Literature DB >> 34695135

Concurrent circulation of dengue serotype 1, 2 and 3 among acute febrile patients in Cameroon.

Huguette Simo Tchetgna1, Francine Sado Yousseu1,2, Basile Kamgang1, Armel Tedjou1,3, Philip J McCall4, Charles S Wondji1,4.   

Abstract

Acute febrile patients presenting at hospitals in Douala, Cameroon between July and December 2020, were screened for dengue infections using real time RT-PCR on fragments of the 5' and 3' UTR genomic regions. In total, 12.8% (41/320) of cases examined were positive for dengue. Dengue virus 3 (DENV-3) was the most common serotype found (68.3%), followed by DENV-2 (19.5%) and DENV-1 (4.9%). Co-infections of DENV-3 and DENV-2 were found in 3 cases. Jaundice and headache were the most frequent clinical signs associated with infection and 56% (23/41) of the cases were co-infections with malaria. Phylogenetic analysis of the envelope gene identified DENV-1 as belonging to genotype V, DENV-2 to genotype II and DENV-3 to genotype III. The simultaneous occurrence of three serotypes in Douala reveals dengue as a serious public health threat for Cameroon and highlights the need for further epidemiological studies in the major cities of this region.

Entities:  

Mesh:

Year:  2021        PMID: 34695135      PMCID: PMC8568189          DOI: 10.1371/journal.pntd.0009860

Source DB:  PubMed          Journal:  PLoS Negl Trop Dis        ISSN: 1935-2727


Background

Dengue is one of the most important mosquito-borne infections worldwide and its disease burden, one of the greatest in global health. The global incidence of dengue has increased by over 30 fold in recent decades, reaching today’s level of approximately 400 million infections affecting half of the world’s population in the 125 countries at risk of infection [1,2]. Dengue results from an infection with dengue virus (DENV) of the genus Flavivirus (Flaviviridae family). DENV genome is a positive sense, non-segmented, single stranded RNA of ~10.7kb which comprise an open reading frame encoding for three structural proteins and seven non-structural (NS) proteins in the order 5’ C-preM/M-E-NS1-NS2a-NS2b-NS3-NS4a-NS4b-NS5 3’ [3]. In fact, DENV is a complex of four antigenically and genetically distinct viruses, referred to as dengue serotypes 1 to 4 (DENV-1, DENV-2, DENV-3, and DENV-4) and each serotype can be further subdivided into multiple genotypes. Dengue infections in humans are typically inapparent but can involve a range of clinical presentations from mild fever to the complications that can result in the potentially fatal severe Dengue [4,5]. A major determinant of disease severity is the timing and sequence of infection as infection with one virus serotype confers a lifelong homotypic immunity but subsequent re-infection with a different serotype increases the risk of severe disease [4]. DENV is primarily transmitted to humans by the mosquitoes of the Aedes genus, with Aedes aegypti the primary vector and Ae. albopictus the secondary vector. The last two decades have been marked by an unprecedented global expansion of the vectors rapidly followed by dengue, the result of global-scale human-driven changes such as massively increased urbanization, deforestation and ineffective vector control, and latterly climate change, all contributing to increase in vector transmission from human to human [2]. In Africa, dengue outbreaks have been recorded more frequently in many countries including Gabon, Angola, Mozambique, Kenya, Ethiopia, Sudan and Burkina Faso [6,7,8]. All four DENV serotypes have been widely reported across Africa and the co-circulation of two or more serotypes, first reported from Gabon in 2013 [8] is becoming more common, e.g. Kenya [7], Burkina Faso [6], Nigeria [9], Tanzania [10] raising fears that severe dengue will be seen more frequently in future outbreaks in Africa. In Cameroon numerous studies over the past twenty years have reported seroprevalence rates in rural and urban areas in Cameroon, with no major outbreak notifications [11,12]. Cross-sectional studies in Yaoundé and Kribi have reported DENV-1 and DENV-2 [13,14] and a small scale study conducted in Douala in 2017 showed that dengue serotype 1 was responsible of 10% of the acute febrile diseases found in that city [14]. Both Ae. aegypti and Ae. albopictus, occur in Douala where Ae. aegypti is predominant in downtown and Ae. albopictus more common in suburban areas [15]. The Douala populations of both species can transmit DENV-2, and at high transmission efficiency for Ae. aegypti [16]. Therefore, our aim was to estimate the implication of dengue fever among outpatients seen in four public hospitals in the city and determine the main active genotypes and serotypes.

Material and methods

Ethics statement

The study was approved by the National Ethical Committee for Human Research in Cameroon (N°2019/06/1165/CE/CNERSH/SP) and the institutional ethical committee of the Liverpool School of Tropical Medicine (Research Protocol 19–012). Permission to perform the study was obtained from each hospital and written informed consent was obtained from every patient who volunteered to be recruited. Assent and written consent for volunteers under 20 years old were obtained from their parents or legal guardian.

Study design and patient inclusion

This cross-sectional study was conducted from July to December 2020 in 4 public hospitals in Douala (Fig 1), the largest city in Cameroon with approximately 3 million inhabitants. Douala has a warm and humid tropical climate with an average annual temperature and precipitation of 26°C and 3600mm respectively. The port of Douala is the largest seaport of Central Africa, with significant international movement of goods and passengers.
Fig 1

Sampling sites and dengue cases distribution in the city of Douala.

The figure was built using the Cameroon shapefiles available at https://gadm.org/download_country_v3.html with QGIS Desktop V.3.14.16 software (https://www.qgis.org/en/site/).

Sampling sites and dengue cases distribution in the city of Douala.

