Literature DB >> 34874953

1H, 13C and 15N resonance assignment of the SARS-CoV-2 full-length nsp1 protein and its mutants reveals its unique secondary structure features in solution.

Tatiana Agback1, Francisco Dominguez2, Ilya Frolov2, Elena I Frolova2, Peter Agback1.   

Abstract

Structural characterization of the SARS-CoV-2 full length nsp1 protein will be an essential tool for developing new target-directed antiviral drugs against SARS-CoV-2 and for further understanding of intra- and intermolecular interactions of this protein. As a first step in the NMR studies of the protein, we report the 1H, 13C and 15N resonance backbone assignment as well as the Cβ of the apo form of the full-lengthSARS-CoV-2 nsp1 including the folded domain together with the flaking N- and C- terminal intrinsically disordered fragments. The 19.8 kD protein was characterized by high-resolution NMR. Validation of assignment have been done by using two different mutants, H81P and K129E/D48E as well as by amino acid specific experiments. According to the obtained assignment, the secondary structure of the folded domain in solution was almost identical to its previously published X-ray structure as well as another published secondary structure obtained by NMR, but some discrepancies have been detected. In the solution SARS-CoV-2 nsp1 exhibited disordered, flexible N- and C-termini with different dynamic characteristics. The short peptide in the beginning of the disordered C-terminal domain adopted two different conformations distinguishable on the NMR time scale. We propose that the disordered and folded nsp1 domains are not fully independent units but are rather involved in intramolecular interactions. Studies of the structure and dynamics of the SARS-CoV-2 mutant in solution are on-going and will provide important insights into the molecular mechanisms underlying these interactions.

Entities:  

Mesh:

Substances:

Year:  2021        PMID: 34874953      PMCID: PMC8651119          DOI: 10.1371/journal.pone.0251834

Source DB:  PubMed          Journal:  PLoS One        ISSN: 1932-6203            Impact factor:   3.752


Introduction

Within the recent 1.5 years, the severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) has spread world-wide and devastated the economies of essentially all countries [1, 2]. To date, more than one hundred million people have contracted the disease that led to more than 3 M deaths (https://www.worldometers.info/coronavirus). Despite the enormous public health threat of this and previous CoV infections, no efficient therapeutic means have been developed against coronaviruses (CoV) before the COVID-19 pandemics. One of the major reasons for this was a lack of detailed knowledge of the mechanism of CoV replication and their interactions with host cells. SARS-CoV-2 is a member of the Betacoronavirus (β-CoV) genus along with other highly pathogenic respiratory viruses, such as SARS-CoV-1 and MERS-CoV (Middle Eastern respiratory syndrome virus). These viruses have similar genome and replication strategies but differ in their pathogenicity for humans. Similar to other β-CoVs, the SARS-CoV-2 genome (G RNA) is represented by a single-stranded RNA of positive polarity of ~30 kb in length [3-5]. It mimics the structure of cellular mRNAs in that it has a Cap and a poly(A)-tail at the 5’ and 3’ termini, respectively. Upon delivery into the cells, the G RNA is directly translated into two very long polyproteins, which are encoded by the overlapping ORF1a and ORF1b. The latter polyproteins are enzymatically processed into individual nonstructural proteins nsp1-to-16 by the encoded protease activities. These nsps represent viral components of the replication complexes and are also involved in modification of the intracellular environment to promote efficient viral replication. As in the case of other β-CoVs, the SARS-CoV-2-specific nsp1 protein plays indispensable roles in these processes [6-8]. First of all, it is a key player in downregulation of cellular translation and is a major β-CoV-specific virulence factor [6, 9, 10]. It interacts with the 40S ribosomal subunit, blocks the RNA channel and inhibits initiation of translation of cellular, but not viral, RNA templates [6, 8, 11–17]. SARS-CoV-1 and MERS nsp1 proteins are also indirectly involved in endonuclease degradation of cellular mRNAs; however, the mechanism of this function remains to be determined [18, 19]. It is still unknown whether SARS-CoV-2 nsp1 can mediate degradation of cellular RNAs. Nsp1 of both SARS-CoV-1 and SARS-CoV-2 were also implicated in inhibition of nuclear-cytoplasmic traffic, albeit by different mechanisms [20, 21]. The above activities appear to play critical roles in the downregulation of the innate immune response that can mount during SARS-CoV-2 infection, and thus, control the infection spread. Nsp1 proteins of β-CoVs also facilitate cell cycle arrest, which is clearly detectable during viral infection and nsp1 expression [9, 22]. Importantly, the previous studies demonstrated that the deletion of nsp1 gene in the genome of other β-CoVs makes them nonviable [23]. This strongly indicated the direct involvement of the latter protein in genomic RNA replication and/or synthesis of the subgenomic RNAs, which encode viral structural and accessory proteins. Interestingly, point mutations or small deletions in nsp1 can independently prevent either inhibition of cellular translation or viral replication [22-27]. Thus, the accumulated data suggest that nsp1 plays important roles in CoV replication and pathogenesis. It exhibits multiple activities and likely interacts with a variety of viral and cellular proteins and organelles. Understanding of the molecular mechanisms of these interactions is critical for development of live attenuated vaccines and therapeutic means against SARS-CoV-2 infection. Further dissection of multiple nsp1 functions in viral replication and pathogenesis requires the detailed knowledge of the dynamic structure of nsp1. To date, the data about the structure of β-CoV nsp1 remain very fragmented. This is a relatively small 19.8 kDa protein. It contains an N-terminal structured domain (amino acids 13 to 125 in SARS-CoV-2 nsp1), which was proposed to be critical for degradation of cellular mRNAs. The first 12 residues and the C-terminal fragment (residues 126–180) in SARS-Cov-2 nsp1 are predicted to be intrinsically disordered. However, the last 26 amino acid long peptide in this C-terminal fragment has been shown to fold into two short α-helixes upon binding to the 40S ribosome subunit [7, 8, 17]. The structure of the folded N-terminal domain of SARS-CoV nsp1 has been determined by NMR (PDB:2HSX), and two X-ray structures of the folded domain of SARS-CoV-2 nsp1 have been recently published (PDB:7K7P and 7K3N) [28-30]. The N-terminal nsp1 domains of both viruses have similar folds. The important difference was found to be the presence of an additional small β-strand (residues 95–97) in SARS-CoV-2-specific nsp1. No structure of the full-length proteins containing the disordered C-terminal domain is available for the nsp1 of any β-CoV. The flexibility of the disordered C- and N-terminal fragments in the SARS-CoV-2 nsp1 and their interactions with the folded domain may play the critical role(s) in protein functions. Solution NMR is the method of choice for studying such flexible regions in proteins. Most of the currently available NMR approaches and protocols are focused on elucidating the structure of either fully folded proteins (FP), which complement the crystallographic data, or the intrinsically disordered protein (IDPs). Complete backbone and side chain resonance assignment of NMR spectra of large proteins, containing both folded and disordered domains, is still a challenge due to (a) a high degree of divergence in the conformational flexibility characteristics of disordered and folded domains and (b) the reduced frequency dispersion observed in the NMR spectra in the 1H dimension for disordered regions. Recently, a near-complete backbone resonance assignment of the SARS-CoV-2 nsp1 was reported [31]. The latter protein was analysed in an acidic buffer, pH 6.5. As a first step towards characterizing the structure and dynamics of the full-length SARS-CoV-2 nsp1 in neutral buffer by NMR spectroscopy, we herein report the almost complete 1H, 13C and 15N backbone and 13Cβ side chain assignment of the wild type protein and two of its mutants: a single mutant H81P and a double mutant K129E, D48E. This assignment has been evaluated by additionally observing selectively chosen type of amino acids (MUSIC-type of experiments). To overcome ambiguities in assignment in the crowded areas of the full-length SARS-CoV-2 nsp1 spectra, we additionally compared the assigned resonances with those corresponding to the single and double mutants of nsp1. Based on this data, the secondary structure of the full-length SARS-CoV-2 nsp1 in solution was derived and, additionally, the protein flexibility was evaluated. These data provide a structural basis for further understanding of intra- and intermolecular interactions of the SARS-CoV-2 nsp1.

