Literature DB >> 34351906

Recovery from heat shock requires the microRNA pathway in Caenorhabditis elegans.

Delaney C Pagliuso1, Devavrat M Bodas1,2, Amy E Pasquinelli1.   

Abstract

The heat shock response (HSR) is a highly conserved cellular process that promotes survival during stress. A hallmark of the HSR is the rapid induction of heat shock proteins (HSPs), such as HSP-70, by transcriptional activation. Once the stress is alleviated, HSPs return to near basal levels through incompletely understood mechanisms. Here, we show that the microRNA pathway acts during heat shock recovery in Caenorhabditis elegans. Depletion of the miRNA Argonaute, Argonaute Like Gene 1 (ALG-1), after an episode of heat shock resulted in decreased survival and perdurance of high hsp-70 levels. We present evidence that regulation of hsp-70 is dependent on miR-85 and sequences in the hsp-70 3'UTR that contain target sites for this miRNA. Regulation of hsp-70 by the miRNA pathway was found to be particularly important during recovery from HS, as animals that lacked miR-85 or its target sites in the hsp-70 3'UTR overexpressed HSP-70 and exhibited reduced viability. In summary, our findings show that down-regulation of hsp-70 by miR-85 after HS promotes survival, highlighting a previously unappreciated role for the miRNA pathway during recovery from stress.

Entities:  

Mesh:

Substances:

Year:  2021        PMID: 34351906      PMCID: PMC8370650          DOI: 10.1371/journal.pgen.1009734

Source DB:  PubMed          Journal:  PLoS Genet        ISSN: 1553-7390            Impact factor:   5.917


Introduction

The heat shock response is a broadly conserved cellular mechanism that is activated to help organisms survive stress [1]. Various types of stress including heat shock, oxidative stress, infection, and tumorigenesis can trigger the heat shock response (HSR) [2,3]. Upon encountering stress, proteins can misfold and form harmful aggregates, which have the potential to cause cell death if not ameliorated [4-6]. To maintain protein homeostasis (proteostasis), the HSR stimulates a transient yet robust reprogramming of cellular activities, coupling a general decline in transcription and translation with the specific induction of molecular chaperones known as heat shock proteins (HSPs) [7-9]. Upon stress, activation of the transcription factor HSF1 (Heat Shock Factor 1) drives the accumulation of HSPs, which aid in restoring proteostasis and are, thus, integral to organismal survival [10]. Many HSPs have a diversity of cellular functions under both stressful and non-stressful conditions that revolve around mediating protein folding, stability and complex formation [11,12]. This group includes HSP70, which is constitutively expressed in most cell types but is robustly induced by heat shock and other types of stress. While up-regulation of HSP70 upon stress is primarily a result of HSF1 dependent transcription, less is understood about how HSP70 levels return to basal levels after stress [13]. Studies in Drosophila and human cells have documented the rapid induction and subsequent decline of Hsp70 transcripts during the HSR. Destabilization of Hsp70 mRNA after return to ambient temperatures is regulated post-transcriptionally and involves yet to be defined 3’UTR sequences and trans-acting factors [14-17]. In addition to the transcriptional reprogramming of protein coding genes elicited upon HS, microRNAs (miRNAs) have also been reported to respond to HS. MiRNAs are short, ~22 nucleotide non-coding RNAs that guide Argonaute (AGO) proteins to target mRNAs, triggering destabilization through imperfect base pairing [18]. In Caenorhabditis elegans, ALG-1 (AGO-Like Gene 1) is broadly expressed and binds most miRNAs [19]. Specific C. elegans miRNAs have been observed to be up- or down-regulated during HS [20-22], suggesting roles in the HSR. Moreover, deletion of miR-71 or miR-246 results in reduced HS survival [23]. Despite the identification of individual miRNAs that influence HS survival, much is yet to be learned about specific roles and targets of miRNAs during stress. In this study, we demonstrate a role for the miRNA pathway in the recovery phase following heat shock in C. elegans. Removal of ALG-1 after HS resulted in reduced survival and perdurance of higher hsp-70 levels. We found that efficient down-regulation of hsp-70 after an episode of HS also requires miR-85 and the hsp-70 3’UTR, which contains two miR-85 binding sites. Moreover, animals lacking miR-85 or its binding sites in the hsp-70 3’UTR exhibited greater sensitivity to HS. The reduced survival of these strains was dependent on hsp-70 expression, as knock down of hsp-70 by RNA interference (RNAi) after HS restored viability to WT levels. Altogether, we show that in C. elegans down-regulation of hsp-70 after HS is facilitated by miR-85 and is important for organismal survival.