The figure was built using the Cameroon shapefiles available at https://gadm.org/download_country_v3.html with QGIS Desktop V.3.14.16 software (https://www.qgis.org/en/site/). Outpatients above 3 years old presenting with an acute febrile syndrome were enrolled in the study. The inclusion criteria required a fever (an axillary temperature above 38°C) of less than 7 days duration plus at least three of the following symptoms: headache, asthenia, myalgia, rash, arthralgia, nausea, abdominal pain, vomiting, jaundice, and diarrhoea. Following consent by volunteer, a questionnaire was used to collect data, including socio-demographic details and some clinical signs. A 5 mL sample of whole blood was collected in EDTA vacutainer tubes from the median cubital vein and centrifuged at 2000 rpm for 10min to obtain both the plasma and the buffy coat which were store at -20°C for further analysis. Additionally, samples were screened for malaria using either a rapid diagnostic test or whole blood thick smear.

Real time RT-PCR for dengue screening and serotype classification

Total RNA was extracted from plasma using the QIAamp viral RNA mini kit, as per the manufacturer’s recommendations (Qiagen, Hilden, Germany). The extracted RNA was retrotranscribed into cDNA using the High-capacity cDNA reverse transcription kit (Applied Biosystems, Foster City, California, USA) according to the manufacturer. Then 5 μL of cDNA was amplified using the kit TaqMan Universal PCR Master Mix (Applied Biosystems, Foster City, California, USA) with primers published elsewhere [17] and targeting a 107 bp fragment in the 3’UTR to screen for infection by either of the four dengue serotypes. The reaction was pre-amplified for 02 min at 50°C followed by 10min at 94°C then the amplification and fluorescence quantification were done during 45 cycles for 15 sec at 94°C and 1 min at 60°C. Subsequently, a dengue serotype-specific real time RT-PCR was performed to determine the serotype of samples which gave a positive result during the above-mentioned RT-PCR using four different sets of primers and probes specific to the 5’ UTR and capsid following the same protocol described above [17] (Table 1). All the real time RT-PCR experiments were done on the Stratagene Mx3005P qPCR machine (Agilent Technologies, Santa Clara, California, USA).
Table 1

Primers and probes used to detect and serotype dengue virus by real time RT-PCR.

VirusPrimersSequences 5’ ➔ 3’Gene
All Dengue virusesDENV-All-FAGGACYAGAGGTTAGAGGAGA3’ UTR
DENV-All-RCGYTCTGTGCCTGGAWTGAT
DENV-All-PFAM-ACAGCATATTGACGCTGGGARAGACC-TAMRA
Dengue virus 1DENV-1-FATACCYCCAACAGCAGGAATT5’UTR-C
DENV-1-RAGCATRAGGAGCATGGTCAC
DENV-1-PFAM-TTGGCTAGATGGRGCTCATTCAAGAAGAAT-TAMRA
Dengue virus 2DENV-2-FTGGACCGACAAAGACAGATTCTT5’UTR-C
DENV-2-RCGYCCYTGCAGCATTCCAA
DENV-2-PFAM-CGCGAGAGAAACCGCGTGTCRACTGT-TAMRA
Dengue virus 3DENV-3-FAAGACGGGAAAACCGTCTATCAA5’UTR-C
DENV-3-RTTGAGAATCTCTTCGCCAACTG
DENV-3-PFAM-ATGCTGAAACGCGTGAGAAACCGTGT-TAMRA
Dengue virus 4DENV-4-FCCATCCCACCRACAGCAGG5’UTR-C
DENV-4-RCAAGATGTTCAGCATGCGGC
DENV-4-PFAM-ATGGGGACAGTTRAAGAAAAAYAAGGCCAT-TAMRA

Adapted from Leparc-Goffart et al., [17]

Adapted from Leparc-Goffart et al., [17]

Amplification of the envelope gene, Sanger sequencing and phylogenetic analysis

The envelope gene was amplified using three sets of primers as previously described [18] with the Kapa Taq DNA polymerase kit (Kapa Biosystems, Wilmington, Massachusetts, USA). Briefly, 5 μL of cDNA was added to a reaction mixture containing 400nM of each primer, 1.25 mM of MgCl2, and 80 μM of dNTPs. The amplification was performed by incubation for 3 min at 95°C followed by 45 cycles of 30 sec at 95°C, 30 sec at 55°C and 1 min at 72°C and a final amplification for 10 min at 72°C on the Applied Biosystems 2720 Thermal Cycler (Applied Biosystems, Foster City, California, USA). The amplicons were visualized on a 1% agarose gel electrophorese, purified using ExoSAP-IT (Applied Biosystems, Foster City, California, USA) then directly sequenced using the Sanger technology through Microsynth SeqLab (Göttingen, Germany). The sequences obtained, one for DENV-1, three for DENV-2 and five for DENV-3, were aligned to references retrieved from GenBank and manually edited using the MAFFT algorithm from Unipro Ugene V36.0 [19]. Then, the best fitting DNA evolution model for the phylogenetic inference was determined using Mega X [20]. Hence the phylogenetic trees were built using the Maximum likelihood under the Tamura-Nei 93 (TN-93) substitution model with a discrete Gamma distribution (+G) and assuming that a certain fraction of sites are evolutionarily invariable (+I). The trees were built with 1000 bootstrap iterations and annotated using FigTree V1.4.4 (http://tree.bio.ed.ac.uk/software/figtree/).

Statistical analysis

Pair-wise comparisons were made between dengue-positive and dengue-negative cases, using either the Chi-square (χ2), the Fischer exact test or the student t-test with significance at p-value < 0.05 for qualitative and quantitative variables. Independent variables were tested for possible association with dengue positivity and expressed as odds rations (OR) with 95% confidence intervals. All statistical analyses were performed using R version 4.00 (The R Foundation for Statistical Computing, https://www.r-project.org/).

