| Literature DB >> 34946887 |
Andrey V Khrunin1, Gennady V Khvorykh1, Alexandra V Rozhkova1, Evgeniya A Koltsova2, Elizaveta A Petrova2, Ekaterina I Kimelfeld2, Svetlana A Limborska1.
Abstract
Although there has been great progress in understanding the genetic bases of ischemic stroke (IS), many of its aspects remain underexplored. These include the genetics of outcomes, as well as problems with the identification of real causative loci and their functional annotations. Therefore, analysis of the results obtained from animal models of brain ischemia could be helpful. We have developed a bioinformatic approach exploring single nucleotide polymorphisms (SNPs) in human orthologues of rat genes expressed differentially under conditions of induced brain ischemia. Using this approach, we identified and analyzed nine SNPs in 553 Russian individuals (331 patients with IS and 222 controls). We explored the association of SNPs with both IS outcomes and with the risk of IS. SNP rs66782529 (LGALS3) was associated with negative IS outcomes (p = 0.048). SNPs rs62278647 and rs2316710 (PTX3) were associated significantly with IS (p = 0.000029 and p = 0.0025, respectively). These correlations for rs62278647 and rs2316710 were found only in women, which suggests a sex-specific association of the PTX3 polymorphism. Thus, this research not only reveals some new genetic associations with IS and its outcomes but also shows how exploring variations in genes from a rat model of brain ischemia can be of use in searching for human genetic markers of this disorder.Entities:
Keywords: ischemic stroke; ischemic stroke outcome; rat model of brain ischemia; single nucleotide polymorphisms
Mesh:
Year: 2021 PMID: 34946887 PMCID: PMC8701352 DOI: 10.3390/genes12121938
Source DB: PubMed Journal: Genes (Basel) ISSN: 2073-4425 Impact factor: 4.096
Genomic characteristics of the polymorphisms studied, with primer and probe sequences and PCR conditions.
| rs | chr | Position (hg 19) | Alleles | Gene | Primer and Probe Sequences | Ta *, °C |
|---|---|---|---|---|---|---|
| rs62278647 | 3 | 157149133 | A/T |
| 5’-(FAM)AAACAGACTGATACATCCA(BHQ1)-3’ | 55 |
| rs2316710 | 3 | 157150180 | C/A |
| 5’-(FAM)TTTATGAACCTGGAATACA(BHQ1)-3’ | 54 |
| rs7634847 | 3 | 157159145 | C/T |
| 5’-(FAM)TTTAATCCTTATGCCAACCA(BHQ1)-3’ | 58 |
| rs1877822 | 17 | 63165077 | A/G |
| 5’-(FAM)ACTCTGCTACCTCAGTT(BHQ1)-3’ | 58 |
| rs74063268 | 12 | 13352358 | T/C |
| 5’-(FAM)TCTTCAACGTGTCTCTCT(BHQ1)-3’ | 58 |
| rs2569192 | 5 | 140015208 | C/G |
| 5’-(FAM)CTTTCTAGCAACCCTAGT(BHQ1)-3’ | 55 |
| rs66782529 | 14 | 55587867 | C/T |
| 5’-(FAM)AGTTATTTGACTCTCTGTGAC(BHQ1)-3’ | 58 |
| rs1009977 | 14 | 55603002 | T/G |
| 5’-(FAM) ACTGCCAAATATTTTATTTG(BHQ1)-3’ | 55 |
| rs1491961 | 3 | 46250348 | T/C |
| 5’-(FAM)TGGCACCCTATGCCC(BHQ1)-3’ | 62 |
* Ta—annealing temperature.
