Morphological, molecular and MALDI-TOF MS identification of ticks and tick-associated pathogens in Vietnam.

Matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF MS) has been reported as a promising and reliable tool for arthropod identification, including the identification of alcohol-preserved ticks based on extracted leg protein spectra. In this study, the legs of 361 ticks collected in Vietnam, including 251 Rhiphicephalus sanguineus s.l, 99 Rhipicephalus (Boophilus) microplus, two Amblyomma varanensis, seven Dermacentor auratus, one Dermacentor compactus and one Amblyomma sp. were submitted for MALDI-TOF MS analyses. Spectral analysis showed intra-species reproducibility and inter-species specificity and the spectra of 329 (91%) specimens were of excellent quality. The blind test of 310 spectra remaining after updating the database with 19 spectra revealed that all were correctly identified with log score values (LSV) ranging from 1.7 to 2.396 with a mean of 1.982 ± 0.142 and a median of 1.971. The DNA of several microorganisms including Anaplasma platys, Anaplasma phagocytophilum, Anaplasma marginale, Ehrlichia rustica, Babesia vogeli, Theileria sinensis, and Theileria orientalis were detected in 25 ticks. Co-infection by A. phagocytophilum and T. sinensis was found in one Rh. (B) microplus.

Introduction

Ticks have been incriminated as the second most important vectors of human and animal infectious pathogens in the world after mosquitoes [1] and are able to transmit a wide range of pathogens, including bacteria, protozoans, viruses, and helminths [2]. In Southeast Asia (SEA), there are 104 known tick species, representing 12 genera, which is approximately 12% of all recognised and classified species [3]. Among them, Rhipicephalus sanguineus sensu lato (s.l.) are the most common ticks that parasitise dogs in SEA. These ticks are the ectoparasite vectors of bacterial and protozoal pathogens that can be transmitted to animals [4] and humans [5]. Rhipicephalus (Boophilus) microplus is an important vector of livestock pathogens [6]. Amblyomma (formerly Aponomma) varanensis, Dermacentor auratus, and Dermacentor compactus may act as vectors of infectious agents (e.g. Rickettsia spp., Anaplasma spp., Ehrlichia spp., Borrelia spp., Babesia spp. and Theileria spp.) to humans, and to domestic and wild animals in Malaysia, Laos, Thailand, and Vietnam [7-10].

In Vietnam, the agricultural sector makes up one-third of the developing nation’s economy [11], and livestock represents the second biggest contribution to household incomes after crop growing [12]. Despite the perceived food and economic benefits of livestock production, the country is potentially faced with challenges such as the emergence and re-emergence of zoonotic diseases, which can cause huge losses [13, 14]. One such example is the risk of infectious diseases spreading through the large number of dogs that are illegally imported into Vietnam from neighbouring countries for food consumption without any veterinary controls [15, 16]. In 2014, an outbreak of oriental theileriosis, which causes abortion and death, in imported cattle from Australia to Vietnam was associated with Theileria orientalis [17]. The serological detection of both Babesia bovis and Babesia bigemina parasite species transmitted by ticks has also been reported in cattle imported from Thailand [18].

Limited data is available on ticks and tick-associated pathogens in Vietnam. Nevertheless, 48 species of nine tick genera have been reported by Kolonin [19] and recently two new species of ticks of the genus Dermacentor (Dermacentor limbooliati and Dermacentor filippovae) have been described by Apanaskevich [9, 20]. Also in Vietnam, some tick-borne microorganisms have been reported in ticks and animals [19, 21–23], more precisely in Hepatozoon canis, Ehrlichia canis, and Babesia vogeli ticks [24].

In recent years, several studies have focused on acarology in Vietnam [4, 10, 25]. The correct identification of ticks is a crucial step in distinguishing tick vectors from non-vectors. The lack of reference data and standard taxonomic keys specific to Vietnamese tick species makes the morphological identification of Vietnamese ticks difficult or almost impossible. The morphological identification of tick species therefore remains a challenge for Vietnamese researchers [19]. Molecular tools have been used to overcome the limitations of morphological identification [26]. However, there are several drawbacks to these tools, which are time-consuming, expensive, and require primer-specific targeting [27-29].

Recently, the MALDI-TOF MS method has been proposed as an alternative and innovative tool to overcome the limitations of the above two methods in arthropod identification [30]. Since then, studies in several laboratories have demonstrated that MALDI-TOF MS is a remarkably robust tool for identifying many species of arthropod vectors and non-vectors [30]. The aim of this study was to identify tick species collected from domestic and wild animals in Vietnam and their associated pathogens using morphological, MALDI-TOF MS and molecular tools.

Materials and methods

Ethics statement

Ethical approval was obtained from the Institute of Malariology, Parasitology, and Entomology, Quy Nhon (IMPE-QN) on behalf of the Vietnamese Ministry of Health (approval no: 401/VSR-CT-2010, 333/CT-VSR-2018). Permission was obtained from the communal authorities for wild animals that were not listed in the Red Data Book of Vietnam, and agreement was obtained from the owners of cows, goats, and dogs.

Tick collection and morphological identification

Ticks were collected in four provinces: Quynh Luu (19o13’ N; 105o60’ E) District, Nghe An Province; Nam Giang (15o65’ N; 107o50’ E) District, Quang Nam Province; Van Canh (13o37’ N; 108o59’ E) District, Binh Dinh Province; and Khanh Vinh (12o16’ N; 108o53’ E) District, Khanh Hoa Province in Vietnam in September 2010, between April and September 2018. The map of Vietnam showing the collection sites was made with QGIS version 3.10 and the Vietnamese layers were downloaded from DIVA-GIS at the following link: https://www.diva-gis.org/datadown (Fig 1A). All engorged and non-engorged ticks were collected from the skin of domestic animals (cows, goats, and dogs) and wild animals (pangolins, wild pigs) using forceps. Ticks from wild animals were collected in a collaborative manner by rangers and trained care personnel from the Wildlife Rescue, Conservation and Development Center. Ticks were morphologically identified first at species level using dichotomous keys [9, 31] by an entomological team from the Institute of Malariology, Parasitology and Entomology, Quy Nhon, Vietnam (IMPE-QN). Ticks from the same host were counted and placed in the same tube containing 70% v/v alcohol, before being sent to the Institut Hospitalo-Universitaire (IHU) Méditerranée Infection in Marseille, France for MALDI-TOF MS and molecular analysis. In Marseille, the morphological identification of ticks was verified by two specialists in morphological identification of ticks using a magnifying glass (Zeiss Axio Zoom.V16, Zeiss, Marly le Roi, France) and dichotomous keys. Morphological identification was carried out only if all discriminating characters had been observed.