Results

From July to December 2020, 320 individuals were recruited in four public hospitals in Douala. The mean age of this population was 29 ±17.4 years, with a sex ratio M/F of 0.8. Participants comprised 16.87% below 15 years. The most common clinical signs found in our cohort were headache (63.7%), asthenia (58.7%) and joint pain (47.8%); jaundice and rash were reported from 16 and 4 patients respectively, out of the 320 individuals included in the study (Table 2). Malaria infections were detected in 227 (71%) cases using both RDT and thick smear.
Table 2

General description of the dengue positive and negative cases found in the study.

CharacteristicsDengue positive (N = 41)Dengue negative (N = 279)OR (CI 95%)p-valueTotal (N = 320)
Socio-demographic characteristics
Age (years)
least than 051290.730 (0.34–1.49) 0.03 30
06 to 1573845
16–24135063
25–451695111
46–8424446
NA22325
mean Age26.57±14.2928.63±17.900.82*0.4129 ±17.48
Male (%)21 (51.22%)121 (43.37%)0.60#0.43142 (44.38%)
Mean day of fever since the onset2.92±2.524.15±2.913.21* 0.002 3.99 (2.81)
YF vaccination11 (26.83%)78 (27.96%)2.58e-30#189 (27.81%)
Clinical manifestation
Headache26 (63.41%)178 (63.80%)0.45 (0.21–1.00) 0.04 204 (63.75%)
Asthenia23 (56.1%)165 (59.14%)1.17 (0.45–3.65)0.74188 (58.75%)
Joint pain18 (43.9%)135 (48.39%)0.88 (0.40–2.00)0.75153 (47.81%)
Abdominal pain13 (31.71%)103 (38.15%)1.03 (0.49–2.15)0.95116 (36.25%)
Muscular pain13 (31.71%)99 (35.48%)0.85 (0.38–1.92)0.70112 (35%)
Nausea8 (19.51%)98 (35.12%)1.03 (0.48–2.15)0.95106 (33.12%)
Vomiting13 (31.71%)89 (31.95%)1.39 (0.51–3.39)0.49102 (31.87%)
Cough3 (7.31%)67 (24.01%)1.52 (0.66–3.38)0.3170 (21.87%)
Diarrhoea7 (17.07%)36 (12.90%)0.72 (0.31–1.62)0.4443 (13.44%)
Retro-orbital pain1 (2.44%)22 (7.88%)1.10 (0.24–3.57)0.8823 (7.19%)
Runny nose0 (00)22 (7.88%)0.70 (0.11–2.60)0.6422 (6.87%)
Jaundice3 (7.32%)13 (4.66%)3.45 (1.01–10.48) 0.03 16 (5%)
Photophobia0 (0.0)14 (5.02%)NA0.9914 (4.37%)
Rash0 (0.0)4 (1.43%)2.46 (0.12–20.17)0.444 (1.25%)

N sample size, NA not available, OR odd ratio, CI95% 95% confidence interval. * student t-test; # χ2 test

N sample size, NA not available, OR odd ratio, CI95% 95% confidence interval. * student t-test; # χ2 test Dengue virus was found in 12.8% (41/320) of participants who lived in 12 of the central and peripheral neighbourhoods in the city (Fig 1), with the highest number from Newbell, a densely populated settlement in the central ward of the city. Co-infections of dengue with malaria were seen in 56% of dengue positive cases. Three dengue serotypes were found, DENV-1, DENV-2, and DENV-3 in patients aged from 3 years to 75 years, but significantly more were in adults (81.1%) than in children below 15 years old (18.9%; χ2 = 21.84, df = 1), (Table 3). DENV-3 was the most prevalent serotype (68.3%), followed by DENV-2 (19.5%) and DENV-1 (4.9%), and 6 (14,6%) that could not be serotyped. Three cases of co-infection with DENV-2 and DENV-3 were found, though none exhibited clinical signs of severe dengue. Of all symptoms reported, headache (OR = 0.4, IC95% [0.2–1.0], p = 0.04) and jaundice (OR = 3.4, IC95% = [1.0–10.5], p = 0.03) were significantly associated with dengue infection (Table 2). Dengue cases were found in July, August, and September, which is the rainy season in Douala (Table 3).
Table 3

Description of the dengue positive cases found from July to September 2020 in Douala.

PatientAge (years)GenderRT-PCR* (Ct)SerotypeDengue serotyping RT-PCR# (Ct)Collection date
111M30.8323.35September 2020
244.12M26.99319.43September 2020
320.02F33.67325.66September 2020
416.45M31.99124July 2020
537.54F33.973 + 234.84/27.77July 2020
616.90M31.71140.02July 2020
723.86M27.84324.4July 2020
819.59F37.46233July 2020
935.63M34.44229August 2020
1015.89F38.76nd-August 2020
1110.66M40.19nd-August 2020
1228.46M34.64340.17August 2020
1325.56M30.56328.81September 2020
1436.58M25.73323.48July 2020
1531.57M30.41323.26July 2020
1629.98F35.69327.79September 2020
1729.58F38.52nd-July 2020
1813.58F28.92220.99July 2020
1942.60F36.973 + 226/28.78July 2020
2038.57M31.44327.99July 2020
21ndM26.69324.69July 2020
2242.57F31.18324.43July 2020
23ndF39.43234.52July 2020
2475.62M39.89331.76July 2020
2552.61F25.87319.93July 2020
2620.24M38.33221.19July 2020
2721.50F32.95nd-August 2020
2821.61M33.69329.7August 2020
2919.44F40.72325.95August 2020
3026.63F41.24327.67August 2020
3123.66M26.48nd-August 2020
3233.67F40.81nd-August 2020
3334.09F26.48318.9August 2020
3442.32M40.81336.15August 2020
3542.29M29.123 + 234.85/21.37August 2020
363.01F43.38337.4September 2020
376.02M41.5337.4September 2020
3840.13F42.37338.53September 2020
398.02M40.21337.87September 2020
4021.38M31.69324.73September 2020
4122M35.5328.9September 2020

* Real time RT-PCR that detect all the dengue cases, independently of the serotypes by amplification of a portion of the 3’UTR.