Frequency of genotypes in the groups of patients from Studies 1, 2 and 3.
| SNP | Gene | Genotype | Study 1 * |
| Study 2 * |
| Study 3 * |
| ||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|
| mRS 0–2 | mRS 3–6 | mRS 0–3 | mRS 4–6 | ΔmRS > 0 | ΔmRS < 0 | ΔmRS = 0 | ||||||
| rs62278647 |
| TT | 0.20 (23) | 0.25 (53) | 0.2375 | 0.22 (39) | 0.24 (37) | 0.6600 | 0.23 (35) | 0.22 (15) | 0.24 (26) | 0.5626 |
| AT | 0.67 (78) | 0.58 (123) | 0.63 (110) | 0.59 (91) | 0.64 (98) | 0.55 (37) | 0.61 (66) | |||||
| AA | 0.13 (15) | 0.17 (37) | 0.14 (25) | 0.17 (27) | 0.14 (21) | 0.22 (15) | 0.15 (16) | |||||
| rs2316710 |
| CC | 0.10 (12) | 0.16 (34) | 0.3577 | 0.12 (21) | 0.16 (25) | 0.3881 | 0.11 (17) | 0.21 (14) | 0.14 (15) | 0.3980 |
| CA | 0.59 (69) | 0.55 (116) | 0.56 (97) | 0.57 (88) | 0.59 (91) | 0.52 (34) | 0.56 (60) | |||||
| AA | 0.30 (35) | 0.29 (62) | 0.32 (56) | 0.27 (41) | 0.30 (46) | 0.27 (18) | 0.31 (33) | |||||
| rs7634847 |
| CC | 0.41 (48) | 0.40 (85) | 0.5256 | 0.42 (73) | 0.39 (60) | 0.5311 | 0.39 (60) | 0.42 (28) | 0.42 (45) | 0.4598 |
| CT | 0.51 (59) | 0.48 (103) | 0.49 (86) | 0.49 (76) | 0.53 (82) | 0.43 (29) | 0.47 (51) | |||||
| TT | 0.08 (9) | 0.12 (25) | 0.09 (15) | 0.12 (19) | 0.08 (12) | 0.15 (10) | 0.11 (12) | |||||
| rs1877822 |
| AA | 0.65 (75) | 0.67 (144) | 0.6443 | 0.65 (113) | 0.68 (106) | 0.7086 | 0.65 (100) | 0.61 (41) | 0.72 (78) | 0.3930 |
| GA | 0.32 (37) | 0.31 (66) | 0.33 (57) | 0.30 (46) | 0.33 (51) | 0.34 (23) | 0.27 (29) | |||||
| GG | 0.03 (4) | 0.02 (4) | 0.03 (5) | 0.02 (3) | 0.03 (4) | 0.04 (3) | 0.01 (1) | |||||
| rs74063268 |
| TT | 0.87 (101) | 0.83 (178) | 0.6348 | 0.85 (149) | 0.84 (130) | 0.9496 | 0.85 (131) | 0.84 (56) | 0.85 (92) | 0.7112 |
| CT | 0.12 (14) | 0.15 (33) | 0.14 (24) | 0.15 (23) | 0.14 (21) | 0.15 (10) | 0.15 (16) | |||||
| CC | 0.01 (1) | 0.01 (3) | 0.01 (2) | 0.01 (2) | 0.02 (3) | 0.01 (1) | 0.00 (0) | |||||
| rs2569192 |
| CC | 0.45 (52) | 0.47 (99) | 0.5947 | 0.45 (77) | 0.48 (74) | 0.5365 | 0.45 (69) | 0.44 (29) | 0.50 (53) | 0.8523 |
| CG | 0.50 (58) | 0.45 (96) | 0.50 (86) | 0.44 (68) | 0.49 (75) | 0.47 (31) | 0.45 (48) | |||||
| GG | 0.05 (6) | 0.08 (1)6 | 0.06 (10) | 0.08 (12) | 0.06 (10) | 0.09 (6) | 0.06 (6) | |||||
| rs66782529 |
| CC | 0.46 (53) | 0.51 (109) | 0.6104 | 0.44 (77) | 0.55 (85) | 0.1469 | 0.45 (70) | 0.61 (41) | 0.47 (51) | 0.0488 |
| TC | 0.45 (52) | 0.39 (84) | 0.46 (80) | 0.36 (56) | 0.44 (67) | 0.27 (18) | 0.47 (51) | |||||