Fig 1

Map of Vietnam showing tick collection sites realised with QGIS version 3.10, the layers have been uploaded to the DIVA-GIS website: (A); Morphologically, the 70% alcohol tick-preserved species were collected in Vietnam over a period of 10 years: Amblyomma varanensis [♀: a, b]; Amblyomma sp. [♀: c, d]; Dermacentor auratus [♂: e, f]; Dermacentor compactus [♂: g, h]; and approximately 2 years: Rhipicephalus (B) microplus [♀: I, k]; Rhipicephalus sanguineus s.l [♂: l, m] (B).

Tick dissection and sample preparation

Ticks were individually removed from the alcohol and were rinsed and dissected with a sterile surgical blade, as previously described [32]. The four legs of each tick and the half part without legs were submitted for MALDI-TOF MS and molecular biology analysis, respectively. The remaining parts with legs were frozen and stored as samples for any further research.

DNA extraction and molecular identification of ticks

DNA from each half-tick or legs (for ticks from which we did not obtain sequences with half-tick DNA) was individually extracted using an EZ1 DNA tissue kit (Qiagen), according to the manufacturer’s recommendations, as previously described [33]. DNA was monitored with Nanodrop 1000 Spectrophotometer (Thermo Fisher Scientific, Wilmington, USA) and either immediately used or stored at -20°C until use.

DNA from ticks was submitted to standard PCR in an automated DNA thermal cycle to amplify a 465-base pair (bp) fragment of the mitochondrial 16S DNA gene, as described previously [34]. The 12S tick gene, amplifying about 405-bp of the mitochondrial DNA fragment, was used for all specimens for which we did not have a sequence with the 16S gene. DNA from Rh. sanguineus s.l., reared in our laboratory, was used as a positive control. Purified PCR products were sequenced as previously described [34]. The obtained sequences were assembled and analysed using the ChromasPro software (version 1.7.7) (Technelysium Pty. Ltd., Tewantin, Australia), and were then blasted against the reference sequences available in GenBank (http://blast.ncbi.nlm.nih.gov/).

MALDI-TOF MS analysis

Sample preparation

The four legs of each tick were first put into an Eppendorf tube and dried overnight at 37°C and then put into an Eppendorf tube with 40 μL of high-performance liquid chromatography (HPLC) grade water and incubated overnight at 37°C. The legs were then crushed in a mix of 20 μL of 70% (v/v) formic acid (Sigma) and 20 μL of 50% (v/v) acetonitrile (Fluka, Buchs, Switzerland), with glass beads (Sigma, Lyon, France), as described previously [35]. The crushed legs were centrifuged and 1 μL of the supernatant of each sample was deposited in quadruplicate onto a MALDI-TOF MS steel plate (Bruker Daltonics, Wissembourg, France). After drying at room temperature, 1μL of matrix solution composed of a saturated solution of α-cyano-4-hydroxycynnamic acid (Sigma, Lyon, France), 50% acetonitrile (v/v), 2. 5% trifluoroacetic acid (v/v) (Aldrich, Dorset, United Kingdom), and high performance liquid chromatography (HPLC) grade water was added [36]. The target plate was air-dried one more at room temperature before being introduced into the Microflex LT MALDI-TOF Mass Spectrometer (Bruker Daltonics, Germany) for analysis. The quality of the matrix, sample loading, and performance of the MALDI-TOF MS device were controlled using the legs of a Rh. sanguineus s.l. reared in our laboratory as a positive control.

MALDI-TOF MS parameters, spectral analysis and reference database creation

The spectral profiles obtained from the tick legs were visualised using a Microflex LT MALDI-TOF mass spectrometer with FlexControl software (version 3.3, Bruker Daltonics). The setting parameters of the MALDI-TOF MS apparatus were identical to those previously used [32].

The FlexAnalysis v.3.3 software was used to evaluate spectral quality (smoothing, baseline subtraction, peak intensities). MS spectra reproducibility was assessed by comparing the average spectral profiles (MSP, main spectrum profile) obtained from the four spots of each tick leg, according to species, using MALDI-Biotyper v3.0 software (Bruker Daltonics) [37]. MS spectra reproducibility and specificity were assessed based on a principal component analysis (PCA) and cluster analysis (MSP dendrogram). PCA was performed using ClinProTools v2.2 with the manufacturer’s default settings. Cluster analysis was performed based on a comparison of the MSP given by MALDI-Biotyper v3.0. software with clustering according to protein mass profile (i.e., their mass signals and intensities) [37].

Based on the morphological identification, eight and seven reference spectra of Rh. sanguineus and Rh. (B) microplus, respectively, were added to our MALDI-TOF MS database. However, two, one, and one spectra of D. auratus, Am. varanensis, D. compactus, respectively, which were only identified morphologically by three tick identification specialists, were also added to our MALDI-TOF MS database. To create a database, reference spectra (MSP, Main Spectrum Profile) were created by combining the results of spectra from specimens of each species using the automated function of the MALDI-Biotyper v3.0 software (Bruker Daltonics). MSPs were created based on an unbiased algorithm using peak position, intensity, and frequency data [38]. Four tick species that could not be identified by molecular biology were temporarily added into the MS reference database to identify the remaining specimens from the same species.

Blind test for tick identification

A blind test was performed with the remaining tick specimens not included in our MALDI-TOF MS database after the database had been upgraded with 19 MS spectra from specimens of the five tick species to determine their identification. The reliability of tick species identification was estimated using the log score values (LSVs) obtained from the MALDI-Biotyper software, which ranged from 0 to 3. These LSVs correspond to the degree of similarity between the MS reference spectra in the database and those submitted to blind tests. An LSV was obtained for each spectrum of the samples tested. According to one previous study [37], an LSV of at least 1.8 should be obtained to be considered reliable for species identification.

Detection of microorganisms

Quantitative PCR (qPCR) was performed for screening microorganisms using specific primers and probes targeting Anaplasmataceae, Piroplasmida, Borrelia spp., Bartonella spp., Coxiella burnetii, and Rickettsia spp. PCR reactions were performed according to the manufacturer’s instructions, using a CFX96 Touch detection system (Bio-Rad). qPCR amplification was performed using the thermal profile described previously [39]. The DNA of Rickettsia montanensis, Bartonella elizabethae, Anaplasma phagocytophilum, Coxiella burnetii, Borrelia crocidurae, and Babesia vogeli were used as a positive control and DNA from Rh. sanguineus s.l from our laboratory, which were free of bacteria, were used as negative controls. The samples were considered to be positive when the cycle threshold (Ct) was strictly less than 36 [40].