# real time RT-PCR to identify each serotype by amplification of 5’ UTR and capsid. Ct cycle threshold

* Real time RT-PCR that detect all the dengue cases, independently of the serotypes by amplification of a portion of the 3’UTR. # real time RT-PCR to identify each serotype by amplification of 5’ UTR and capsid. Ct cycle threshold

Phylogenetic analysis of the dengue serotypes

The phylogenetic analysis shows that our strain of DENV-1 belongs to genotype V (Fig 2), the American- African genotype which is a cosmopolite genotype including strains from around the world. Indeed, our DENV-1 belongs to the subset of DENV-1 found in West and Central Africa and is closely related to the Gabonese strain of 2012 (Fig 2). Interestingly, the cluster formed by the Gabonese and Cameroonian strains are basal to the cluster comprising the strains responsible for outbreaks in Angola in 2013, as well as those reported from the Republic of the Congo (RC) and Democratic Republic of the Congo (DRC) since 2015, through a spillover in Japan. Moreover, although they all belong to genotype V, our strain is not closely related to DENV-1 strains found in West Africa recently, but rather to more ancient strains from Nigeria, and Côte d’Ivoire from 1968 and 1985 respectively (Fig 2). For DENV-2, the phylogenetic reconstruction has shown that the DENV-2 strains isolated during this study belongs to the genotype II, alongside with other African strains (Fig 3). Our strains seem to have evolved from a common ancestor with the strains responsible for epidemics in West Africa since 2014. DENV-3 phylogeny shows that the Cameroonian strains belong to the genotype III. Indeed, ours strains belongs to the African DENV-3 clade (Fig 4). They root between the West and the East-South African strains. Although the strains from Gabon, a neighbouring country, seem to have directly originated from the West African strains, DENV-3 from Cameroon seems to be more ancient and seems to have evolved from the East-South African strains including those observed in the Comoros, Madagascar and Djibouti in 2010 and 2011 respectively.
Fig 2

Dengue virus 1 phylogenetic tree built with a 721 bp fragment of the envelope gene.

The maximum likelihood tree was built using the TN-93 +G+I model. Each DENV genotype is represented by a single colour. The sequence from this study is highlighted in red. The tree node value represented the bootstrap expressed in decimal. Dengue virus 3 from Tanzania was used as outgroup. DENV-1 from Cameroon formed a cluster with the Gabonese trains within the genotype V.

Fig 3

Dengue virus 2 phylogenetic tree built with a 1387 bp fragment of the envelope gene.

The maximum likelihood tree was built using the TN-93 +G+I model. Each DENV genotype is represented by a single colour. The three sequences from this study are highlighted in red. The tree node value represented the bootstrap expressed in decimal. Dengue virus 3 from Tanzania was used as outgroup. DENV2 strains from Cameroon belong to genotype II along other African strains. It forms a sister clade with those responsible of the recent outbreaks in West Africa.

Fig 4

Dengue virus 3 phylogenetic tree built with a 1026 bp fragment of the envelope gene.

The maximum likelihood tree was built using the TN-93 +G+I model. Each DENV genotype is represented by a single colour. The five sequences from this study are highlighted in red. The tree node value represented the bootstrap expressed in decimal. Dengue virus 4 from Singapore was used as outgroup. DENV-3 from Cameroon belongs to the genotype III. They share a common ancestor with the viruses active in West Africa since 2008.

Dengue virus 1 phylogenetic tree built with a 721 bp fragment of the envelope gene.

The maximum likelihood tree was built using the TN-93 +G+I model. Each DENV genotype is represented by a single colour. The sequence from this study is highlighted in red. The tree node value represented the bootstrap expressed in decimal. Dengue virus 3 from Tanzania was used as outgroup. DENV-1 from Cameroon formed a cluster with the Gabonese trains within the genotype V.

Dengue virus 2 phylogenetic tree built with a 1387 bp fragment of the envelope gene.

The maximum likelihood tree was built using the TN-93 +G+I model. Each DENV genotype is represented by a single colour. The three sequences from this study are highlighted in red. The tree node value represented the bootstrap expressed in decimal. Dengue virus 3 from Tanzania was used as outgroup. DENV2 strains from Cameroon belong to genotype II along other African strains. It forms a sister clade with those responsible of the recent outbreaks in West Africa.

Dengue virus 3 phylogenetic tree built with a 1026 bp fragment of the envelope gene.

The maximum likelihood tree was built using the TN-93 +G+I model. Each DENV genotype is represented by a single colour. The five sequences from this study are highlighted in red. The tree node value represented the bootstrap expressed in decimal. Dengue virus 4 from Singapore was used as outgroup. DENV-3 from Cameroon belongs to the genotype III. They share a common ancestor with the viruses active in West Africa since 2008.