Material and methods

Preparation of 15N, 13C labeled SARS-CoV-2 nsp1 proteins

Nucleotide sequence of the full-length wild type nsp1 was amplified by PCR from recombinant cDNA of SARS-CoV-2 Wuhan-Hu-1 strain (NC_045512.2) using primers: NSP1-Dir CCACTGGTCTCAAGGTGGTATGGAGAGCCTTGTCCCTGG NSP1-Rev CCACACTCGAGTTATTACCCTCCGTTAAGCTCACGC. The PCR product was cloned into pE-SUMOpro-3 plasmid (LifeSensors Inc) between Bsa I and Xho I restriction sites. The synthetic gene blocks encoding mutant nsp1 were ordered from Integrated DNA Technologies and cloned into pE-SUMOpro-3 plasmid (LifeSensors Inc) between Eco RI and Xho I restriction sites. Plasmids encoding SUMO-nsp1 proteins were transformed into E. coli strain Rosetta2(DE3)pLacI (Novagen), and proteins were produced in the M9 media supplemented with 2 g/L [15N]NH4Cl (Cambridge Isotope Laboratories) and 3 g/L d-[13C6]glucose (Cambridge Isotope Laboratories). The expression was induced by 1 mM IPTG after cells reached the density of ~2 OD600. Then cells continued to grow at 37°C for 3–5 h. Freshly prepared or frozen cell pellets were lysed in Emulsiflex B15 (Avestin). The lysates were loaded on HisTrap HP column (GE Healthcare) and after extensive washing the recombinant proteins were eluted by imidazole gradient. Fractions containing SUMO-HVD nsp1 proteins were combined, and His-SUMO tag was cleaved with Upl1 protease. After cleavage, the proteins were diluted to contain 25 mM NaCl and further purified on Resource Q column (GE Healthcare). Size exclusion chromatography on a HiLoad Superdex 75 16/600 column (GE Healthcare) in NMR buffer was used as a final purification step. Fractions containing pure proteins were combined and concentrated. The protein purities and identities were confirmed by SDS-PAGE and mass spectrometry (for unlabeled protein), respectively. Final proteins contained an extra glycine at the N-terminus, which was required for SUMO cleavage. Protein concentrations were determined on 280 nm using extinction coefficients, which were determined by ProteinCalculator v3.4 (http://protcalc.sourceforge.net/).

Preparation of NMR samples

All NMR experiments were performed in a buffer containing 20 mM HEPES pH 7.5, 100 mM KCl (with or without 2.5 mM MgCl2), 1 mM NaN3, 10 (v/v) % D2O and 0.1 mM DSS (4,4-dimethyl-4-silapentane-1-sulfonic acid) as an internal 1H chemical shift standard. The protein concentration were about 0.4 mM and spectra were acquired in a 5 mm tube (final volume of 0.45mL). 13C and 15N chemical shifts were referenced indirectly to the 1H standard using a conversion factor derived from the ratio of NMR frequencies [32]. To perform 3D 13C-HSQC type experiments, the nsp1 sample was lyophilized and dissolved in D2O in a volume of 0.45 mL. To confirm that the protein’s structure was not affected by lyophilization, sample was lyophilized again, dissolved in H2O and 1D 1H spectrum was compared to the original spectrum.

NMR experiments

NMR experiments were acquired on a Bruker Avance III spectrometers operating at 14.1 T, corresponding to 600 MHz, equipped with a cryo-enhanced QCI-P probe. The assignment of the backbone and side chains resonances was based on a set of 3D TROSY or HSQC triple resonance experiments from the Bruker library. The summary of the performed experiments and the key parameters are presented in Table 1. To increase resolution in the indirect dimensions and reduce acquisition time of the 3D experiments, the iterative non-uniform sampling protocol (NUS) [33] was used in the experiments comprising: TROSY-HNCO, TROSY-HNCA and TROSY-HN(CO)CA, TROSY-HN(CA)CO, TROSY-HN(CO)CACB, TROSY HNCACB, H(CC)(CO)NH, TOCSY- 15N HSQC, HCACO and TOCSY-13C HSQC experiments. NUS points sampling schedules applied to the 3D experiments are listed in Table 1.
Table 1

List of NMR experiments and the main parameters used to perform the sequence-specific assignment of the backbone and side chain resonances of the full-length SARS-CoV-2 nsp1 protein.

ExperimentsMaximum evolution time, ms.scansNUS, pointsNUS, %time
F3F2F1
1H-15N HSQC(a) 106.5( 1 H) 164.4( 15 N) - 8 - - 2h10m
TROSY-HNCO(a) 106.5( 1 H) 12.3( 15 N) 33.1( 13 C) 4 900 30 4h51m
TROSY-HN(CA)CO(a) 106.5( 1 H) 12.3( 15 N) 21.2( 13 C) 32 576 30 1d1h
TROSY-HNCA(a) 106.5( 1 H) 12.3( 15 N) 16.5( 13 C) 8 900 30 9h40m
TROSY-HN(CO)CA(a) 106.5( 1 H) 12.3( 15 N) 16.5( 13 C) 8 900 30 19h38m
TROSY-HNCACB(a) 106.5( 1 H) 10.2( 15 N) 8.3( 13 C) 32 750 30 1d8h
TROSY-HN(CO)CACB(a) 106.5( 1 H) 10.2( 15 N) 12.4( 13 C) 32 1125 30 2d1h
3D H(CC)(CO)NH 106.5( 1 H) 10.7( 15 N) 3.3( 1 H) 16 208 25 4h39m
3D 1H–15N NOESY(a) 106.5( 1 H) 12.3( 15 N) 6.6( 1 H) 16 - - 1d20h
3D DIPSI2- 15N HSQC 106.5( 1 H) 13.1( 15 N) 9.8( 1 H) 16 902 30 20h8m
3D 1H–13C NOESY(b) 155.1( 1 H) 3.3( 13 C) 15.1( 1 H) 8 - - 1d22h
3D HCACO(b) 426.5( 1 H) 9.9( 13 C) 19.8( 13 C) 8 900 25 1d
3D MLEV17-13C HSQC(b) 155.1( 1 H) 7.4( 13 C) 15.1( 1 H) 8 2250 25 1d1h
2D CON IPAP - 169.6( 13 C) 44.7( 15 N) 32 - - 2h53m
TROSY-MUSIC(c) (S+1) 106.5( 1 H) 16.4( 15 N) - 64 - - 1h47m
TROSY-MUSIC(c)(S+1, S) 106.5( 1 H) 16.4( 15 N) - 64 - - 1h45m
TROSY-MUSIC(c)(E+1) 106.5( 1 H) 16.4( 15 N) - 128 - - 3h45m
TROSY-MUSIC(c)(E+1, E) 106.5( 1 H) 16.4( 15 N) - 128 - - 3h40m
TROSY-MUSIC(c)(A+1) 106.5( 1 H) 16.4( 15 N) - 128 - - 3h34m
TROSY-MUSIC(c)(A+1, A) 106.5( 1 H) 16.4( 15 N) - 128 - - 3h30m
TROSY-MUSIC(c)(D+1) 106.5( 1 H) 16.4( 15 N) - 64 - - 1h51m
TROSY-MUSIC(c)(D+1, D) 106.5( 1 H) 16.4( 15 N) - 64 - - 1h49m
TROSY-MUSIC(c)(N+1, Q+1) 106.5( 1 H) 16.4( 15 N) - 128 - - 3h47m
TROSY-MUSIC(c)(N+1) 106.5( 1 H) 16.4( 15 N) - 128 - - 3h45m

a Experiments were performed at two temperatures: 298 K and 308 K.

b Experiments were performed with samples in D2O.

c Parameters and pulse sequences of the TROSY type MUSIC with semi constant time in indirect dimension were previously described in [39].

a Experiments were performed at two temperatures: 298 K and 308 K. b Experiments were performed with samples in D2O. c Parameters and pulse sequences of the TROSY type MUSIC with semi constant time in indirect dimension were previously described in [39]. To assign Hα proton resonances and for assessment of NOE contacts, additional NOESY 15N-HSQC, NOESY-13C- HSQC [34-36] spectra were collected. The quality of the spectra allowed for assignment of the Hα protons and made HACACO experiment superfluous. To verify assignment of the amino acids located in the disordered fragments of SARS-CoV-2 nsp1, 13C observed CON experiment with IPAP scheme for virtual decoupling [37, 38] was used to correlate 15N with 13C’ resonances. We also performed TROSY type MUSIC experiments with semi-constant time acquisition period in the indirect dimension to identify different type of amino acids such as Ser, Glu, Ala, Asp, Gln, Asn and their respective n+1 residues. Key parameters of the experiments used in this study are presented in Table 1. All TROSY-type MUSIC pulse sequences and the setting details have been fully described elsewhere [39]. Due to the differences in the relaxation characteristics of the folded domain and the disordered fragments of SARS-CoV-2 nsp1, several experiments were performed at two temperatures: 298 K and 308 K. Data were processed by Topspin 4.0.6 (Bruker) using linear prediction and assigned using CcpNmr Analysis 2.4.2 [40]. The chemical shifts of the full-length SARS-CoV-2 nsp1 were analyzed with TALOS-N software [41]. As input for TALOS-N analysis, the experimentally derived chemical shifts of 1HN, 15N, 13Cα, 13Cβ, 13C´ and 1Hα nuclei for every amino acid were used. In case of absence of chemical shifts, TALOS-N uses a database of sequences to predict the secondary structure [41]. The secondary X-ray-based structures were extracted with the UCSF Chimera program [42] using the PDB entry: 7K7P [30]. In the text and figures, the standard nomenclature for amino acids of the carbon atoms was used, where 13Cα is the carbon next to the carbonyl group 13C´ and 13Cβ is the carbon next to 13Cα [43].