All samples that were positive following qPCR were submitted to standard PCR and sequencing to identify the microorganism species. For the Rickettsia sp. positive sample, we first used a primer targeting a 630-bp fragment of the OmpA gene [35] and then another targeting a 401-bp fragment of the gltA gene [33]. Samples which were Anaplasmataceae positive following qPCR were subjected to amplifying and sequencing of a 520-bp fragment of the 23S rRNA gene [33]. Samples which were Piroplasmidae positive following qPCR were subjected to amplifying and sequencing of a 969-bp fragment of the 18S rRNA [41]. Samples which were Borrelia sp. positive following qPCR was subjected to amplifying and sequencing of a 344-bp fragment of the flaB gene [42]. The primers and probes used in this study are listed in Table 1. The obtained sequences were assembled and analysed using the ChromasPro software (version 1.7.7) (Technelysium Pty. Ltd., Tewantin, Australia), and were then blasted against the reference sequences available in GenBank (http://blast.ncbi.nlm.nih.gov/). The method used for phylogenetic tree analysis was the neighbour-joining (NJ) method with 1,000 replicates. DNA sequences were aligned using MEGA software version 7.0 (https://www.megasoftware.net/). The various statistical analyses were performed using R software version 3.4 (R Development Core Team, R Foundation for Statistical Computing, Vienna, Austria) and ggplot packages were used to perform the graphics.

Table 1

Target amplified and used for qPCR and standard PCR.

Microorganisms	Targeted sequence	Primers (5’-3’) and Probes (Used for qPCR Screening or Sequencing)	References
Anaplasmataceae	23S	f_TGACAGCGTACCTTTTGCATr_GTAACAGGTTCGGTCCTCCAp_6FAM-GGATTAGACCCGAAACCAAG	[108]
	23S (520-bp)	f_ATAAGCTGCGGGGAATTGTCr_TGCAAAAGGTACGCTGTCAC
Piroplasmida	5.8S	f_AYYKTYAGCGRTGGATGTCr_TCGCAGRAGTCTKCAAGTCp_FAM-TTYGCTGCGTCCTTCATCGTTGT-MGB	[39]
	18S (969-bp)	f1_GCGAATGGCTCATTAIAACAf4_CACATCTAAGGAAGGCAGCAf3_GTAGGGTATTGGCCTACCG*r4_AGGACTACGACGGTATCTGA*
Rickettsia spp.	gltA(RKND03)	f_GTGAATGAAAGATTACACTATTTATr_GTATCTTAGCAATCATTCTAATAGCp_6FAM-CTATTATGCTTGCGGCTGTCGGTTC	[109]
	gltA (401-bp)	f_ATGACCAATGAAAATAATAATr_CTTATACTCTCTATGTACA	[110]
	OmpA (630-bp)	70_ATGGCGAATATTTCTCCAAAA701_GTTCCGTTAATGGCAGCATCT180_GCAGCGATAATGCTGAGTA*	[1]
Borrelia spp.	ITS4	f_GGCTTCGGGTCTACCACATCTAr_CCGGGAGGGGAGTGAAATAGp_TGCAAAAGGCACGCCATCACC	[111]
	flaB (344-bp)	f_TGGTATGGGAGTTTCTGGr_ TAAGCTGACTAATACTAATTACCC
Bartonella spp.	ITS2	f_GATGCCGGGGAAGGTTTTCr_GCCTGGGAGGACTTGAACCTp_GCGCGCGCTTGATAAGCGTG	[112]
Coxiellia burnetii	IS30A	f_CGCTGACCTACAGAAATATGTCCr_GGGGTAAGTAAATAATACCTTCTGGp_CATGAAGCGATTTATCAATACGTGTATG	[113]

Abbreviation

*, used for sequencing only.

Results

A total of 1120 ticks including 334 (30%) engorged ticks were collected in four provinces of Vietnam: Nghe An, Quang Nam, Binh Dinh, and Khanh Hoa. Morphologically, ticks were identified as belonging to six species (Fig 1A), including 935 (83.5%) Rh. sanguineus s.l. collected from dogs, 174 (15.5%) Rh. (B) microplus) from cows and goats, seven (0.6%) D. auratus from pangolins, two (0.2%) Am. varanensis from wild pigs, and one (0.1%) D. compactus and one (0.1%) Amblyomma sp. from a pangolin (Table 2). Rhipicephalus sanguineus s.l. and Rh. (B) microplus were collected between April and September 2018. The other ticks were collected in September 2010. The different specimens that could not be identified by molecular biology are shown in the pictures in Fig 1B that we took using a magnifying glass (Zeiss Axio Zoom.V16, Zeiss, Marly le Roi, France).

Table 2

The number of tick species used for MALDI-TOF MS analysis, creation of the MS reference spectra creation, and molecular biology confirmation.

Morphological identification	Number submitted for molecular ID*	Molecular ID* (%identity; GenBank accession number)	Number of good spectra/ tested	Number of spectra added to DB$	MADI-TOF MS ID* (number identified)	LSVs & [Low-High]
Rhipicephalus sanguineus s.l	8	Rh. sanguineus s.l (99.75–100%; MG651947, MG793434, KX632154)	241/251	8	Rh. sanguineus s.l (233)	[1.7–2.351]
Rhipicephalus (B) microplus	7	Rh. (B) microplus (100%; MN880401, MT462222, EU918187)	78/99	7	Rh. (B) microplus (71)	[1.705–2.346]
Amblyomma varanensis	1	not identified	1/2	1	NA	NA
Amblyomma sp.	1	not identified	1/1	0	Am.varanensis (1)	1.857
Dermacentor auratus	7	not identified	7/7	2	D. auratus (5)	[1.949–2.396]
Dermacentor compactus	1	not identified	1/1	1	NA	NA
Total	25		329/361	19	310

*Identification

& Range of log score values

$ Database.

Molecular identification of ticks

To confirm our morphological identification, 25 tick specimens were submitted to molecular analysis using the 16S rDNA gene, including eight specimens of Rh. sanguineus s.l., seven Rh. (B) microplus, seven D. auratus, one Am. varanensis, one D. compactus and one Amblyomma sp. Sequences were obtained only for the specimens of Rh. sanguineus s.l. and Rh. (B) microplus. BLAST analysis indicated that obtained sequences from Rh. sanguineus s.l. were 99.75 to 100% identical to the corresponding sequences of Rh. sanguineus s.l. (Genbank: MG651947, MG793434, KX632154) and those obtained from Rh. (B) microplus were 100% identical to the corresponding sequences of Rh. (B) microplus (Genbank: MN880401, MT462222, EU918187). Unfortunately, for the specimens morphologically identified as D. auratus, Am. varanensis, Amblyomma sp. and D. compactus, we were unable to amplify any DNA from the half-tick or legs of these tick species with PCR targeting part of the two genes (16S and 12S rDNA), despite the fact that the nanodrop had indicated that the amount of DNA contained in these samples was 7.8 to 19.4 ng/μl.