Discussion

To gauge the extent of the contemporary dengue threat to Cameroon, we screened for dengue infection in outpatients at four public hospitals in the city of Douala, between July and December 2020. We found a 12.8% infection rate by PCR in 320 febrile individuals examined, and three co-circulating dengue serotypes were detected. All infections were found in the wet season (July-September), predominantly in adults (81.1%). Our results are comparable to those reported by Abe et al. from the same period in Gabon, where dengue infection was mainly found in adults during the rainy season [21]. This high infection rate during the wet season corresponds with the rise in abundance of the vector breeding habitats in Douala in that season [2,15,22]. Co-infections of dengue and malaria have been reported previously from Cameroon and elsewhere in Africa [7,12,13], at levels similar to the 55.6% found here. These levels of co-infection with malaria and dengue may reflect the low socio-economic status of the affected population since transmission of both pathogens by their respective vectors is favoured by poor housing quality, inadequate sanitation and poverty [23,24]. In Africa, where malaria transmission rates far exceed anywhere else worldwide, such co-infections will be responsible for substantial under diagnosis and underreporting of arboviral infections throughout the continent[25]. Three dengue virus serotypes were found during this surveillance study: DENV-1 genotype V, DENV-2 genotype II and DENV-3 genotype III. The characterisation of three dengue serotypes during the same period in one city raises a concern about severe forms of the disease, namely dengue haemorrhagic fever (DHF) and dengue shock syndrome (DSS) through the development of antibody-dependent enhancement (ADE) in secondarily infected individuals, especially since DENV-1 and DENV-2 are already known in Douala [11,14,26,27]. Apart from jaundice, we found no clinical signs of external haemorrhage in this study. However, as we did not carry out any hematologic tests which could have informed on any eventual blood dysregulation in dengue infected individuals, nor any follow up of the patients, we cannot draw conclusions on the severity of these cases. Aedes aegypti and Ae. albopictus mosquitoes from Douala (Cameroon) have been proven to be efficient to transmit DENV-2 [16], however comparable data are not available for DENV-3 which hampers the comprehension of DENV-3 spreading in the country. Additionally, we have found three cases of co-infections by DENV-2 and DENV-3 in individuals aged 37 and 42 years old. No specific clinical signs have been associated with those co-infections. Co-infection of individuals by numerous dengue serotypes have been recurrently reported in patients and Aedes mosquitoes, mostly during multi-serotype outbreaks, driven by the frequency of the circulating serotypes [28,29]. However, the relevance of such events for disease severity and on the virus life cycle has not been well established. Senaratne and colleagues have demonstrated that co-infections by two or more dengue serotypes have no incidence on disease severity since the clinical presentation, the white blood cell count and viraemia were not different from mono-infected individuals [30]. Yet, neurologic impairments have been described in children co-infected by DENV-1, -2 and -3 in Brazil [31]. More efforts should therefore be made to understand why some co-infections and the genotypes involved, result in severe cases and the situation in Douala offers opportunities for such studies in an African context. DENV-3 genotype III found in this study was closely related to strains that have circulated in West Africa, in 2008–2009, mainly Côte d’Ivoire, Togo and Cape Verde. DENV-3 has been anecdotally described in Central Africa, Cameroon in 2006 and Gabon in 2010 [8,21,32]. DENV-3 genotype III, which originated from the Indian subcontinent, was first described in Africa in the 1980s in Mozambique and was mostly active in the eastern parts of the continent [33]. Indeed, it has been extensively described on numerous occasions in Djibouti, Sudan, Kenya [33,34,35]. However, the epidemiology of the virus has changed, as it is now recurrently found in West Africa, notably during epidemics but also from returning travellers [36,37,38,39]. The global expansion of DENV-3 genotype III is ongoing and includes Central Africa. In fact, our study pinpoints for the second time the burden of DENV-3 in Central Africa after it was first reported in Gabon during the 2016–2017. The only serotype responsible for dengue fever at the time in Gabon, was DENV-3 genotype III, which accounted for up to 8% of the febrile cases. In Douala, we found an even greater prevalence of DENV-3, however with a strain more ancient than those from West Africa and Gabon, a finding which heads to support a greater settlement of this virus in the sub-region. Indeed, one can assume the circulation of many DENV3 genotype III clades in Central Africa, one which has evolved from East African strains as seen in Cameroon and the second which has newly been introduced from West Africa, as exemplified in Gabon. DENV-3 has been postulated to be responsible for more severe manifestations of dengue disease through some meta-analysis of the disease severity, but also because the first cases of DHF have appeared with the description of distinct genetic shifts in the DENV-3 genotype III genome [33,40,41]. The establishment of DENV-3 genotype III in Cameroon and Central Africa therefore raises some public health concerns. Interestingly, DENV-2 was the second most abundant dengue serotype found while we only got two cases of DENV-1. In a previous study in Cameroon, DENV-1 was the only serotype found among febrile patients, even in Douala [14,42,43], however, at variable prevalence. Seroprevalence studies have shown that 72% of individuals in Douala had neutralising antibodies against DENV-2, confirming that DENV-2 was active in the city sometime in the past [11]. Hence, dengue epidemiology in Douala has shifted, with DENV-3 as the current major serotype alongside a baseline activity of DENV-2 and DENV-1. Similarly, before the finding of DENV-3 in Gabon by Abe and colleagues [21], the lately active dengue serotype in Central Africa was DENV-1, recorded from DRC [44,45,46]. In fact, the long-term persistence of a dengue lineage in a specific area has been demonstrated to be limited, due to lineage introduction, shift or replacement [47]. The introduction of new genotypes or serotypes in a region may cause bottlenecks and displacement of previously dominant serotypes, although co-circulation with the latter may occur [48,49]. Such replacement events have been well documented during major epidemics, in Peru and Malaysia and are perhaps due to a heterologous primed populations exposed to the new lineages [50,51] as well as pre-existing population immunity; but they may result in a greater number of symptomatic and severe cases [47,50,51]. Hence, if such an event is happening in Douala or Central Africa, this could lead to an increase in DENV-3 cases and severity. Nevertheless, our study has some limitations which preclude us to conclude on some questions regarding dengue in Douala. Indeed, we have not characterised the disease at the clinical level which could have provide insights into the severity of the cases observed and hence the outcome of the disease. Additionally, we have only analysed a portion of the envelope gene of some strains. The whole genome analysis of all the viral strains found would have provide more knowledge on genetic diversity of the different lineages present.

