium nonalfalfae (V. nonalfalfae) is one of the most problematic hop (Humulus lupulus L.) pathogens, as the highly virulent fungal pathotypes cause severe annual yield losses due to infections of entire hop fields. In recent years, the RNA interference (RNAi) mechanism has become one of the main areas of focus in plant-fungal pathogen interaction studies and has been implicated as one of the major contributors to fungal pathogenicity. MicroRNA-like RNAs (milRNAs) have been identified in several important plant pathogenic fungi; however, to date, no milRNA has been reported in the V. nonalfalfae species. In the present study, using a high-throughput sequencing approach and extensive bioinformatics analysis, a total of 156 milRNA precursors were identified in the annotated V. nonalfalfae genome, and 27 of these milRNA precursors were selected as true milRNA candidates, with appropriate microRNA hairpin secondary structures. The stem-loop RT-qPCR assay was used for milRNA validation; a total of nine V. nonalfalfae milRNAs were detected, and their expression was confirmed. The milRNA expression patterns, determined by the absolute quantification approach, imply that milRNAs play an important role in the pathogenicity of highly virulent V. nonalfalfae pathotypes. Computational analysis predicted milRNA targets in the V. nonalfalfae genome and in the host hop transcriptome, and the activity of milRNA-mediated RNAi target cleavage was subsequently confirmed for two selected endogenous fungal target gene models using the 5' RLM-RACE approach.Entities:
Keywords: RNA interference; Verticillium nonalfalfae; fungal pathogen; microRNA-like RNAs; plant-pathogen interactions
Mesh:
Substances:
Year: 2022 PMID: 35055083 PMCID: PMC8778906 DOI: 10.3390/ijms23020900
Source DB: PubMed Journal: Int J Mol Sci ISSN: 1422-0067 Impact factor: 5.923
Summary of the sequencing and distribution of sRNAs among different V. nonalfalfae samples.
| Sample | No. of All Total Sequenced Reads | No. of Unique Reads | Percent of Unique Reads [%] | No. of All rRNA/tRNA/sn-snoRNA | Percent of rRNA/tRNA/sn-snoRNA [%] |
|---|---|---|---|---|---|
| Rec_XSM | 9,700,277 | 2,526,947 | 26 | 499,837 | 5.2 |
| Rec_CD | 10,360,750 | 2,322,612 | 22 | 542,831 | 5.2 |
| Rec_conidia | 12,804,008 | 2,090,161 | 16 | 684,176 | 5.3 |
| Rec_resting | 8,359,143 | 1,161,372 | 14 | 258,592 | 3.1 |
| T2_XSM | 8,595,353 | 1,510,766 | 18 | 562,534 | 6.5 |
| T2_CD | 4,387,811 | 912,222 | 21 | 256,280 | 5.8 |
| T2_conidia | 10,468,293 | 1,572,551 | 15 | 665,576 | 6.4 |
| T2_resting | 9,055,417 | 683,765 | 8 | 271,404 | 3.0 |
Figure 1Prediction of the V. nonalfalfae precursor secondary structures; (a)—vna-miR-1, (b)—vna-miR-2, (c)—vna-miR-3, (d)—vna-miR-4, (e)—vna-miR-5, (f)—vna-miR-6, (g)—vna-miR-7, (h)—vna-miR-8 and (i)—conserved-miR-7044; the mature milRNA sequence is highlighted in yellow.
Identified and confirmed V. nonalfalfae milRNAs with the characteristics of the precursor sequence.
| Name | Length [nt] | Sequence (5′-3′) | Precursor Location | Precursor Length [nt] | MFE [kcal mol−1] | In Protein Coding Region? |
|---|---|---|---|---|---|---|
| vna-miR-1-5p | 23 | AAACGCTGATCTCCAAGTTACCT | Vna.chr3:112750..112859 | 110 | −33.3 | NO |
| vna-miR-2-5p | 22 | ACGGGTCCGGATATGCAGCTTG | Vna.chr4:1556903..1556813 | 101 | −44.3 | NO |
| vna-miR-3-5p | 18 | TGGCGCTGAGGGTGTCGA | Vna.chr1:2345083..2345190 | 108 | −40.2 | YES |
| vna-miR-4-5p | 18 | CGCGCCGCGATGCCGCCG | Vna.chr3:662853..662940 | 88 | −43.8 | YES |
| vna-miR-5-3p | 21 | TCAAGCCTGGGGCTCGCTTTG | Vna.chr4:3996299..3996386 | 88 | −41.2 | NO |
| vna-miR-6-5p | 18 | GGTCGACCTCTGGGCGCT | Vna.chr4:3834130..3834239 | 110 | −50.6 | NO |
| vna-miR-7-3p | 18 | TCCGGGATGAGGAGGAGC | Vna.chr4:933646..933736 | 91 | −40.7 | YES |
| mmu-miR-7044-5p | 18 | GGTGGTGGTGGTGGCGGC | Vna.chr3:3285001..3285047 | 110 | −61.0 | NO |
| vna-miR-8-5p | 20 | TAGGTGGCTCTGAGGCATGG | Vna.chr-un:2863075..2863184 | 110 | −39.8 | NO |
Figure 2MilRNA copy number plotted on log10 scale for each confirmed V. nonalfalfae milRNA in each of the four investigated pathotype-tissue combinations; the use of 10 for the logarithmic base allows the power of the count values to be read directly from the plot. Statistically significant differences between the samples were tested using the one-way ANOVA methodology.
Figure 3Predicted endogenous target clustering of the selected V. nonalfalfae gene models by their biological process according to enriched gene ontologies; the values represent the number of selected milRNA targets in each enriched GO annotation.
Figure 4Predicted hop target clustering of selected hop transcripts by their biological process according to enriched gene ontologies; the values represent the number of selected milRNA targets in each enriched GO annotation.
Figure 5Schematic representation of the experimentally validated cleavage sites of the target mRNAs; (a)—evm.model.chr5_1271NY.847 and (b)—evm.model.chr2_1770NN.495; the seed region of mature milRNA is highlighted in red.