Result and discussion

Assignment protocol

The validity of the secondary structure analysis based on chemical shifts (CS) depends not only on the knowledge of CS of the 1HN, 15N, 13Cα, 13Cβ, 13C´ nuclei but also on 1Hα assigned resonances. Thus, we used the fully protonated 15N,13C-labelled SARS-CoV-2 nsp1. Additionally, this provides a foundation for validating inter β-strands interactions in the folded domain of the protein through observation of NOE contacts between 1HN-1HN or Hα- 1HN protons [44]. Recently, it was reported [31] that the secondary structure of the full-length SARS-CoV-2 nsp1 protein (Fig 1A) at pH 6.5 embraces one folded domain (residues 14–125) and two disordered chains, flanking the folded domain at the N-terminus (residues 1–13) and the C-terminus (residues 126–180).
Fig 1

1H-15N HSQC spectra at T = 308K of the full-length SARS-CoV-2 nsp1 protein with TROSY MUSIC experiments.

Superpositions of the 1H-15N HSQC spectra of the full-length SARS-CoV-2 nsp1 protein (grey) (at 308 K) with TROSY MUSIC experiments. (A) Blue colour indicates D + 1, and red indicates D and D+1 cross peaks; (B) blue colour indicates E + 1, and red shows E and E + 1cross peaks; (C) blue colour shows A + 1, and red indicates A and A +1 cross peaks; (D) blue colour shows S + 1, and red indicates S and S + 1 cross peaks. The assignment of the observed cross peaks was done according to the amino acid sequence shown in Fig 2A.

1H-15N HSQC spectra at T = 308K of the full-length SARS-CoV-2 nsp1 protein with TROSY MUSIC experiments.

Superpositions of the 1H-15N HSQC spectra of the full-length SARS-CoV-2 nsp1 protein (grey) (at 308 K) with TROSY MUSIC experiments. (A) Blue colour indicates D + 1, and red indicates D and D+1 cross peaks; (B) blue colour indicates E + 1, and red shows E and E + 1cross peaks; (C) blue colour shows A + 1, and red indicates A and A +1 cross peaks; (D) blue colour shows S + 1, and red indicates S and S + 1 cross peaks. The assignment of the observed cross peaks was done according to the amino acid sequence shown in Fig 2A.
Fig 2

1H-15N HSQC spectra of the full-length SARS-CoV-2 nsp1 protein at T = 308K with backbone amide assignments.

(A) Amino acid sequence of the full-length SARS-CoV-2 nsp1 protein. The folded domain is indicated in blue. (B) 1H-15N HSQC spectrum with its extended crowded part (C) of the full-length 15N, 13C-labelled SARS-CoV-2 nsp1 protein in the buffer containing 20 mM HEPES pH 7.5, 100 mM KCl, 2.5 mM MgCl2, 1 mM TCEP, 1 mM NaN3, 10 (v/v) % D2O and 0.1 mM DSS. The chemical shift assignment of NH backbone is shown by the number and letters corresponding to the amino acid sequence shown in panel (A). The assignment is presented only for the residues whose cross peaks were observed at 308 K.

It is known that folded and intrinsically disordered proteins (IDP) entities, have differences in relaxation properties and, thus, require different optimal NMR experimental conditions. This also means that the positions of the amide 1H and 15N chemical shifts of the disordered fragments and some flexible parts of the folded domains strongly depend on the buffer conditions including pH and temperature. Lower temperatures generally favor IDPs by reducing amide proton exchange while higher temperatures favor folded proteins due to reduced T2 relaxation. Keeping this in mind, we performed all NMR data collections at two temperature, 298 K and 308 K. This was proved to be sufficient for generating an almost complete assignment of the protein. Thus, we achieved the maximum NMR performances for the folded domain at 308 K and for the disordered fragments at 298 K. We also performed all assignments at physiological buffer (pH 7.5), and low salt concentration, and in the absence or presence of 2.5 mM MgCl2. These conditions are optimal for future analysis of nsp1 interaction with 40S ribosome subunit or RNA, where the presence of Mg2+ could be expected. No differences in the spectra were observed in the presence or absence of MgCl2. All data presented are from the spectra with MgCl2. As there are no programs readily available for performing automatic assignment of a protein containing both folded and disordered regions, we use the conventional manual assignment strategy based on experiments presented in Table 1. To achieve the best resolution in the 3D experiments in the indirect dimensions and to resolve resonances corresponding to the disordered part of protein, NMR experiments were mostly performed with the NUS option [33]. To facilitate the assignment procedure in this study, we chose the following strategy. First, amino acid selective TROSY- MUSIC experiments on full length wild type 15N,13C labelled SARS-CoV-2 nsp1 at 308 K were performed. Fig 1 presents the superposition of the 1H-15N HSQC of SARS-CoV-2 nsp1 protein (shown in grey) with TROSY-MUSIC spectra of selected D + 1, D, E + 1, A + 1, A, S + 1 and S cross peaks of amino acids. As we have described earlier [39], these type of experiments mostly benefits the analysis of IDPs. Indeed, the TROSY-MUSIC spectra of SARS-CoV-2 nsp1 presented in (Fig 1A and 1B) show all D + 1, D, E + 1, E cross peaks from the disordered fragments, but not from the folded domain, and thus, allow easy assignment. However, TROSY-MUSIC with A + 1, A, S + 1 selection showed almost all expected correlations for their respective types of amino acid throughout the entire sequence of the nsp1 protein. The exceptions were the amide protons involved in slow conformational exchange, whose cross peaks in the 1H-15N HSQC spectrum were broadened below the detection limit. These data were used to assign the resonances at 308 K. The 1H-15N-HSQC spectrum at 308K shows well-dispersed and narrow-line widths of the amide signals (Fig 2B and 2C). At this temperature, we have observed and assigned 158 residues, including prolines. Importantly, even at this higher temperature (308 K), amino acids 125K, 124R, 123L and 122L show two sets of amide 1HN - 15N cross peaks, which allowed us to conclude that the amino acids between the folded domain and the C-terminal disordered part of SARS-CoV-2 nsp1 protein adopt two distinguishable conformations detectable in the NMR time scale.

1H-15N HSQC spectra of the full-length SARS-CoV-2 nsp1 protein at T = 308K with backbone amide assignments.

(A) Amino acid sequence of the full-length SARS-CoV-2 nsp1 protein. The folded domain is indicated in blue. (B) 1H-15N HSQC spectrum with its extended crowded part (C) of the full-length 15N, 13C-labelled SARS-CoV-2 nsp1 protein in the buffer containing 20 mM HEPES pH 7.5, 100 mM KCl, 2.5 mM MgCl2, 1 mM TCEP, 1 mM NaN3, 10 (v/v) % D2O and 0.1 mM DSS. The chemical shift assignment of NH backbone is shown by the number and letters corresponding to the amino acid sequence shown in panel (A). The assignment is presented only for the residues whose cross peaks were observed at 308 K. Next, we examined the broadening of some of the NH backbone resonances below the detection limit at 308 K. To perform this analysis and additionally validate resonances, which were ambiguously assigned due to the crowdedness of the spectra, we used NMR data of two SARS-CoV-2 nsp1 protein mutants. The selection of mutants was based on the following criteria: (1) the replacement of chosen amino acid should not lead to any strong conformational transition in the protein and (2) preferably large chemical shift perturbation (CSP) should be expected in the place of the substituted amino acid. We have analysed NMR data of 2 mutants. In the first, a single histidine in position 81 was replaced by proline (H81P). According to the X-ray structure (PDB: 7K7P), the aromatic ring of H81 is located in a flexible loop and turned towards the solvent. Thus, its replacement should not lead to any significant change in the architecture of the secondary structure of SARS-CoV-2 nsp1 protein. Moreover, the replacement by proline was expected to induce a large perturbation of chemical shifts (CS) of the nuclei located in its proximity due to its unique structure and possibly enhance the stability of the loop. As it is shown in Fig 3D, the CSP observed in 1H-15N HSQC spectra of wild type nsp1 vs the H81P mutant (red bars) are evident. As expected, the most significant CSPs were observed between residues 75 and 85. Noteworthy, the amino acids of the N-termini (10–17) and at the beginning of the C-terminal disordered fragment (residues 120–127) are affected as well. This finding led us to the conclusion that amino acids corresponding to those three regions are in close proximity.
Fig 3

Secondary structure and order parameters of the full-length SARS-CoV-2 nsp1 protein.