Conclusion

These results highlight the importance of monitoring emerging and re-emerging viruses in urban areas of Africa, especially the large high-density cities. This routine arbovirus survey has revealed dengue infections as a significant cause of acute febrile disease cases in public hospitals in Douala. We have confirmed the presence of three serotypes, DENV-1, DENV-2, and DENV-3, and of co-infections with DENV-2 and DENV-3. The presence of multiple serotypes is alarming as it demonstrates the increased likelihood of severe dengue. It is of sufficient concern to warrant further epidemiological studies and the development of appropriate dengue outbreak prevention and response plans in Cameroon and elsewhere in the region. 20 Jul 2021 Dear Dr SIMO TCHETGNA, Thank you very much for submitting your manuscript "Concurrent circulation of dengue serotype 1, 2 and 3 among acute febrile patients in Cameroon" for consideration at PLOS Neglected Tropical Diseases. As with all papers reviewed by the journal, your manuscript was reviewed by members of the editorial board and by several independent reviewers. In light of the reviews (below this email), we would like to invite the resubmission of a significantly-revised version that takes into account the reviewers' comments. We cannot make any decision about publication until we have seen the revised manuscript and your response to the reviewers' comments. Your revised manuscript is also likely to be sent to reviewers for further evaluation. When you are ready to resubmit, please upload the following: [1] A letter containing a detailed list of your responses to the review comments and a description of the changes you have made in the manuscript. Please note while forming your response, if your article is accepted, you may have the opportunity to make the peer review history publicly available. The record will include editor decision letters (with reviews) and your responses to reviewer comments. If eligible, we will contact you to opt in or out. [2] Two versions of the revised manuscript: one with either highlights or tracked changes denoting where the text has been changed; the other a clean version (uploaded as the manuscript file). Important additional instructions are given below your reviewer comments. Please prepare and submit your revised manuscript within 60 days. If you anticipate any delay, please let us know the expected resubmission date by replying to this email. Please note that revised manuscripts received after the 60-day due date may require evaluation and peer review similar to newly submitted manuscripts. Thank you again for your submission. We hope that our editorial process has been constructive so far, and we welcome your feedback at any time. Please don't hesitate to contact us if you have any questions or comments. Sincerely, Marilia Sá Carvalho Associate Editor PLOS Neglected Tropical Diseases Amy Morrison Deputy Editor PLOS Neglected Tropical Diseases *********************** Reviewer's Responses to Questions Key Review Criteria Required for Acceptance? As you describe the new analyses required for acceptance, please consider the following: Methods -Are the objectives of the study clearly articulated with a clear testable hypothesis stated? -Is the study design appropriate to address the stated objectives? -Is the population clearly described and appropriate for the hypothesis being tested? -Is the sample size sufficient to ensure adequate power to address the hypothesis being tested? -Were correct statistical analysis used to support conclusions? -Are there concerns about ethical or regulatory requirements being met? Reviewer #1: The study aims to characterize the contribution of DENV to acute febrile illness in Douala, Cameroon. The authors obtained 320 samples from symptomatic patients and were able to detect DENV in 41 samples. The positive samples were serotyped by RT-qPCR and subsequently submitted to envelope gene sequencing. Maximum likelihood analysis was performed to identify the genotypes of DENV1, DENV2 and DENV3 circulating in Duoala, Cameroon. The authors concluded that the simultaneous occurrence of three DENV serotypes in Douala reveals that the virus is a serious public health threat for Cameroon. Reviewer #2: The objectives are clear and well delineated for the study. The design is appropriate, however the sample size was low to compose four public hospitals. Even being from a poor country with a lack of surveillance. The low number of samples that were sequenced are unrepresentative. It is known that DENV1 is well established in the Aedes aegypti mosquito on several continents. Currently, dengue viruses have originated lineages within a genotype and this is very important to show the variability, especially for dengue viruses 1 and 2. It is important to emphasize that there are already many methodologies for obtaining low-cost and sensitive sequences that allow a broad analysis. The target population is in agreement with the proposed objectives. Statistical tests are adequate, as well as molecular analysis. Ethical aspects are reported in the text. Reviewer #3: (No Response) -------------------- Results -Does the analysis presented match the analysis plan? -Are the results clearly and completely presented? -Are the figures (Tables, Images) of sufficient quality for clarity? Reviewer #1: Some inconsistencies were observed in Results section; therefore, authors should clarify or rectify their statement in the text: Table 2: in the age column, the sum of positive dengue patients is not 41: - 6 to 15 age line: the sum of positive and negative dengue cases is 48, but only 7 positive and 40 negative cases are listed - 25 to 45 age line: the sum of positive and negative dengue cases is 103, but only 16 positive and 86 negative cases are listed Lines 159-160: the number of dengue and malaria co-infections is inconsistent: 176 cases were co-infections with malaria, but only 41 patients tested positive for dengue. Is that accurate? Lines 177, 179, 185, 187 and 190: the names of the figures should be changed to Figure 2, 3 and 4 instead of Figure 2a, 2b and 2c. Figure 2, Figure 3 and Figure 4: ML trees were inferred with a number of dengue sequences different from the mentioned number of sequences generated in this study, for example: the authors generated 2 DENV1 sequences, but the ML tree shows only 1 sequence. The same was observed for DENV2 and DENV3. The authors should include all sequences generated in this study for phylogenetic analysis or make it clear why only some sequences were used. Line 193: The authors mentioned that DENV3 strains from Cameroon might have evolved from South Africa strains. For clear understanding, the authors should provide the names of the countries they are referring to. Line 226: the ages of the patients co-infected with DENV2 and DENV3 are inconsistent with the information presented on f the Table 3. Reviewer #2: The study proposed to determine the DENV serotypes and genotypes of dengue cases in four public hospitals, however a low number of positives was obtained by molecular biology. With regard to genetic sequencing, few sample sequences were obtained, this may be related to the sequencing methodology for genomic analysis used to determine the genotypes. There is an important reference in the study that malaria was found in more than 70% of cases and people are co-infected with two denv serotypes, such as denv2 and denv3. The results are clear, with a lot of clinical information, which demonstrate good accuracy in data collection. This is relevant epidemiological information, as there is little data of this type in the study area, as endemic malaria makes it difficult to detect dengue cases. Studies of this type should be strengthened, as the clinical manifestations of dengue have caused serious conditions, such as dengue hemorrhagic fever and neurological alterations. Figures are of good quality, but the table 2 needs improvement in presentation, I suggest a subdivision within it, to separate population demographic characteristics from clinical manifestations. Reviewer #3: (No Response) -------------------- Conclusions -Are the conclusions supported by the data presented? -Are the limitations of analysis clearly described? -Do the authors discuss how these data can be helpful to advance our understanding