MS reference spectra analysis

The legs of 361 specimens, including 251 morphologically identified as Rh. sanguineus s.l., 99 Rh. (B) microplus, seven D. auratus, two Am. varanensis, one Amblyomma sp. and one D. compactus were randomly selected and subjected to MALDI-TOF MS analysis. Visualisation of MS spectra from all specimens using FlexAnalysis v.3.3 software showed that 91% (329) of specimens had excellent quality spectra (peak intensity > 3,000 a.u., no background noise and baseline subtraction correct) (Figs 2A and S1 and Table 2). The MS spectra of different specimens showed intra-species reproducibility and inter-species specificity, as confirmed by PCA (Figs 2B and 3B) and dendrogram (Fig 3A) analysis. PCA and dendrogram analysis showed that all specimens of the same species were grouped together or were on the same branches. Additionally, at the genus level, all specimens from the same genus were also gathered in the same part of dendrogram (Fig 3A).

Fig 2

Comparison of MALDI-TOF MS spectra from the legs of six tick species collected in Vietnam.

The MS spectra revealed intra-species reproducibility and inter-species specificity (A); The MS spectra were compared by Principal Component Analysis (B); a.u., arbitrary units; m/z, mass-to-charge ratio.

Fig 3

Comparison of MALDI-TOF MS spectra from the legs of six alcohol-preserved tick species collected in Vietnam and stored for different periods of time.

The dendrogram was built using between one and eight representative MS spectra from six distinct tick species (A). The MS spectra of different specimens showed intra-species reproducibility and inter-species specificity as confirmed by PCA (B).

MALDI-TOF MS tick identification by blind test

The 310 MS remaining spectra of excellent quality, including 233 Rh. sanguineus s.l, 71 Rh. (B) microplus, five D. auratus and one Amblyomma sp. were queried against our reference spectra database upgraded with eight Rh. sanguineus s.l. and seven Rh. (B) microplus which were morphologically and molecularly identified, and two D. auratus, one Am. varanensis and one D. compactus identified only morphologically. The spectra of the ticks introduced in the MALDI-TOF MS database have been deposited on the website of the University Hospital Institute (UHI) under the following DOI: https://doi.org/10.35088/rbqp-g648. The blind test revealed that 100% (233) of Rh. sanguineus s.l. specimens were correctly identified as Rh. sanguineus s.l. with LSVs ranging from 1.7–2.351 with a mean of 1.976 ± 0.137, 100% (71) of Rh. (B) microplus identified with LSVs ranging from 1.705–2.346 with a mean of 1.989 ± 0.148 and 100% (five) D. auratus with LSVs of 1.949–2.396 with a mean of 2.164 ± 0.149 (Table 2). The tick identified morphologically as Amblyomma sp. was identified by MALDI-TOF MS as Am. varanensis (LSV = 1.857) (Table 2). All our specimens were identified with LSVs ranging from 1.7–2.396 with a mean of 1.982 ± 0.142 and a median of 1.971, and 97% (301) had LSVs >1.8, which is considered the threshold for identification (Fig 3B). No blind test was performed for D. compactus because of the low number of specimens.

Detection of microorganisms in ticks

A total of 361 ticks, including 260 (72%) non-engorged and 101 (28%) engorged ticks, were examined for the DNA of six microorganisms using qPCR. Thirty-nine (10.8%) were positive for at least one of the microorganisms, including Anaplasmataceae, Rickettsia spp, Borrelia spp. and Piroplasmida (Table 3). Notably, two Rh. (B) microplus specimens were co-infected with both Anaplasmataceae and Piroplasmida. No samples were positive for C. burnetii or Bartonella spp.

Table 3

Microorganisms detected using molecular biology tools in ticks collected in Vietnam.

Microorganisms tested	Tick species
	Rh. sanguineus	Rh. (Bo) microplus	Amblyomma sp.	Total
Anaplasmataceae	2% (5/251)	13.1% (13/99)	-	5% (18/361)
Anaplasma phagocytophilum	-	1% (1/99)	-	0.3% (1/361)
Anaplasma platys	0.4% (1/251)	-	-	0.3% (1/361)
Anaplasma marginale	1.2% (3/251)	1% (1/99)	-	1.1% (4/361)
Ehrlichia rustica	-	1% (1/99)	-	0.3% (1/361)
Piroplasmida	4% (10/251)	10.1% (9/99)	-	5.3% (19/361)
Babesia vogeli	3.6% (9/251)	-	-	2.5% (9/361)
Theileria sinensis	-	6.1% (6/99)	-	1.7% 96/361)
Theileria orientalis	-	3% (3/99)	-	0.8% (3/361)
Rickettsia sp.	-	-	100% (1/1)	0.3% (1/361)
Borrelia sp.	0.4% (1/251)	-	-	0.3% (1/361)

DNA from bacteria of the Anaplasmataceae family were detected in 18/361 (5%) of ticks by qPCR. The DNA of bacteria belonging to the Anaplasmataceae family was found in 13 (72%) Rh. (B) microplus and five (28%) Rh. sanguineus s.l. We successfully obtained seven (40%) sequences all from Rh. (B) microplus by standard PCR and sequencing using the 23S Anaplasmataceae gene amplifying a 520-pb fragment of rRNA (Table 3). A BLAST analysis showed that four of the sequences obtained were 100% identical to the corresponding sequence of Anaplasma marginale (Genbank: CP023731), one of sequences obtained was 100% identical to the corresponding sequence of Ehrlichia rustica (Genbank: KT364330), one was 99.13% identical to the corresponding sequence of Anaplasma phagocytophilum (Genbank: CP015376) and one was 100% identical to the corresponding sequence of Anaplasma platys (Genbank: CP046391).