(A) The secondary structure derived from the X-ray data of the folded domain of SARS-CoV-2 nsp1 (residues 10–124, PDB: 7K7P) according to UCSF Chimera [42]. The yellow lines show loop segments of the protein. (B) Index of secondary structure prediction (S.S. Prediction) (red and blue bars indicate α-helices and β-strands, respectively. (C) Model-free [45] order parameter, S2, [46] extracted by TALOS-N [41]. (D) Chemical shift deviations of Δ1H and Δ15N nuclei (ppm), obtained as distances , between wild type SARS-CoV-2 nsp1 protein and nsp1(H81P) (red) or nsp1(K129E, D48E) (blue) mutants. Amino acids which did not contribute to the TALOS-N analysis are shown by short black bars in the green box on top of panel (B).

Secondary structure and order parameters of the full-length SARS-CoV-2 nsp1 protein.

(A) The secondary structure derived from the X-ray data of the folded domain of SARS-CoV-2 nsp1 (residues 10–124, PDB: 7K7P) according to UCSF Chimera [42]. The yellow lines show loop segments of the protein. (B) Index of secondary structure prediction (S.S. Prediction) (red and blue bars indicate α-helices and β-strands, respectively. (C) Model-free [45] order parameter, S2, [46] extracted by TALOS-N [41]. (D) Chemical shift deviations of Δ1H and Δ15N nuclei (ppm), obtained as distances , between wild type SARS-CoV-2 nsp1 protein and nsp1(H81P) (red) or nsp1(K129E, D48E) (blue) mutants. Amino acids which did not contribute to the TALOS-N analysis are shown by short black bars in the green box on top of panel (B). In the second mutant, we introduced two aa substitutions: Lys129 and Asp48 were replaced by Gln (K129E and D48E). The first mutation is in the beginning of the disordered fragment of SARS-CoV-2 nsp1. The second mutation, according to the X-ray structure (PDB: 7K7P), is located at the end of the α-helix. In Fig 3D, the CSPs observed in 1H-15N HSQC spectra of wild type nsp1 vs the double mutant are presented by blue bars. Significant CSPs were observed for residues 44–51 and 125–132. The strategy of inducing chemical shift changes in particular regions of the protein by carefully selected replacements of structurally insensitive amino acids was very valuable and helped us to resolve some ambiguities in the backbone and side chain assignments. More detailed characterisation of the SARS-CoV-2 nsp1 mutants will be published elsewhere. The resulting assignment of the full length of SARS-CoV-2 nsp1 was as following. For the folded domain (residues 14–125) we assigned 95% 1HN and 95% 15N including prolines, 96% of 13Cα, 88% of 13Cβ, 94% of 13C´and 83% of all Hα. For the two disordered fragments (residues 1–13 and 126–180) we assigned 91% 1HN, 91% 15N, 94% of 13Cα, 93% of 13Cβ, 94% of 13C´ and 76% of all Hα. Comparison of NMR spectra acquired in different conditions in this and published [31] work revealed only small changes for folded, dynamically stable nsp1 domain. In that study, the authors have assigned more of the amide resonances, and this is not surprising considering their lower pH experimental conditions. However, in our assignment, there are some residues that were previously missed: Q63, E102 and T103. Only one residue shows significant difference: N126. The resonances corresponding to the loops and the disordered regions of the protein were more likely to be affected by changes in temperature and pH, but they do not indicate any profound structural difference. Residues showing chemical shift differences larger than 0.2 are: A42, H45, C51, V111, N126, S135 and S166. Differences between 0.1 and 0.2 were observed for: D48, G49, G52, V56, E57, V60, L61, R77, H83, V108, H110, E113 and I114. The differences were calculated using: . All 1H, 15N and 13C chemical shifts of the full-length of SARS-CoV-2 nsp1 protein at pH 7.5 and at two temperatures, 298 K and 308 K, have been deposited in BioMagResBank (http://www.bmrb.wisc.edu) under the accession 50915. The chemical shifts for the earlier published work have been taken from BioMagResBank accession 50620 (31).