| TT | 0.09 (11) | 0.09 (20) | 0.10 (17) | 0.09 (14) | 0.11 (17) | 0.12 (8) | 0.06 (6) | |||||
| rs1009977 |
| TT | 0.40 (46) | 0.36 (78) | 0.4536 | 0.33 (58) | 0.43 (66) | 0.2069 | 0.35 (55) | 0.46 (31) | 0.35 (38) | 0.5467 |
| GT | 0.42 (49) | 0.49 (105) | 0.50 (88) | 0.43 (66) | 0.48 (74) | 0.39 (26) | 0.50 (54) | |||||
| GG | 0.18 (21) | 0.14 (31) | 0.17 (29) | 0.15 (23) | 0.17 (26) | 0.15 (10) | 0.15 (16) | |||||
| rs1491961 |
| CC | 0.41 (48) | 0.46 (98) | 0.3249 | 0.42 (73) | 0.47 (73) | 0.0773 | 0.44 (68) | 0.46 (31) | 0.44 (47) | 0.9413 |
| CT | 0.51 (59) | 0.43 (92) | 0.51 (89) | 0.40 (62) | 0.47 (73) | 0.42 (28) | 0.46 (50) | |||||
| TT | 0.08 (9) | 0.11 (24) | 0.07 (13) | 0.13 (20) | 0.09 (14) | 0.12 (8) | 0.10 (11) | |||||
* Numbers in brackets are the numbers of individuals with particular genotypes.
Frequency of genotypes in the groups of patients and controls.
| SNP | Gene | Genotypes | Patients * | Controls * | Chi-Square ** | |
|---|---|---|---|---|---|---|
| rs62278647 |
| TT | 0.23 (76) | 0.28 (63) | 20.9166 | 0.000029 † |
| AT | 0.61 (201) | 0.42 (94) | ||||
| AA | 0.16 (53) | 0.29 (65) | ||||
| rs2316710 |
| CC | 0.14 (47) | 0.25 (56) | 11.99 | 0.0025 † |
| CA | 0.56 (185) | 0.45 (99) | ||||
| AA | 0.29 (97) | 0.30 (67) | ||||
| rs7634847 |
| CC | 0.40 (133) | 0.41 (92) | 5.2685 | 0.0718 |
| CT | 0.49 (162) | 0.42 (93) | ||||
| TT | 0.11 (35) | 0.17 (37) | ||||
| rs1877822 |
| AA | 0.66 (220) | 0.63 (140) | 1.08678 | 0.5808 |
| GA | 0.31 (103) | 0.33 (74) | ||||
| GG | 0.02 (8) | 0.04 (8) | ||||
| rs74063268 |
| TT | 0.85 (280) | 0.82 (181) | 2.22535 | 0.3287 |
| CT | 0.14 (47) | 0.18 (40) | ||||
| CC | 0.01 (4) | 0.00 (1) | ||||
| rs2569192 |
| CC | 0.46 (151) | 0.50 (110) | 0.698198 | 0.7053 |
| CG | 0.47 (155) | 0.45 (99) | ||||
| GG | 0.07 (22) | 0.06 (13) | ||||
| rs66782529 |
| CC | 0.49 (162) | 0.47 (104) | 0.474517 | 0.7888 |
| TC | 0.41 (136) | 0.44 (98) | ||||
| TT | 0.10 (32) | 0.09 (20) | ||||
| rs1009977 |
| TT | 0.37 (124) | 0.38 (85) | 0.26155 | 0.8774 |
| GT | 0.47 (154) | 0.47 (105) | ||||
| GG | 0.16 (53) | 0.14 (32) | ||||
| rs1491961 |
| CC | 0.44 (146) | 0.52 (115) | 4.97237 | 0.0832 |
| CT | 0.46 (152) | 0.42 (92) | ||||
| TT | 0.10 (33) | 0.06 (13) |
* Numbers in brackets are the numbers of individuals with particular genotypes; ** Genotype distribution in groups was compared by genotypic test; † Significant p-values.