DNA of Piroplasmida was detected in 19/361 (5.3%) of ticks by qPCR using the 5.8S rRNA gene. Of these, ten (53%) were found in Rh. sanguineus s.l. and nine (47%) were found in Rh. (B) microplus. We successfully obtained 18 (95%) sequences by standard PCR and sequencing using the 18S rRNA gene amplifying a 969-pb fragment of rRNA. The BLAST analysis of nine sequences obtained from Rh. sanguineus s.l. revealed that they were between 99.75% and 100% identical to the corresponding sequence of Babesia vogeli (GenBank: MN067709), six sequences obtained from Rh. (B) microplus were between 99.82% and 100% identical to the corresponding sequences of Theileria sinensis (GenBank: KF559355, MT271911, AB000270) and three sequences obtained from Rh. (B) microplus were between 99.88 and 100% identical to the corresponding sequences of Theileria orientalis (GenBank: MG599099) (Table 3).

Rickettsia and Borrelia sp. were detected by qPCR in one tick of Amblyomma sp. and one of Rh. sanguineus s.l., respectively. However, all the standard PCR procedures for the identification of Rickettsia and Borrelia species failed. Of the 25 ticks for which we obtained sequences of microorganisms, 16 (64%) came from engorged ticks and one tick (4%) was co-infected with A. phagocytophilum and T. sinensis. The species of microorganism, the species of tick and the state of engorgement of the ticks in which the microorganisms were detected are listed in S1 Table.

Two phylogenetic trees of Anaplasmataceae and Piroplasmida were built from the 23S rRNA and 18S rRNA genes sequences of our amplicons, respectively. These phylogenetic trees showed that the microorganisms detected in this study are close to their homologues available in GenBank (Fig 4A and 4B).

Fig 4

23S rRNA gene-based phylogenetic analysis of strains identified in this study.

Phylogenetic tree highlighting the position of A. phagocytophilum, A. marginale, A. platys, and E. rustica identified in our study are close to their homologues available in GenBank (A). 18S rRNA gene-based phylogenetic analysis of strains identified in the present study. Phylogenetic tree highlighting the position of B. vogeli, T. sinensis, and T. orientalis relative to their correspondence available in GenBank (B).

Discussion

The correct identification of tick species and associated pathogens can contribute to improving vector control efforts adapted to the surveillance and prevention of outbreaks of tick-borne diseases. In this study, our ticks were identified using traditional methods (morphological) and then confirmed by molecular methods and MALDI-TOF MS, and the associated pathogens were researched using molecular tools. In this study, we combined these three tools to identify ticks and to search for microorganisms associated with these ticks collected in Vietnam.

In this study, the morphological identification of ticks collected in Vietnam revealed six species, including Rh. sanguineus s.l., Rh. (B) microplus, Am. varanensis, Amblyomma sp., D. auratus and D. compactus. All these species had already been reported in Vietnam [3, 19, 25] and neighbouring countries including Laos, Malaysia, Cambodia, and Thailand [3, 23, 43]. Among the Rh. sanguineus s.l. were the species most commonly found on dogs in Vietnam. This tick species is the most widely distributed worldwide and is known to be a vector of several pathogens such as Anaplasma, Rickettsia, Ehrlichia, and Babesia spp. [44, 45]. Rhipicephalus (Boophilus) microplus was collected from both cows and goats and is responsible for the transmission of livestock pathogens [6, 24]. There have been several reports of tick-borne livestock pathogens such as Anaplasma spp., Ehrlichia ruminantium, Babesia bigemina, Babesia bovis, and Theileria spp. [46-48]. However, this tick rarely bites humans [22]. Other tick species were collected from wild animals (pangolins and pigs). Several species of ticks of the genus Amblyomma have been collected from almost all species of pangolins [49, 50] and are vectors of Rickettsia, Ehrlichia spp. [51]. Recently, several studies reported Amblyomma javanense detected from pangolins in Singapore [52] and China [53], and Amblyomma compressum ticks on pangolins from Congo [54]. Our study is the first to observe Am. varanensis, Amblyomma sp. on pangolins from Vietnam. Dermacentor auratus, D. compactus are widely distributed across Sri Lanka, Bangladesh, India, and SEA including Vietnam [55, 56], and are well known vectors of Rickettsia, Coxiella burnetii, Borrelia, and Anaplasma spp. [57, 58].

Molecular techniques were used to confirm our morphological identification of tick species by amplifying a portion sequence of a 465-bp fragment 16S rRNA gene. The choice of the 16S rRNA gene was based on previous studies that reported that this gene was a reliable tool for tick identification [29, 59]. Interrogating the GenBank database with 16S rDNA sequences from Rh. sanguineus s.l and Rh. (B) microplus showed similarity with the reference sequences available in Genbank for these species that were stored in 70% alcohol for approximately two years. Conversely, we were unable to obtain sequences for all specimens that had been preserved for more than 10 years in alcohol (i.e., Am. varanensis, Amblyomma sp., D. auratus, and D. compactus) with the 16S and 12S rDNA genes. This might be due to the fact that the alcohol was not completely eliminated during extraction [60] and/or to the fact that these ticks contained blood from their host, which includes several factors that can inhibit the PCR reaction, as already reported [61].

In this study, MALDI-TOF MS was used to identify ticks collected in Vietnam from domestic and wild animals. Among the spectra of tick legs that were subjected to MS analysis, the correct identification rates (LSVs >1.8) were 97%, almost identical to the identification rate reported in other studies [32, 33, 62]. Interestingly, specimens that were not able to be identified by molecular biology were identified by MALDI-TOF MS. This confirms that the tool is reliable and accurate for the identification of ticks. Despite these numerous advantages, this technique is limited by the high cost of the device, although it can be used for clinical microbiology and mycology in addition to entomology, with no additional cost. Maintenance may be another limitation but this can be compensated for by the low cost of reagents once the device is acquired [30]. Secondly, the development of protocols, the choice of the arthropod compartment to be used, the spectra for the creation of the database and, finally, the methods and time of conservation of the arthropods can influence the performance of MALDI-TOF MS [30, 37, 63].

In this study, 10.8% of the ticks were positive for at least one of the microorganisms by qPCR, of which 16/25 (64%) of the ticks carrying DNA of microorganisms by sequencing were engorged ticks. The detection of microorganisms in engorged ticks doesn’t have the same epidemiological meaning as when detected in a questing or non-engorged attached tick. Such ticks may potentially have fed on hosts with bacteraemia, thus biasing the estimate of the actual rate of tick infestation.

The microorganisms detected in this study and confirmed by sequencing belong to the Anaplasmataceae family (A. phagocytophilum, A. marginale, A. platys, and E. rustica), which are known aetiologies of zoonotic diseases [8, 13, 64, 65]. The Piroplasmida family (B. vogeli, T. sinensis, and T. orientalis) was mainly known as the potential zoonotic pathogens [66].