Secondary structure of the SARS-CoV-2 nsp1 protein

The full-length SARS-CoV-2 nsp1 protein chemical shifts were analyzed with TALOS-N, and the data are presented in Fig 3B and 3C. The chemical shifts of the main peaks were used in the cases where dual peaks were observed. The analysis of the secondary structures of the folded domain of the SARS-CoV-2 nsp1, which was derived from the NMR data, and the previously determined crystal structure (7K7P) shows that they are almost identical. This additionally validated our assignment (Fig 3A and 3B). The secondary structure of the earlier assigned SARS-CoV-2 nsp1 and that determined in our study are also similar. Nevertheless, a few important inconsistencies are evident. The crystal structure of SARS-CoV-2 nsp1 folded domain [28-30] revealed the presence of an additional short β5-strand (residues 95–97), which is not found in the structure of SARS-CoV nsp1 determined by NMR (PDB: 2HSX). In our study of the full-length nsp1, the presence of β5-strand folded between residues 95 and 97 could not be confirmed, neither was it found in the NMR assignment by Wang et al (31). Moreover, according to the predicted order parameter [S2 by TALOS-N (Fig 3C)], the segment between residues 92–103 is dynamic. This prediction is in agreement with our finding that amide protons between residues I95 and G98 were not observed at both 308 K and 298 K, suggesting their involvement in multiple conformational exchange and exposure to the solvent. We additionally performed the analysis of the 3D NOESY 15N -HSQC spectrum to determine dipole-dipole contacts of NH-NH and NH-Hα protons, which allows the detection of hydrogen bonds between two β-strands [44]. The β-sheet formed by strands β4 and β3, according to the X-ray structure, was confirmed by observing NH-NH and NH-Hα NOEs between those strands, but not between the β4 and β5 strands. These data contradict the X-ray results, which suggest low mobility of the β5 strand due to the additional hydrogen bonds between the β4 and β5 strands. Subtle differences between the X-ray and NMR secondary structures were also noticed for the strands β1, β2, β6 and β7. According to our NMR data, in solution, these strands are extended by one or two amino acids at their C-termini. Furthermore, the α-helix 2 in solution is one amino acid shorter than in the X-ray structure. Our data also predicted that the α-helix has a break at residue H45. The X-ray structure also shows two short 3–10 helices between amino acids 22 to 26 and 60 to 64, respectively (helix 1 and 3). The TALOS-N analysis of our chemical shifts detected the first helix, albeit shorter (residues 23 to 25), but not the second one. One should note that TALOS-N does not differentiate between α and 3–10 helices but classifies both types as helices [41]. A perusal of possible NOE cross peaks of the two regions shows some indication of helix formation in the first region, but none in the second. In conclusion, we observed a short helix corresponding to α1, but did not observe α3. This is the same result as in the previous assignment of nsp1 at pH 6.5 published by Wang et al (31). Instead, our chemical shifts suggest the presence of a long, disordered loop between residues 55 and 67, which, according to the TALOS-N prediction, has restricted mobility (Fig 3B and 3C). Importantly, this region of the SARS-CoV-2 nsp1 sequence was well characterised by NMR through chemical shifts as well as by NOE of NH-NH and NH-Hα proton contacts. This led us to conclude that these discrepancies between NMR and X-ray secondary structure predictions likely result from the crystallisation conditions. Interestingly, Wang et al suggests the possibility of a short helix consisting of residues 171–175 albeit with lower probability than those of other helices in the protein (31). Our data does not support this. This could be an effect of the differences in pH between our studies. Two more dynamic regions in the solution structure of the folded domain of SARS-CoV-2 were identified based on the S2 order parameter predicted by TALOS-N: S74-H83 and L92-E102 (Fig 3B and 3C). This prediction is in line with the lack of peaks or broadened 15N/ 1HN cross peaks, even at 298 K in the 1H-15N NMR spectra. We did not observe resonances for H81 and G82 in the first region nor for S100 and G101 in the second one. It can be explained either by broadening of the HSQC cross peaks below detection limit or, more likely, by the involvement of these regions in slow conformational exchange. This was observed in the earlier NMR assignment of nsp1 as well. In that study resonances of E93, Q96, E102 and T103 could not be assigned (31). The N- and C-termini, comprising amino acids M1-N9 and N124-G180, respectively, were identified by CSI as fully unstructured, but showing differences in the predicted order parameters (S2) throughout the sequences. Dynamic regions with an order parameter S2 below 0.6 were predicted for M1-F8, S135-Q158 and H165-G180. The increase in dynamic behaviour of those residues correlated with the changes in the intensities of the amide backbone cross peaks in the 1H-15N HSQC spectra of nsp1. These cross peaks have higher intensity compared to cross peaks belonging to the amino acids in folded, less dynamic regions. Other residues in the unstructured regions are less dynamic. For the H81P mutant, we see chemical shift changes for residues 10–17 and 120–127 belonging to the junctions between structured/unstructured regions (Fig 3D). Based on these data, we propose that in the full-length SARS-CoV-2 nsp1, the folded and disordered parts of the protein behave not as fully independent units but are rather involved in intramolecular interactions. This has also been suggested by Wang et al, who hypothesised that the unstructured C-terminal region interacts with the folded region (31). This may stabilize the overall protein fold and improve its solubility. The second set of chemical shifts of the residues having a double set of signals, amino acids 122–125, was also analysed by TALOS-N combined with the other chemical shifts of residues with single cross peaks, but no significant change from the main set could be observed. This was expected as the chemical shift differences are small between the sets. Comparing the calculated S2 values of this region between our data and those obtained by Wang et al reveals some differences. In our study, the S2 stays above 0.75 for all residues involved but, in their case, the S2 drops below 0.75 for the last two residues and continues to drop in the following residues to levels typical for unstructured domains (31). In our case, the S2 drops to the level of unstructured domains only after G133. As mentioned above, we suggest that residues 120–127 may be involved in interaction(s) with the folded domain, probably with the dynamic loop between residues 74–83. It is reasonable to speculate that this difference between the two NMR assignments is the result of using different pH and salt concentration. It is tempting to further speculate that this interaction may result in multiple protein conformations involving the C-terminal unstructured domain and that this might explain the multiple functions of nsp1 in viral replication and virus-host interactions. It is in our plans to further investigate this phenomenon possibly by some mutations in the 120–127 region. In conclusion, the near complete 15N/13C/1H backbone resonance and part of side chain assignment of the full-length SARS-CoV-2 nsp1 at pH 7.5 and physiological salt concentration has been performed. Validation of assignment have been done by using two different nsp1 mutants as well as MUSIC type amino acid selective experiments. Assignment revealed that the secondary structure of the rigid folded domain is almost identical to that determined by X-ray. However, the existence of the short β-strand (residues 95 to 97), which is considered to be the significant structural difference between SARS-CoV-1 and SARS-CoV-2 nsp1 proteins, has not been confirmed. In solution, SARS-CoV-2 nsp1exhibits disordered, flexible N- and C-termini, having different dynamics. The short peptide in the beginning of the C-terminal disordered fragment (122–125) adopts two conformations. We propose that there are intramolecular interactions between the disordered and folded nsp1 domains, most likely involving the region two conformations. Studies of the structure and dynamics of the SARS-CoV-2 mutants in solution are on-going and will provide important insights on the molecular bases underlying these interactions. Further mutations and interactions with RNA and other proteins are under way as well. 10 Jun 2021 PONE-D-21-14234 1H, 13C and 15N resonance assignment of the SARS-CoV-2 full-length nsp1 protein and its mutants reveals its unique secondary structure features in solution. PLOS ONE Dear Dr. Agback, Thank you for submitting your manuscript to PLOS ONE. After careful consideration, we feel that it has merit but does not fully meet PLOS ONE’s publication criteria as it currently stands. Therefore, we invite you to submit a revised version of the manuscript that addresses the points raised during the review process. Please be aware that both reviewers raised a significant number of concerns that should be completely addressed in a revised version of the manuscript, which will likely undergo a second round of review. Of particular importance is to clarify the novelty of the work, in relation to previous publications. Please submit your revised manuscript by Jul 25 2021 11:59PM. If you will need more time than this to complete your revisions, please reply to this message or contact the journal office at plosone@plos.org. When you're ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file. Please include the following items when submitting your revised manuscript: A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). You should upload this letter as a separate file labeled 'Response to Reviewers'. A marked-up copy of your manuscript that highlights changes made to the original version. You should upload this as a separate file labeled 'Revised Manuscript with Track Changes'. An unmarked version of your revised paper without tracked changes. You should upload this as a separate file labeled 'Manuscript'. If you would like to make changes to your financial disclosure, please include your updated statement in your cover letter. Guidelines for resubmitting your figure files are available below the reviewer comments at the end of this letter. If applicable, we recommend that you deposit your laboratory protocols in protocols.io to enhance the reproducibility of your results. Protocols.io assigns your protocol its own identifier (DOI) so that it can be cited independently in the future. For instructions see: http://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocols. Additionally, PLOS ONE offers an option for publishing peer-reviewed Lab Protocol articles, which describe protocols hosted on protocols.io. Read more information on sharing protocols at https://plos.org/protocols?utm_medium=editorial-email&utm_source=authorletters&utm_campaign=protocols. We look forward to receiving your revised manuscript. Kind regards, Oscar Millet Academic Editor PLOS ONE Journal Requirements: When submitting your revision, we need you to address these additional requirements. 1. Please ensure that your manuscript meets PLOS ONE's style requirements, including those for file naming. The PLOS ONE style templates can be found at https://journals.plos.org/plosone/s/file?id=wjVg/PLOSOne_formatting_sample_main_body.pdf and https://journals.plos.org/plosone/s/file?id=ba62/PLOSOne_formatting_sample_title_authors_affiliations.pdf 2. We note that you have indicated that data from this study are available upon request. PLOS only allows data to be available upon request if there are legal or ethical restrictions on sharing data publicly. For more information on unacceptable data access restrictions, please see http://journals.plos.org/plosone/s/data-availability#loc-unacceptable-data-access-restrictions. In your revised cover letter, please address the following prompts: a) If there are ethical or legal restrictions on sharing a de-identified data set, please explain them in detail (e.g., data contain potentially sensitive information, data are owned by a third-party organization, etc.) and who has imposed them (e.g., an ethics committee). Please also provide contact information for a data access committee, ethics committee, or other institutional body to which data requests may be sent. b) If there are no restrictions, please upload the minimal anonymized data set necessary to replicate your study findings as either Supporting Information files or to a stable, public repository and provide us with the relevant URLs, DOIs, or accession numbers. For a list of acceptable repositories, please see http://journals.plos.org/plosone/s/data-availability#loc-recommended-repositories. We will update your Data Availability statement on your behalf to reflect the information you provide. 