of the topic under study? -Is public health relevance addressed? Reviewer #1: The conclusions provided by the authors are sounded, but little is discussed about the limitations of the study. The authors discussed that their results are relevant for public health in Africa and how the monitoring of virus could help preventing dengue outbreaks. Reviewer #2: The conclusion reports on the importance of arbovirus surveillance in urban areas in Africa, which is really important for public health. To improve viral surveillance, it is necessary to change the study algorithm, in order to have a closer phylogenetic profile of the genotypes, a greater number of sequences must be obtained, including using more sensitive methods, such as next-generation sequencing or at least larger partial sequences by Sanger. At no time were the limitations of the study reported, such as difficulties with methodologies. Phylogenetic analyzes are in agreement and provided important and reliable information, but for a more detailed study of genotypes it is necessary to increase the fragment size, as well as the number of sequences. Reviewer #3: (No Response) -------------------- Editorial and Data Presentation Modifications? Use this section for editorial suggestions as well as relatively minor modifications of existing data that would enhance clarity. If the only modifications needed are minor and/or editorial, you may wish to recommend “Minor Revision” or “Accept”. Reviewer #1: (No Response) Reviewer #2: Minor Revision: Review table 2, with division of demographic information from clinics. Reviewer #3: (No Response) -------------------- Summary and General Comments Use this section to provide overall comments, discuss strengths/weaknesses of the study, novelty, significance, general execution and scholarship. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. If requesting major revision, please articulate the new experiments that are needed. Reviewer #1: Some inconsistencies were observed in Results section and related tables; therefore, authors should clarify or rectify their statement in the text. Reviewer #2: Strength of the study: 1- Contribute to the knowledge of the situation of arboviruses in urban areas in Africa; 2- Identify circulating serotypes and genotypes; 3- Propose DENV surveillance in the study area, as three circulating serotypes were detected. Reviewer #3: The article proposed by SIMO TCHETGNA et al., acute febrile patients were presenting at hospitals between July and December 2020 for monitoring the circulation and co-circulation of DENV in Douala, Cameroon. Still, some details in the study queue should be taken into account: The quantity of dataset samples is not representative of the phylogenetic inference analyses. I recommend the authors check the phylogenetic signal of the dataset before carrying out the phylogenetic reconstructions, considering that it is only the envelope region of the virus, requiring a more extensive set of data to represent the cohesive statements of the cohesive statements the analyses. It would be interesting for the authors to check the introduction of serotypes. It is not common to have three dengue serotypes circulating in a small region of a country. What were the criteria used for the sequencing of the samples, considering that of the 41 positives, only nine samples were sequenced, only 21% were sequenced? Was there sequencing of co-infection samples between serotypes 2 and 3? I believe that the results need to be better worked to accept the article in the newspaper, so I don't recommend the article in its format. -------------------- PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files. If you choose “no”, your identity will remain anonymous but your review may still be made public. Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy. Reviewer #1: No Reviewer #2: No Reviewer #3: No Figure Files: While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email us at figures@plos.org. Data Requirements: Please note that, as a condition of publication, PLOS' data policy requires that you make available all data used to draw the conclusions outlined in your manuscript. Data must be deposited in an appropriate repository, included within the body of the manuscript, or uploaded as supporting information. This includes all numerical values that were used to generate graphs, histograms etc.. For an example see here: http://www.plosbiology.org/article/info%3Adoi%2F10.1371%2Fjournal.pbio.1001908#s5. Reproducibility: To enhance the reproducibility of your results, we recommend that you deposit your laboratory protocols in protocols.io, where a protocol can be assigned its own identifier (DOI) such that it can be cited independently in the future. Additionally, PLOS ONE offers an option to publish peer-reviewed clinical study protocols. Read more information on sharing protocols at https://plos.org/protocols?utm_medium=editorial-email&utm_source=authorletters&utm_campaign=protocols 16 Sep 2021 Submitted filename: Responses to the reviewers.docx Click here for additional data file. 28 Sep 2021 Dear Dr SIMO TCHETGNA, We are pleased to inform you that your manuscript 'Concurrent circulation of dengue serotype 1, 2 and 3 among acute febrile patients in Cameroon' has been provisionally accepted for publication in PLOS Neglected Tropical Diseases. Before your manuscript can be formally accepted you will need to complete some formatting changes, which you will receive in a follow up email. A member of our team will be in touch with a set of requests. Please note that your manuscript will not be scheduled for publication until you have made the required changes, so a swift response is appreciated. IMPORTANT: The editorial review process is now complete. PLOS will only permit corrections to spelling, formatting or significant scientific errors from this point onwards. Requests for major changes, or any which affect the scientific understanding of your work, will cause delays to the publication date of your manuscript. Should you, your institution's press office or the journal office choose to press release your paper, you will automatically be opted out of early publication. We ask that you notify us now if you or your institution is planning to press release the article. All press must be co-ordinated with PLOS. Thank you again for supporting Open Access publishing; we are looking forward to publishing your work in PLOS Neglected Tropical Diseases. Best regards, Marilia Sá Carvalho Associate Editor PLOS Neglected Tropical Diseases Amy Morrison Deputy Editor PLOS Neglected Tropical Diseases *********************************************************** 21 Oct 2021 Dear Dr SIMO TCHETGNA, We are delighted to inform you that your manuscript, "Concurrent circulation of dengue serotype 1, 2 and 3 among acute febrile patients in Cameroon," has been formally accepted for publication in PLOS Neglected Tropical Diseases. We have now passed your article onto the PLOS Production Department who will complete the rest of the publication process. All authors will receive a confirmation email upon publication. The corresponding author will soon be receiving a typeset proof for review, to ensure errors have not been introduced during production. Please review the PDF proof of your manuscript carefully, as this is the last chance to correct any scientific or type-setting errors. Please note that major changes, or those which affect the scientific understanding of the work, will likely cause delays to the publication date of your manuscript. Note: Proofs for Front Matter articles (Editorial, Viewpoint, Symposium, Review, etc...) are generated on a different schedule and may not be made available as quickly. Soon after your final files are uploaded, the early version of your manuscript will be published online unless you opted out of this process. The date of the early version will be your article's publication date. The final article will be published to the same URL, and all versions of the paper will be accessible to readers. Thank you again for supporting open-access publishing; we are looking forward to publishing your work in PLOS Neglected Tropical Diseases. Best regards, Shaden Kamhawi co-Editor-in-Chief PLOS Neglected Tropical Diseases Paul Brindley co-Editor-in-Chief PLOS Neglected Tropical Diseases
  51 in total