Anaplasma marginale is responsible for bovine anaplasmosis and is an intracellular bacterium transmitted by tick species mainly belonging to the Rhipicephalus and Dermacentor genera [67]. The DNA and specific antibodies against A. marginale were previously reported in the blood of cattle and cows from Vietnam [23, 24]. This study is the first report of A. marginale in Rh. (B) microplus and Rh. sanguineus s.l ticks collected in Vietnam. However, A. marginale had previously been reported in cattle and cattle Rh. (B) microplus ticks in China [68], the Philippines [69] which is a neighbouring country to Vietnam, in cattle and cattle ticks in Malaysia [70], and many African countries [71].

Anaplasma platys, the aetiological agent of infectious canine cyclic thrombocytopenia and which can be transmitted by Rh. sanguineus s.l., A. platys has been recorded in China [48], Colombia [72], and detected on various ectoparasites such as Rh. (B) microplus [48] and Hyalomma dromedarii [73]. Anaplasma platys is one of the most significant tick-borne zoonotic pathogens [24, 74] and several cases of human infections have been described in Venezuela [75], Chicago [76], and South Africa [77]. Anaplasma platys has already been detected from blood specimens of cattle and dogs in Vietnam [24], but it was the first discovery in Rh. sanguineus s.l. ticks from Vietnam in our study. It had been previously detected in Rh. sanguineus s.l. in SEA [25], including in the Philippines [78], Thailand, and Malaysia [79, 80].

The pathogen A. phagocytophilum is the causative agent of human granulocytic anaplasmosis (HGA) and tick-borne fever in ruminants [81]. It is rarely found in Rh. (B) microplus and is known to be transmitted by the Ixodes tick genus [82]. Of the detected tick-borne diseases, A. phagocytophilum is the most important bacterium due to its wide distribution across Europe, Asia, and North America [83, 84], with several reports of human infections [85, 86]. This is the first study reporting the detection of A. phagocytophilum in Rh. (B) microplus ticks using the molecular method in Vietnam. It has also been described in the same tick species in China [87] and Malaysia [70].

We found Candidatus Ehrlichia rustica in the Ehrlichia chaffeensis group, the agent of human monocytic ehrlichiosis [88]. Canine ehrlichiosis was first recorded in a serological study in US military dogs serving in the Vietnam war [89]. The vectors of this pathogen are Rhipicephalus, Amblyomma, Dermacentor spp. [90]. Another study from 2003 reported that Ehrlichia spp., which gathered with E. chaffeensis, was also discovered in other species, such as Haemaphysalis hystricis from wild pigs in Vietnam [22], and Ixodes sinensis in China [91].

Babesia vogeli, the agent of canine babesiosis in North and South America, is transmitted by Rh. sanguineus s.l. and is the less pathogenic species. It is a protozoan found mainly in tropical or subtropical areas of northern, eastern and southern Africa, Asia, and northern and central Australia [92]. In SEA, B. vogeli has been described in Malaysia [93] and in the Philippines [94]. The molecular evidence of B. vogeli in Rh. sanguineus s.l. collected from dogs has been reported in Vietnam [4] and in ticks collected from East and Southeast Asia [25]. The DNA of B. vogeli was detected in this study in Rh. sanguineus s.l. ticks, confirming the presence of the protozoan in Vietnam.

Theileria sinensis, the causative agent of bovine theileriosis, causes economic losses and threats to the cattle industry. Theileria sinensis is primarily distributed throughout Asia (including China, the Korean Peninsula, Japan, and Malaysia [95-97]. It was identified in Haemaphysalis qinghaiensis ticks collected from cattle and yaks in China [98]. Theileria spp. were then detected in Haemaphysalis longicornis, Hyalomma (i.e., Hy. detritum, Hy. dromedarii, Hy. a. anatolicum, Hy.a asiaticum, Hy. rufipes), and Rhipicephalus sp. [99, 100]. Besides ticks, Theileria spp. were also detected in sheep, goat, and ruminant blood samples [101]. This is the first report of T. sinensis DNA in Rh. (B) microplus in Vietnam.

Similarly, Theileria orientalis, the causative agent of oriental theileriosis, is an economically significant protozoan which infects cattle [95]. Theileria orientalis is widely distributed in countries such as Japan [102], China [103], Indonesia [104], Australia [105], and New Zealand [95]. The Theileria orientalis species has been identified in Vietnam from blood samples from cattle, water buffalo, sheep, goats and Rh. (B) microplus ticks collected from these hosts [46]. Here, we showed the presence of 3% T. orientalis in Rh. (B) microplus collected from cows. Although Rh. (B) microplus is not recorded as a vector of T. orientalis, none of the common vectors Amblyomma, Dermacentor, and Haemaphysalis spp. [106] were detected in our work.

Rickettsia spp. and Borrelia spp. detected by qPCR in this study were not amplified and sequenced to confirm their species. As previously reported, this could be caused by the higher sensitivity of qPCR than standard PCR [107].

Co-infections in ticks usually occur after a blood meal from a host co-infected with different microorganisms. In this study, we reported for the first time the co-infection by A. phagocytophilum and T. sinensis in Rh. (B) microplus ticks. The coinfection rate of 0.3% (1/361) in this study is lower those that have been reported in the Côte d’Ivoire [71], and in Mali [33].

Conclusion

Our work indicates that MALDI-TOF MS is a useful and reliable tool for the identification of alcohol-preserved tick species which have undergone different storage periods collected in Vietnam. Our database demonstrates, for the first time, the prevalence of A. platys, A. phagocytophilum, A. marginale, E. rustica, and T. sinensis pathogens in ticks collected in Vietnam. Our finding should prompt further investigation to evaluate the potential risks of ticks and tick-associated pathogens in Vietnam. Furthermore, it shows that MALDI-TOF MS may be used as an alternative tool for identifying ticks infected or uninfected by pathogens in future studies.

Flow diagram of tick specimens which were included and analysed using MALDI-TOF MS and molecular tools.

(TIF)

Click here for additional data file.

The number of microorganisms were detecetd in engorged/non-engored ticks.

*: Tick was co-infections by two microoganisms.

(DOCX)

Click here for additional data file.

27 Jun 2021

Dear Pr. Parola,

Thank you very much for submitting your manuscript "Morphological, molecular and MALDI-TOF identification of ticks and tick-associated pathogens in Vietnam" for consideration at PLOS Neglected Tropical Diseases. As with all papers reviewed by the journal, your manuscript was reviewed by members of the editorial board and by several independent reviewers. In light of the reviews (below this email), we would like to invite the resubmission of a significantly-revised version that takes into account the reviewers' comments.