3. We note that Figure 1 and Figure 2 in your submission contain copyrighted images. All PLOS content is published under the Creative Commons Attribution License (CC BY 4.0), which means that the manuscript, images, and Supporting Information files will be freely available online, and any third party is permitted to access, download, copy, distribute, and use these materials in any way, even commercially, with proper attribution. For more information, see our copyright guidelines: http://journals.plos.org/plosone/s/licenses-and-copyright. We require you to either (1) present written permission from the copyright holder to publish these figures specifically under the CC BY 4.0 license, or (2) remove the figures from your submission: a. You may seek permission from the original copyright holder of Figure 1 and Figure 2 to publish the content specifically under the CC BY 4.0 license. We recommend that you contact the original copyright holder with the Content Permission Form (http://journals.plos.org/plosone/s/file?id=7c09/content-permission-form.pdf) and the following text: “I request permission for the open-access journal PLOS ONE to publish XXX under the Creative Commons Attribution License (CCAL) CC BY 4.0 (http://creativecommons.org/licenses/by/4.0/). Please be aware that this license allows unrestricted use and distribution, even commercially, by third parties. Please reply and provide explicit written permission to publish XXX under a CC BY license and complete the attached form.” Please upload the completed Content Permission Form or other proof of granted permissions as an "Other" file with your submission. In the figure caption of the copyrighted figure, please include the following text: “Reprinted from [ref] under a CC BY license, with permission from [name of publisher], original copyright [original copyright year].” b. If you are unable to obtain permission from the original copyright holder to publish these figures under the CC BY 4.0 license or if the copyright holder’s requirements are incompatible with the CC BY 4.0 license, please either i) remove the figure or ii) supply a replacement figure that complies with the CC BY 4.0 license. Please check copyright information on all replacement figures and update the figure caption with source information. If applicable, please specify in the figure caption text when a figure is similar but not identical to the original image and is therefore for illustrative purposes only. Additional Editor Comments (if provided): [Note: HTML markup is below. Please do not edit.] Reviewers' comments: Reviewer's Responses to Questions Comments to the Author 1. Is the manuscript technically sound, and do the data support the conclusions? The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented. Reviewer #1: Yes Reviewer #2: Yes ********** 2. Has the statistical analysis been performed appropriately and rigorously? Reviewer #1: Yes Reviewer #2: N/A ********** 3. Have the authors made all data underlying the findings in their manuscript fully available? The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified. Reviewer #1: Yes Reviewer #2: Yes ********** 4. Is the manuscript presented in an intelligible fashion and written in standard English? PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here. Reviewer #1: Yes Reviewer #2: No ********** 5. Review Comments to the Author Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters) Reviewer #1: The manuscript describes the NMR chemical shfit assignment of the nsp1 protein from SARS-CoV-2. Unfortuneatly, it is the second report of this NMR resonance assignment. The authors rightly reference the previous work, but the differences e.g. construct design is not being discussed. The authors do not compare their chemical shift assignment with the previously published data. The authors here also investigate mutants of nsp1, but the differences e.g in the dynamics of "wildtype" and mutant protein are not presented. At this point, I cannot recommend publication of this work. Reviewer #2: The submitted manuscript presents a far-reaching NMR analysis of the SARS-CoV-2 Nsp-1 protein, using both wild-type and two mutant proteins, and at two temperatures. For this, the authors employ a very complete and high-level set of NMR experiments, going beyond the standard protocol and addressing (by MUSIC type experiments) the specific needs for proteins with large unstructured regions (as in Nsp-1). Thus, the work deserves publication for its sound technical implementation and for the high relevance of the targeted protein. However, the manuscript requires a minor-to-mayor overhaul for the reasons listed below, where especially one critical prior work (correctly cited as ref. 31) must be considered more thoroughly. Of note, while this prior work formally limits the novelty of the presented manuscript, this does not constitute a valid reason for rejection in my eyes - rather, I "merely" request a more detailed comparison (stressing the agreements and working out the minor differences) to consolidate, deepen, and extend our understanding of this functionally important protein. General requests: - I recommend that a native English speaker revises the manuscript as it contains awkward wording in several larger parts of the text (e.g., legend of Fig. 1, text paragraphs l. 211-217, l. 269-272, 320-324, 334-336) that strongly compromises readability. - The cited reference [31] reports critical prior work and must be considered in more detail. Thus, the authors should work out more clearly, and wherever relevant in the manuscript, the main differences and agreements between their new work and ref. [31]. For instance: For which further residues were the authors able to provide a NMR characterisation? Why do the authors find slightly different residue segments for the unstructured N- and C-terminal and for the structure central regions? Why could the authors not confirm the short C-terminal helix H3? Could such differences be due to their use of an older version of TALOS (TALOS+ instead of TALOS-N), or to the slightly different experimental conditions (pH, temperature, etc.)? Specific requests: - Table 1 (NMR parameters): Since recorded FID resolution is the inverse of the maximal sampling time (i.e., FID resolution = 1/AQ, which should be stated clearly in the caption to column 2), very low F1 and F2 resolutions follow from the listed data and I wonder whether there might be a systematic error (factor 2?) in these numbers? For instance, the listed 12.3 ms for 15N result in only 81 Hz = 1.35 ppm resolution. Such low resolution makes little sense especially for intrinsically disordered proteins/regions (as present in Nsp-1). Moreover, it invalidates both resolution enhancing NMR methods adopted by the autors, i.e. non-uniform sampling (NUS) and semi-constant t1(15N) evolution. Already constant-time evolution of 1J(NCO) = 15 Hz or 1J(NCA) = 9-12 Hz demands transfer delays at least twice as long as the cited 12.3 ms (i.e., up to 30 ms), and semi-constant time evolution would require even longer delays. Please clarify this obvious contradiction. I also suggest to add a further column to Table 1 listing the pertaining total measurement time for each experiment. - L. 134: state that 14.1 T correspond to 600 MHz for 1H to enable conversion of resolution, from Hz to ppm (as required to convert the maximal evolution times into recorded FID resolutions, see my notes on Table 1 above). - L. 175/176: It is stated that folded and disordered regions show distinct NMR relaxation properties exacting distinct optimal “NMR experimental conditions”. This should be better elaborated. For instance: lower temperatures favour NMR on IDP due to reduced HN/H2O exchange while higher T favour folded regions due to reduced T2 relaxation. Mention further NMR parameters like transfer and interscan delays that also differ – how was this implemented or considered? - Terminology: “DIPSI2-N-HSQC” and “MLEV17-C-HSQC” (line 141) are unconventional names (taken directly from the BRUKER pulse program library?) – better use the standard NMR experiment name = TOCSY-HSQC (or was it a HSQC-TOCSY?). Also, in line 143, I suppose the authors meant to say “NOESY-HSQC” (or HSQC-NOESY)? - L.143: HA assignment should, in principle, follow directly from a combination of HACACO with HNCO and HN(CO)CA spectra, making the acquisition of both NOESY-HSQC meaningless and superfluous for this purpose. I suppose, however, that these latter spectra were rather recorded with the objective to search for structure indication? If so, please indicate! - The optional addition of MgCl2 (2.5 mM) is unclear to me and should be explained. How did it affect the NMR spectra? - The abbreviation “aa” should be avoided and spelled out: “amino acid”, or “residue” - The short helix a3 appears to be missing in the NMR structure, but shows indication of restricted mobility (lines 309 – 312). As a matter of fact, the X-ray structure rather reports a short 3-10 (instead of canonical alpha) helix here. Thus, have the authors considered the possible presence of a 3-10 helix? What secondary structure does the CSI for the HA nuclei suggest (considering that helicity indicated only by HA may suggest a 3-10 helix)? - Terminology: While technically correct, the term “cross peak” for an HSQC signal appears very confusing as it is conventionally reserved to NOE cross peaks. This may give rise to confusions, for instance, when reading through lines 328-330 where the disordered regions of Nsp-1 are discussed, but where no (NOE) cross signals are expected. - This confusion is accentuated by the subsequent conclusion of the authors (lines 330-332, and section “Conclusion”) that folded and unfolded regions in Nsp-1 would show some kind of intramolecular interactions. As it stands, this conclusion is not substantiated enough (although the prior work – ref. 31 – also suggested this from the notable solubility enhancement of the C-terminus on the folded domain). - I was intrigued by the finding of a double set of signals for residues 122-125 (line 221). Then, however, I wonder which of both signal shifts (for each residue) was used for the secondary structure analysis shown in Fig. 3b, and how the predicted secondary structuredness differs for both sets of shifts? This should be clarified and the alternative signal shifts should be reported more clearly – ideally, by inclusion into Fig. 3b (e.g., as a second set of coloured bars). Apparently, there is someconformational dynamics towards the C-terminus of strand b7: could this possibly be related to a “kink” in this strand, near V121? The competing work in ref.[ 31] also mentions such conformational heterogeneity (without further specifying the residues) and suggests a possible role of cis/trans isomerism at a proline residue (again, without specifying the residue number, but possibly referring to P115). Interestingly also, the RCI-S2 order parameters derived by the authors and in ref. [31] differ more strongly in exactly this region (res. 120 – 130), where the authors derive a significantly higher rigidity than reported in [31]. I would greatly welcome if the authors provided more details and some deeper discussion of this interesting observation of conformational exchange exactly in the transition region between folded and unfolded (C-terminal) regions, as this might even have a relevance for the known “switch” in Nsp-1 function (from host translation inhibition to viral translation initiation). ********** 6. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files. If you choose “no”, your identity will remain anonymous but your review may still be made public. Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy. Reviewer #1: No Reviewer #2: Yes: Tammo Diercks [NOTE: If reviewer comments were submitted as an attachment file, they will be attached to this email and accessible via the submission site. Please log into your account, locate the manuscript record, and check for the action link "View Attachments". If this link does not appear, there are no attachment files.] While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com/. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Registration is free. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email PLOS at figures@plos.org. Please note that Supporting Information files do not need this step. 17 Sep 2021 Here are our answers to the concerns and questions of the reviewers. Reviewer #1: The manuscript describes the NMR chemical shfit assignment of the nsp1 protein from SARS-CoV-2. Unfortuneatly, it is the second report of this NMR resonance assignment. The authors rightly reference the previous work, but the differences e.g. construct design is not being discussed. The authors do not compare their chemical shift assignment with the previously published data. The authors here also investigate mutants of nsp1, but the differences e.g in the dynamics of "wildtype" and mutant protein are not presented. At this point, I cannot recommend publication of this work. Answer: As an explanation to the missing comparison, the other assignment paper came out just as our MS was finished. Despite the publication, the chemical shifts were not available at that time and thus, we only added a few sentences about this. In the revised version, since now we have the data, we have heavily modified the MS with considerable comparison with the previous work and more discussion about our results. We hope you will look on the new draft more positively. Note that the mutations were only done to help in the assignment and have no biological meaning. Our biological partners are considering to test them for any effect and if so, we will return to them with a further study. Reviewer #2: The submitted manuscript presents a far-reaching NMR analysis of the SARS-CoV-2 Nsp-1 protein, using both wild-type and two mutant proteins, and at two temperatures. For this, the authors employ a very complete and high-level set of NMR experiments, going beyond the standard protocol and addressing (by MUSIC type experiments) the specific needs for proteins with large unstructured regions (as in Nsp-1). Thus, the work deserves publication for its sound technical implementation and for the high relevance of the targeted protein. However, the manuscript requires a minor-to-mayor overhaul for the reasons listed below, where especially one critical prior work (correctly cited as ref. 31) must be considered more thoroughly. Of note, while this prior work formally limits the novelty of the presented manuscript, this does not constitute a valid reason for rejection in my eyes - rather, I "merely" request a more detailed comparison (stressing the agreements and working out the minor differences) to consolidate, deepen, and extend our understanding of this functionally important protein. Answer: Thank you for taking time to go our manuscript in great detail. When ref 31 came out we had finished our MS and as at that time, we did not yet have access to their chemical shifts, we could not do a proper comparison. Now with the data availability, we have added more text to the MS that discusses differences as well as similarities with the earlier study. We hope that you will find it satisfactory. General requests: - I recommend that a native English speaker revises the manuscript as it contains awkward wording in several larger parts of the text (e.g., legend of Fig. 1, text paragraphs l. 211-217, l. 269-272, 320-324, 334-336) that strongly compromises readability. Answer: We have gone through the parts indicated again and had a native English speaker helping us. We hope this have increased the understanding of the text. - The cited reference [31] reports critical prior work and must be considered in more detail. Thus, the authors should work out more clearly, and wherever relevant in the manuscript, the main differences and agreements between their new work and ref. [31]. For instance: For which further residues were the authors able to provide a NMR characterisation? Why do the authors find slightly different residue segments for the unstructured N- and C-terminal and for the structure central regions? Why could the authors not confirm the short C-terminal helix H3? Could such differences be due to their use of an older version of TALOS (TALOS+ instead of TALOS-N), or to the slightly different experimental conditions (pH, temperature, etc.)