1.  Recent expansion of dengue virus serotype 3 in West Africa.

Authors:  L Franco; A Di Caro; F Carletti; O Vapalahti; C Renaudat; H Zeller; A Tenorio
Journal:  Euro Surveill       Date:  2010-02-18

2.  MEGA X: Molecular Evolutionary Genetics Analysis across Computing Platforms.

Authors:  Sudhir Kumar; Glen Stecher; Michael Li; Christina Knyaz; Koichiro Tamura
Journal:  Mol Biol Evol       Date:  2018-06-01       Impact factor: 16.240

3.  Evidence of Low-Level Dengue Virus Circulation in the South Region of Cameroon in 2018.

Authors:  Moctar M M Mouiche; Nkom F Ntumvi; Victorine T Maptue; Ubald Tamoufe; Bisse Albert; Valantine Ngum Ndze; Julius Nwobegahay; Amethyst Gillis; Matthew LeBreton; David J McIver; James A Ayukekbong; Karen Saylors; Edward M Rubin; Christian E Lange
Journal:  Vector Borne Zoonotic Dis       Date:  2020-01-14       Impact factor: 2.133

Review 4.  Dengue infection.

Authors:  Maria G Guzman; Duane J Gubler; Alienys Izquierdo; Eric Martinez; Scott B Halstead
Journal:  Nat Rev Dis Primers       Date:  2016-08-18       Impact factor: 52.329

5.  Beyond malaria--causes of fever in outpatient Tanzanian children.

Authors:  Valérie D'Acremont; Mary Kilowoko; Esther Kyungu; Sister Philipina; Willy Sangu; Judith Kahama-Maro; Christian Lengeler; Pascal Cherpillod; Laurent Kaiser; Blaise Genton
Journal:  N Engl J Med       Date:  2014-02-27       Impact factor: 91.245

6.  Recent emergence of dengue virus serotype 4 in French Polynesia results from multiple introductions from other South Pacific Islands.

Authors:  Van-Mai Cao-Lormeau; Claudine Roche; Maite Aubry; Anita Teissier; Stéphane Lastere; Elise Daudens; Henri-Pierre Mallet; Didier Musso; John Aaskov
Journal:  PLoS One       Date:  2011-12-28       Impact factor: 3.240

7.  Occurrence of 4 Dengue Virus Serotypes and Chikungunya Virus in Kilombero Valley, Tanzania, During the Dengue Outbreak in 2018.

Authors:  Beatrice Chipwaza; Robert David Sumaye; Maja Weisser; Winfrid Gingo; Nicholas Kim-Wah Yeo; Siti Naqiah Amrun; Fredros O Okumu; Lisa F P Ng
Journal:  Open Forum Infect Dis       Date:  2020-12-26       Impact factor: 3.835

8.  Emergence and global spread of a dengue serotype 3, subtype III virus.

Authors:  William B Messer; Duane J Gubler; Eva Harris; Kamalanayani Sivananthan; Aravinda M de Silva
Journal:  Emerg Infect Dis       Date:  2003-07       Impact factor: 6.883

9.  Global trends in emerging infectious diseases.

Authors:  Kate E Jones; Nikkita G Patel; Marc A Levy; Adam Storeygard; Deborah Balk; John L Gittleman; Peter Daszak
Journal:  Nature       Date:  2008-02-21       Impact factor: 49.962

10.  Risk of dengue in Central Africa: Vector competence studies with Aedes aegypti and Aedes albopictus (Diptera: Culicidae) populations and dengue 2 virus.

Authors:  Basile Kamgang; Marie Vazeille; Armel N Tedjou; Theodel A Wilson-Bahun; Aurélie P Yougang; Laurence Mousson; Charles S Wondji; Anna-Bella Failloux
Journal:  PLoS Negl Trop Dis       Date:  2019-12-30
View more
  1 in total

Review 1.  Concurrent dengue infections: Epidemiology & clinical implications.

Authors:  P D N N Sirisena; Shakuntala Mahilkar; Chetan Sharma; Jaspreet Jain; Sujatha Sunil
Journal:  Indian J Med Res       Date:  2021-05       Impact factor: 5.274

  1 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.