We cannot make any decision about publication until we have seen the revised manuscript and your response to the reviewers' comments. Your revised manuscript is also likely to be sent to reviewers for further evaluation.

When you are ready to resubmit, please upload the following:

[1] A letter containing a detailed list of your responses to the review comments and a description of the changes you have made in the manuscript. Please note while forming your response, if your article is accepted, you may have the opportunity to make the peer review history publicly available. The record will include editor decision letters (with reviews) and your responses to reviewer comments. If eligible, we will contact you to opt in or out.

[2] Two versions of the revised manuscript: one with either highlights or tracked changes denoting where the text has been changed; the other a clean version (uploaded as the manuscript file).

Important additional instructions are given below your reviewer comments.

Please prepare and submit your revised manuscript within 60 days. If you anticipate any delay, please let us know the expected resubmission date by replying to this email. Please note that revised manuscripts received after the 60-day due date may require evaluation and peer review similar to newly submitted manuscripts.

Thank you again for your submission. We hope that our editorial process has been constructive so far, and we welcome your feedback at any time. Please don't hesitate to contact us if you have any questions or comments.

Sincerely,

Lynn Soong, MD, PhD

Deputy Editor

PLOS Neglected Tropical Diseases

***********************

Reviewer's Responses to Questions

Key Review Criteria Required for Acceptance?

As you describe the new analyses required for acceptance, please consider the following:

Methods

-Are the objectives of the study clearly articulated with a clear testable hypothesis stated?

-Is the study design appropriate to address the stated objectives?

-Is the population clearly described and appropriate for the hypothesis being tested?

-Is the sample size sufficient to ensure adequate power to address the hypothesis being tested?

-Were correct statistical analysis used to support conclusions?

-Are there concerns about ethical or regulatory requirements being met?

Reviewer #1: Yes

Reviewer #2: - Ethical considerations: you mentioned obtaining authorizations for cows and dogs, but you also sampled goats. What about them?

- Tick collection: How were the wild animal trapped? And then how were they handled? Were they anesthetized? By whom?

- L170: How confident were you with your morphological identification to create your database solely based on it? Especially since morphological ID of ticks from Vietnam is so challenging. Please make it clear that morphological ID was only used alone when molecular ID wasn’t possible.

- L196: The commonly accepted positivity threshold for bacteria is 35 Ct, not 36. It can be higher for parasites, but you can’t increase it for all your microorganisms. Please correct the sentence and the number of actually positive samples. Also, use the appropriate reference here instead of a self-citation.

--------------------

Results

-Does the analysis presented match the analysis plan?

-Are the results clearly and completely presented?

-Are the figures (Tables, Images) of sufficient quality for clarity?

Reviewer #1: Yes

Reviewer #2: The results are overall well presented and match the analysis plan. I have however a few concerns listed below.

Main comment: it is critical to know which ticks were engorged. Detecting pathogens in a fully engorged tick clearly doesn’t have the same epidemiological meaning as detecting it in a questing or non-engorged attached tick. Please detail how many engorged ticks were included in the study and if the pathogens were detected in engorged/non-engorged ticks. Also, more effort should be put into the molecular identification of ticks.

- L235: Did you check if there was any DNA at all using a nanodrop for example? Ten years isn’t such a long time, DNA has been extracted from much older samples. Maybe some protocol optimization is needed. Have you tried extracting from a smaller sample? You might get some inhibition from the blood; the legs might be a better option. One leg is more than enough.

Table 1: Table 1 is not clear to me, especially the total line.

- Why is the total of the first column 329? Did you sequence 329 specimens?

--------------------

Conclusions

-Are the conclusions supported by the data presented?

-Are the limitations of analysis clearly described?

-Do the authors discuss how these data can be helpful to advance our understanding of the topic under study?

-Is public health relevance addressed?

Reviewer #1: Yes

Reviewer #2: The limitations of the study are barely addressed. This manuscript describes vector-borne bacteria associated with ticks but don't mention if these ticks were engorged with potentially bacteraemic blood. Moreover, the authors highlighted the superiority of MALDI-TOF MS compared to molecular biology in this particular case but failed to use an optimised molecular biology protocol. The data they are reporting might be of importance but some aspects of this manuscript lack thoroughness.

--------------------

Editorial and Data Presentation Modifications?

Use this section for editorial suggestions as well as relatively minor modifications of existing data that would enhance clarity. If the only modifications needed are minor and/or editorial, you may wish to recommend “Minor Revision” or “Accept”.

Reviewer #1: Require minor review of typographic errors throughout the manuscript.

Reviewer #2: The short title isn’t really shorter that the main title

ABSTRACT AND SUMMARY

- L32: “329 (91%) specimens were of excellent quality” I guess you mean the spectra of these 239 specimens were of excellent quality

- L34: Please indicate median value

INTRODUCTION

- L66: Ticks are not ectoparasites of pathogens, please correct this sentence

- L67: Arthropods transmit pathogens, not diseases, please correct

- L74: Rephrase. “Despite the perceived economic benefits of livestock farming, the country potentially faces challenges in terms of food safety risks and transmission of zoonotic diseases.”

- L85: Some important references are missing. Kolonin is only cited for the first time in your discussion. He wrote the only review on ticks of Vietnam and should be cited in your introduction. Nguyen et al. reported tick pathogens associated with Rh. sanguineus in Vietnam in 2019. Apanaskevich can also be mentioned for his recent new Vietnamese tick species descriptions.

- L87: “focused” please correct

METHODS

- L187: Please replace “detection of pathogens” by “detection of microorganisms”. You targeted Anaplasmataceae, those primers also amplify Wolbachia sp. which are not pathogens.

RESULTS

- L221: it’s only one tick so I imagine it’s one pangolin, not “pangolins” please correct

- L223: the morphological characteristics of the ticks are barely presented on Fig1. This is just a picture of the different ticks. To show the morphological criteria, please present them like Boucheikhchoukh et al. (CIMID 2018) or just rephrase.

- L242: “91% (329) of 242 specimens had excellent quality” One word is missing here… spectra I imagine?

- L264: “microorganisms” please correct

- L268: “or Bartonella” please correct

- L270: “The DNA of this bacterium” You’re talking about Anaplasmataceae, it’s a family of bacteria

DISCUSSION

- L310: Avoid abbreviating names at the beginning of a sentence. Correct throughout the manuscript

- L311: Again, vectors transmit pathogens, not diseases, please correct

- L315: “The Amblyomma genus is the most common tick species” So are you talking about or a genus or a species?

- L318: I imagine there’s a typo here and you’re talking about A. compressum?