? Answer: As we are doing a major revision, we decided to upgrade our analysis to TALOS-N. No major changes were observed. We have added discussion and comparison to ref 31 throughout the manuscript. Specific requests: - Table 1 (NMR parameters): Since recorded FID resolution is the inverse of the maximal sampling time (i.e., FID resolution = 1/AQ, which should be stated clearly in the caption to column 2), very low F1 and F2 resolutions follow from the listed data and I wonder whether there might be a systematic error (factor 2?) in these numbers? For instance, the listed 12.3 ms for 15N result in only 81 Hz = 1.35 ppm resolution. Such low resolution makes little sense especially for intrinsically disordered proteins/regions (as present in Nsp-1). Moreover, it invalidates both resolution enhancing NMR methods adopted by the autors, i.e. non-uniform sampling (NUS) and semi-constant t1(15N) evolution. Already constant-time evolution of 1J(NCO) = 15 Hz or 1J(NCA) = 9-12 Hz demands transfer delays at least twice as long as the cited 12.3 ms (i.e., up to 30 ms), and semi-constant time evolution would require even longer delays. Please clarify this obvious contradiction. I also suggest to add a further column to Table 1 listing the pertaining total measurement time for each experiment. Answer: The data in the table is taken directly from the Bruker acqupars, so the experimental conditions are easy to reproduce if any reader wants to. The resolutions are actually slightly better than what the Bruker standard parameter files suggests. We are also using linear prediction to improve the resolution. This we have added to the experimental section as clarification. However, it is an important question as one always need to balance the resolution with the relaxation properties of the molecule being investigated. In addition, one need to consider the time available on the spectrometer. This protein is not deuterated, and due to this, we have to be careful of the relaxation properties to avoid collecting noise instead of signals. We also worried about line broadening due to the higher, physiological pH that our virology partners insisted upon. We have in recent years worked a lot on IDPs from other viral proteins such as nsP3 HVD of chikungunya and Venezuelan equine encephalitis viruses, and we have found that the parameters presented are quite optimal for the IDPs. At least in our hands, the use of MUSIC experiments is much more efficient, both regarding time as well as assignment, than increasing the resolution for “normal” 2D and 3D spectra. In earlier work, we have used TA (targeted acquisition) for optimal resolution/spectrometer time, but the results were almost always very similar to those we describe in the table. Interestingly, we ran all our experiments on our own 600 MHz, and we didn’t see any need to go to higher fields for this protein. In our planned dynamic measurements, we will of course use higher fields as well. Yes, we will add a column with measurement time. - L. 134: state that 14.1 T correspond to 600 MHz for 1H to enable conversion of resolution, from Hz to ppm (as required to convert the maximal evolution times into recorded FID resolutions, see my notes on Table 1 above). Answer: Added: “corresponding to 600 MHz” to sentence. - L. 175/176: It is stated that folded and disordered regions show distinct NMR relaxation properties exacting distinct optimal “NMR experimental conditions”. This should be better elaborated. For instance: lower temperatures favour NMR on IDP due to reduced HN/H2O exchange while higher T favour folded regions due to reduced T2 relaxation. Mention further NMR parameters like transfer and interscan delays that also differ – how was this implemented or considered? Answer: Section has been rewritten and is hopefully clearer. We started by testing different temperatures and as that was enough to obtain almost complete assignment, we did not try to optimize other parameters. - Terminology: “DIPSI2-N-HSQC” and “MLEV17-C-HSQC” (line 141) are unconventional names (taken directly from the BRUKER pulse program library?) – better use the standard NMR experiment name = TOCSY-HSQC (or was it a HSQC-TOCSY?). Also, in line 143, I suppose the authors meant to say “NOESY-HSQC” (or HSQC-NOESY)? Answer: Yes, our nomenclature was unclear, MS changed to TOCSY-HSQC and NOESY-HSQC. - L.143: HA assignment should, in principle, follow directly from a combination of HACACO with HNCO and HN(CO)CA spectra, making the acquisition of both NOESY-HSQC meaningless and superfluous for this purpose. I suppose, however, that these latter spectra were rather recorded with the objective to search for structure indication? If so, please indicate! Answer: We have found that it is more effective timewise to run a NOESY-HSQC in order to get the HA and ignore the HACACO, and this obviously generated more information as well. We added an explanation to the text. - The optional addition of MgCl2 (2.5 mM) is unclear to me and should be explained. How did it affect the NMR spectra? Answer: No difference observed. Observation added to the manuscript. This was in preparation for future possible interaction studies with RNA. - The abbreviation “aa” should be avoided and spelled out: “amino acid”, or “residue” Answer: Changed throughout the manuscript. We have tried to minimize the use of other abbreviations as well in the revised manuscript. - The short helix a3 appears to be missing in the NMR structure but shows indication of restricted mobility (lines 309 – 312). As a matter of fact, the X-ray structure rather reports a short 3-10 (instead of canonical alpha) helix here. Thus, have the authors considered the possible presence of a 3-10 helix? What secondary structure does the CSI for the HA nuclei suggest (considering that helicity indicated only by HA may suggest a 3-10 helix)? Answer: Thank you for the suggestion. We have now checked out the possibility of a 3-10 helix. No evidence for such a helix can be found in our NOE or the predicted backbone torsional angles or using HA only. A discussion of this have been added to the text. Note that for this helix, we only have HA for V60 and Q63. We are missing those of L61, L64 and P62. No secondary structure was observed in ref 31 as well. One should note that helix-1, which is also a 3-10 helix in the x-ray structure, was identified by Talos-N. - Terminology: While technically correct, the term “cross peak” for an HSQC signal appears very confusing as it is conventionally reserved to NOE cross peaks. This may give rise to confusions, for instance, when reading through lines 328-330 where the disordered regions of Nsp-1 are discussed, but where no (NOE) cross signals are expected. Answer: We have always used cross peak to denote the signals in multi-dimensional spectra of all kinds in all our previous publications. We will rewrite LL328-330 as well as other lines mentioning” cross peaks” to make it clearer what we exactly mean. - This confusion is accentuated by the subsequent conclusion of the authors (lines 330-332, and section “Conclusion”) that folded and unfolded regions in Nsp-1 would show some kind of intramolecular interactions. As it stands, this conclusion is not substantiated enough (although the prior work – ref. 31 – also suggested this from the notable solubility enhancement of the C-terminus on the folded domain). Answer: You are right, as it was written the conclusion could not be made. The lines have been rewritten and expanded to make our point understandable (i.e. mutation suggests interaction with the unstructured parts). Comparison to ref 31 has also been added. - I was intrigued by the finding of a double set of signals for residues 122-125 (line 221). Then, however, I wonder which of both signal shifts (for each residue) was used for the secondary structure analysis shown in Fig. 3b, and how the predicted secondary structuredness differs for both sets of shifts? This should be clarified and the alternative signal shifts should be reported more clearly – ideally, by inclusion into Fig. 3b (e.g., as a second set of coloured bars). Apparently, there is some conformational dynamics towards the C-terminus of strand b7: could this possibly be related to a “kink” in this strand, near V121? The competing work in ref.[ 31] also mentions such conformational heterogeneity (without further specifying the residues) and suggests a possible role of cis/trans isomerism at a proline residue (again, without specifying the residue number, but possibly referring to P115). Interestingly also, the RCI-S2 order parameters derived by the authors and in ref. [31] differ more strongly in exactly this region (res. 120 – 130), where the authors derive a significantly higher rigidity than reported in [31]. I would greatly welcome if the authors provided more details and some deeper discussion of this interesting observation of conformational exchange exactly in the transition region between folded and unfolded (C-terminal) regions, as this might even have a relevance for the known “switch” in Nsp-1 function (from host translation inhibition to viral translation initiation). Answer: Longer discussion about the double sets of signals included. Yes, we ran Talos with the second set, but hardly any difference was observed. The chemical shift differences were quite minor so there was no surprise there. This is the same region that we think have some kind of interaction with the folded domain or more specifically loop 74 – 83, which is more dynamic in both our study as well as in ref 31. This is puzzling data that needs more investigation. We are planning some mutation studies involving this region. When we get more labeled protein, we also want to lower the pH for one sample and see if our data becomes more like ref 31. Hopefully we can also get an answer when we will do actual dynamic measurements on the nsp1 protein. Having real data is of course always more interesting than predicted/simulated. As you mention, it would be exciting if this is a switch between different functions, but we feel it is too early to speculate. Our virology partners are planning their experiments at the moment and hopefully we will have some data in this autumn. Submitted filename: Response to Reviewers.docx Click here for additional data file. 27 Oct 2021 1H, 13C and 15N resonance assignment of the SARS-CoV-2 full-length nsp1 protein and its mutants reveals its unique secondary structure features in solution. PONE-D-21-14234R1 Dear Dr. Agback, We’re pleased to inform you that your manuscript has been judged scientifically suitable for publication and will be formally accepted for publication once it meets all outstanding technical requirements. Within one week, you’ll receive an e-mail detailing the required amendments. When these have been addressed, you’ll receive a formal acceptance letter and your manuscript will be scheduled for publication. An invoice for payment will follow shortly after the formal acceptance. To ensure an efficient process, please log into Editorial Manager at http://www.editorialmanager.com/pone/, click the 'Update My Information' link at the top of the page, and double check that your user information is up-to-date. If you have any billing related questions, please contact our Author Billing department directly at authorbilling@plos.org. If your institution or institutions have a press office, please notify them about your upcoming paper to help maximize its impact. If they’ll be preparing press materials, please inform our press team as soon as possible -- no later than 48 hours after receiving the formal acceptance. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information, please contact onepress@plos.org. Kind regards, Oscar Millet Academic Editor PLOS ONE Additional Editor Comments (optional): Reviewers' comments: 19 Nov 2021 PONE-D-21-14234R1 1H, 13C and 15N resonance assignment of the SARS-CoV-2 full-length nsp1 protein and its mutants reveals its unique secondary structure features in solution. Dear Dr. Agback: I'm pleased to inform you that your manuscript has been deemed suitable for publication in PLOS ONE. Congratulations! Your manuscript is now with our production department. If your institution or institutions have a press office, please let them know about your upcoming paper now to help maximize its impact. If they'll be preparing press materials, please inform our press team within the next 48 hours. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information please contact onepress@plos.org. If we can help with anything else, please email us at plosone@plos.org. Thank you for submitting your work to PLOS ONE and supporting open access. Kind regards, PLOS ONE Editorial Office Staff on behalf of Dr. Oscar Millet Academic Editor PLOS ONE
  42 in total