- L331-332: You can use the remaining legs for molecular biology to limit PCR inhibition

- L337: “to be identified” please correct

- L348: “which are known etiologies of zoonotic diseases” please correct

- L353: “antibodies against A. marginale” please correct

- L354: “the first report” please correct

- L414: “MALDI-TOF MS” please check throughout the manuscript that you’ve added “MS” after “MALDI-TOF”

- L408: Please cite an original paper reporting the difference of sensitivity between qPCR and standard PCR. Diarra et al. simply cited this too.

Author contributions: contribution of Jean Michel Berenger is missing

Reference list: please check format of references 33, 39, 43, 48

TABLES

Table 1:

- Please add to your manuscript that no blind test was performed for D. compactus because of the low number of specimens.

- Dermacentor was abbreviated “D” throughout the manuscript (which is the validated abbreviation), please keep this abbreviation in the table

- Head of column 5: “MALDI-TOF MS”

Table 2:

- Anaplasmataceae and Piroplasmida shouldn’t be italicized

- Please add “spp.” after genus names

- Where is the reference for the Borrelia spp. ITS4 primers?

- Please correct “Correlia burnettii”

Table 3: “sp” shouldn’t be italicized

Dendrogram: Use validated abbreviations for species names

--------------------

Summary and General Comments

Use this section to provide overall comments, discuss strengths/weaknesses of the study, novelty, significance, general execution and scholarship. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. If requesting major revision, please articulate the new experiments that are needed.

Reviewer #1: The manuscript describes a comparative evaluation of morphological, molecular and MALDI-TOF identification of tick species collected in Vietnam and preserved long term in 70% alcohol. Also, identify microorganisms associated with those ticks using molecular methods. Results indicated that the MALDI-TOF is a potential useful and reliable tool for the identification of alcohol-preserved tick species.

Reviewer #2: This manuscript by Philippe Parola and co-authors is another confirmation of the reliability of MALDI-TOF MS for the identification of ticks collected in the field. It also reports pathogenic microorganisms in these ticks in Vietnam for the first time. Considering the scarcity of studies on tick-borne diseases in Vietnam and neighbouring countries, such data is always welcome. Nevertheless, a few things need to be addressed. The authors really need to clarify which pathogens were detected from engorged ticks as the epidemiological hypotheses are very different from those we formulate when studying questing ticks. I would also like to see some effort from the authors to refine their molecular biology assays. We all struggle sometimes to sequence some specimens, but extracting the DNA from tick halves (possibly engorged ones)and stopping there doesn't look like much effort. I added some suggestions in my specific comments but many others are available in the literature. On another note, I also think the authors should pay attention to the number of self-citations. I am not referring to MALDI-TOF MS papers, as I am well aware that the authors were among the first ones to apply this technique to entomology. The authors tend however to not cite appropriate references but instead cite their previous papers where they made similar statements. This is not appropriate and needs to be corrected throughout the manuscript. Finally, the English of the manuscript really needs to be improved.

--------------------

PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.

If you choose “no”, your identity will remain anonymous but your review may still be made public.

Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.

Reviewer #1: No

Reviewer #2: No

Figure Files:

While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email us at figures@plos.org.

Data Requirements:

Please note that, as a condition of publication, PLOS' data policy requires that you make available all data used to draw the conclusions outlined in your manuscript. Data must be deposited in an appropriate repository, included within the body of the manuscript, or uploaded as supporting information. This includes all numerical values that were used to generate graphs, histograms etc.. For an example see here: http://www.plosbiology.org/article/info%3Adoi%2F10.1371%2Fjournal.pbio.1001908#s5.

Reproducibility:

To enhance the reproducibility of your results, we recommend that you deposit your laboratory protocols in protocols.io, where a protocol can be assigned its own identifier (DOI) such that it can be cited independently in the future. Additionally, PLOS ONE offers an option to publish peer-reviewed clinical study protocols. Read more information on sharing protocols at https://plos.org/protocols?utm_medium=editorial-email&utm_source=authorletters&utm_campaign=protocols

13 Sep 2021

Submitted filename: renamed_63381.pdf

Click here for additional data file.

13 Sep 2021

Dear Pr. Parola,

We are pleased to inform you that your manuscript 'Morphological, molecular and MALDI-TOF MS dentification of ticks and tick-associated pathogens in Vietnam' has been provisionally accepted for publication in PLOS Neglected Tropical Diseases.

Before your manuscript can be formally accepted you will need to complete some formatting changes, which you will receive in a follow up email. A member of our team will be in touch with a set of requests.

Please note that your manuscript will not be scheduled for publication until you have made the required changes, so a swift response is appreciated.

IMPORTANT: The editorial review process is now complete. PLOS will only permit corrections to spelling, formatting or significant scientific errors from this point onwards. Requests for major changes, or any which affect the scientific understanding of your work, will cause delays to the publication date of your manuscript.

Should you, your institution's press office or the journal office choose to press release your paper, you will automatically be opted out of early publication. We ask that you notify us now if you or your institution is planning to press release the article. All press must be co-ordinated with PLOS.

Thank you again for supporting Open Access publishing; we are looking forward to publishing your work in PLOS Neglected Tropical Diseases.

Best regards,

Lynn Soong, MD, PhD

Deputy Editor

PLOS Neglected Tropical Diseases

***********************************************************

23 Sep 2021

Dear Pr. Parola,

We are delighted to inform you that your manuscript, " Morphological, molecular and MALDI-TOF MS identification of ticks and tick-associated pathogens in Vietnam," has been formally accepted for publication in PLOS Neglected Tropical Diseases.

We have now passed your article onto the PLOS Production Department who will complete the rest of the publication process. All authors will receive a confirmation email upon publication.

The corresponding author will soon be receiving a typeset proof for review, to ensure errors have not been introduced during production. Please review the PDF proof of your manuscript carefully, as this is the last chance to correct any scientific or type-setting errors. Please note that major changes, or those which affect the scientific understanding of the work, will likely cause delays to the publication date of your manuscript. Note: Proofs for Front Matter articles (Editorial, Viewpoint, Symposium, Review, etc...) are generated on a different schedule and may not be made available as quickly.

Soon after your final files are uploaded, the early version of your manuscript will be published online unless you opted out of this process. The date of the early version will be your article's publication date. The final article will be published to the same URL, and all versions of the paper will be accessible to readers.

Thank you again for supporting open-access publishing; we are looking forward to publishing your work in PLOS Neglected Tropical Diseases.

Best regards,

Shaden Kamhawi

co-Editor-in-Chief

PLOS Neglected Tropical Diseases

Paul Brindley

co-Editor-in-Chief

PLOS Neglected Tropical Diseases