1.  Complete assignment of heteronuclear protein resonances by protonless NMR spectroscopy.

Authors:  Wolfgang Bermel; Ivano Bertini; Luminita Duma; Isabella C Felli; Lyndon Emsley; Roberta Pierattelli; Paul R Vasos
Journal:  Angew Chem Int Ed Engl       Date:  2005-05-13       Impact factor: 15.336

2.  A selective experiment for the sequential protein backbone assignment from 3D heteronuclear spectra.

Authors:  Wolfgang Bermel; Ivano Bertini; Isabella C Felli; Roberta Pierattelli; Paul R Vasos
Journal:  J Magn Reson       Date:  2005-02       Impact factor: 2.229

3.  Novel beta-barrel fold in the nuclear magnetic resonance structure of the replicase nonstructural protein 1 from the severe acute respiratory syndrome coronavirus.

Authors:  Marcius S Almeida; Margaret A Johnson; Torsten Herrmann; Michael Geralt; Kurt Wüthrich
Journal:  J Virol       Date:  2007-01-03       Impact factor: 5.103

4.  SARS-CoV-2 Nsp1 binds the ribosomal mRNA channel to inhibit translation.

Authors:  Katharina Schubert; Evangelos D Karousis; Ahmad Jomaa; Alain Scaiola; Blanca Echeverria; Lukas-Adrian Gurzeler; Marc Leibundgut; Volker Thiel; Oliver Mühlemann; Nenad Ban
Journal:  Nat Struct Mol Biol       Date:  2020-09-09       Impact factor: 15.369

5.  The CCPN data model for NMR spectroscopy: development of a software pipeline.

Authors:  Wim F Vranken; Wayne Boucher; Tim J Stevens; Rasmus H Fogh; Anne Pajon; Miguel Llinas; Eldon L Ulrich; John L Markley; John Ionides; Ernest D Laue
Journal:  Proteins       Date:  2005-06-01

6.  Mutagenesis of the murine hepatitis virus nsp1-coding region identifies residues important for protein processing, viral RNA synthesis, and viral replication.

Authors:  Sarah M Brockway; Mark R Denison
Journal:  Virology       Date:  2005-09-30       Impact factor: 3.616

7.  Nonstructural Protein 1 of SARS-CoV-2 Is a Potent Pathogenicity Factor Redirecting Host Protein Synthesis Machinery toward Viral RNA.

Authors:  Shuai Yuan; Lei Peng; Jonathan J Park; Yingxia Hu; Swapnil C Devarkar; Matthew B Dong; Qi Shen; Shenping Wu; Sidi Chen; Ivan B Lomakin; Yong Xiong
Journal:  Mol Cell       Date:  2020-10-29       Impact factor: 17.970

8.  Novel NMR Assignment Strategy Reveals Structural Heterogeneity in Solution of the nsP3 HVD Domain of Venezuelan Equine Encephalitis Virus.

Authors:  Peter Agback; Andrey Shernyukov; Francisco Dominguez; Tatiana Agback; Elena I Frolova
Journal:  Molecules       Date:  2020-12-10       Impact factor: 4.411

9.  Dynamic competition between SARS-CoV-2 NSP1 and mRNA on the human ribosome inhibits translation initiation.

Authors:  Christopher P Lapointe; Rosslyn Grosely; Alex G Johnson; Jinfan Wang; Israel S Fernández; Joseph D Puglisi
Journal:  Proc Natl Acad Sci U S A       Date:  2021-02-09       Impact factor: 11.205

10.  A Novel Coronavirus from Patients with Pneumonia in China, 2019.

Authors:  Na Zhu; Dingyu Zhang; Wenling Wang; Xingwang Li; Bo Yang; Jingdong Song; Xiang Zhao; Baoying Huang; Weifeng Shi; Roujian Lu; Peihua Niu; Faxian Zhan; Xuejun Ma; Dayan Wang; Wenbo Xu; Guizhen Wu; George F Gao; Wenjie Tan
Journal:  N Engl J Med       Date:  2020-01-24       Impact factor: 91.245

View more
  2 in total

1.  Site-specific recognition of SARS-CoV-2 nsp1 protein with a tailored titanium dioxide nanoparticle - elucidation of the complex structure using NMR data and theoretical calculation.

Authors:  Peter Agback; Tatiana Agback; Francisco Dominguez; Elena I Frolova; Gulaim A Seisenbaeva; Vadim G Kessler
Journal:  Nanoscale Adv       Date:  2022-02-17

2.  Extended ensemble simulations of a SARS-CoV-2 nsp1-5'-UTR complex.

Authors:  Shun Sakuraba; Qilin Xie; Kota Kasahara; Junichi Iwakiri; Hidetoshi Kono
Journal:  PLoS Comput Biol       Date:  2022-01-19       Impact factor: 4.475

  2 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.