Results

The microRNA pathway is important for recovery after heat shock

To investigate the role of the miRNA pathway in the C. elegans heat shock response (HSR), we first tested if Argonaute Like Gene 1 (ALG-1) was important for survival after exposure to elevated temperatures. Populations of wild type (WT) and alg-1(gk214) loss-of-function mutants were subjected to 4 hrs of HS at 35°C, and the percent survival was calculated after allowing the animals to recover for 24 hrs at 20°C. Under these conditions, about 60% of the WT and only 30% of the alg-1(gk214) animals survived (Fig 1A). Loss of alg-2, the most closely related homolog to alg-1 in C. elegans [24], did not affect survival in this HS assay (S1A Fig). Although alg-1(gk214) animals are entirely viable during this time course when maintained at 20°C (S1B Fig), this strain does exhibit moderate developmental defects [19,24,25], reduced fertility [19,26,27,28] and a shortened lifespan [29]. To avoid pre-existing defects that might make alg-1(gk214) more sensitive to HS, we utilized the auxin-inducible degron (AID) system to remove ALG-1 upon HS treatment [30]. Four hours of auxin treatment in the CTL (20°C) or HS (35°C) conditions was sufficient to deplete ALG-1 protein, as judged by Western Blotting (Fig 1B). Removal of ALG-1 during HS resulted in reduced levels of survival, comparable to the alg-1(gk214) strain (Fig 1A). Given the dramatic auxin-induced depletion of AID::ALG-1, we considered that the reduced viability phenotype could be due to a requirement for ALG-1 during HS or in the recovery period. To test if ALG-1 is needed for recovery from HS, we performed a similar HS viability experiment but instead moved AID::ALG-1 animals to auxin-containing media for the 24 hr recovery period following HS. Loss of ALG-1 after HS resulted in decreased survival compared to WT or the AID::ALG-1 strain in the absence of auxin (Fig 1C). The auxin-induced depletion of AID::ALG-1 was confirmed by Western blot analysis of control and HS-treated animals (Fig 1D). Importantly, auxin treatment (during HS or during recovery) of WT and alg-1(gk214) animals did not alter average HS survival of these strains compared to average survival scores for no auxin controls (S1C Fig). Additionally, to control for potential stress induced by moving animals to new plates for auxin treatment, all strains, regardless of condition, were moved to fresh plates. While our results do not rule out a role for ALG-1 activity during HS, they do demonstrate that ALG-1 and, by inference, the microRNA pathway contribute to the recovery phase following HS.
Fig 1

The microRNA pathway is important for recovery after heat shock.

A. Loss of alg-1 activity during HS results in reduced viability. Heat shock treatment was performed on synchronized L4 worms for 4 hrs at 35°C and percent survival was determined after 24 hrs recovery at 20°C. The AID::ALG-1 strain was exposed to auxin during the 4 hr HS period. Three biological replicates were performed with at least 50 worms per strain, per condition. Student’s t-tests were performed to determine significance compared to WT (***P < 0.001). B. Western blot of ALG-1 protein levels in synchronized L4 AID::ALG-1 worms collected at CTL (20°C) or immediately after 4 hr HS (35°C) in the absence or presence of auxin during the same 4 hr period. C. Loss of alg-1 activity during recovery after HS results in reduced viability. Heat shock treatment was performed on synchronized L4 worms for 4 hrs at 35°C and percent survival was determined after 24 hrs recovery at 20°C. The AID::ALG-1 strain was placed on auxin immediately after HS during the 24 hr recovery period. Three biological replicates were performed with at least 50 worms per strain, per condition. Student’s t-tests were performed to determine significance compared to WT (*P < 0.05, ***P < 0.001). D. Western blot of ALG-1 protein levels in synchronized AID::ALG-1 worms collected after 24 hrs of recovery post HS treatment or kept at CTL (20°C) in the absence or presence of auxin during the recovery period. E. RT-qPCR of hsp-70 mRNA after 24 hr recovery from HS in WT and AID::ALG-1 recovered in the absence or presence of auxin. All replicates were normalized to ama-1 mRNA levels, which are not affected by HS. Three biological replicates were assayed. Student’s t-tests were performed to determine significance relative to WT (***P < 0.001). F. Depiction of predicted mir-85 target sites in the hsp-70 3’UTR based on Target Scan Worm. Site 1 is conserved and Site 2 is poorly conserved [31]. G. Gene ontology (GO) enrichment analysis of mir-85 predicted targets from Target Scan Worm (n = 133) using DAVID [32].

The microRNA pathway is important for recovery after heat shock.

A. Loss of alg-1 activity during HS results in reduced viability. Heat shock treatment was performed on synchronized L4 worms for 4 hrs at 35°C and percent survival was determined after 24 hrs recovery at 20°C. The AID::ALG-1 strain was exposed to auxin during the 4 hr HS period. Three biological replicates were performed with at least 50 worms per strain, per condition. Student’s t-tests were performed to determine significance compared to WT (***P < 0.001). B. Western blot of ALG-1 protein levels in synchronized L4 AID::ALG-1 worms collected at CTL (20°C) or immediately after 4 hr HS (35°C) in the absence or presence of auxin during the same 4 hr period. C. Loss of alg-1 activity during recovery after HS results in reduced viability. Heat shock treatment was performed on synchronized L4 worms for 4 hrs at 35°C and percent survival was determined after 24 hrs recovery at 20°C. The AID::ALG-1 strain was placed on auxin immediately after HS during the 24 hr recovery period. Three biological replicates were performed with at least 50 worms per strain, per condition. Student’s t-tests were performed to determine significance compared to WT (*P < 0.05, ***P < 0.001). D. Western blot of ALG-1 protein levels in synchronized AID::ALG-1 worms collected after 24 hrs of recovery post HS treatment or kept at CTL (20°C) in the absence or presence of auxin during the recovery period. E. RT-qPCR of hsp-70 mRNA after 24 hr recovery from HS in WT and AID::ALG-1 recovered in the absence or presence of auxin. All replicates were normalized to ama-1 mRNA levels, which are not affected by HS. Three biological replicates were assayed. Student’s t-tests were performed to determine significance relative to WT (***P < 0.001). F. Depiction of predicted mir-85 target sites in the hsp-70 3’UTR based on Target Scan Worm. Site 1 is conserved and Site 2 is poorly conserved [31]. G. Gene ontology (GO) enrichment analysis of mir-85 predicted targets from Target Scan Worm (n = 133) using DAVID [32]. In contrast to the well-studied transcriptional induction of genes that respond to HS, much less is known about how gene expression changes during recovery from this stress [16,33]. There is evidence that in Drosophila S2 cells the HS-induced gene Hsp70 is subject to post-transcriptional down-regulation during recovery through a yet to be defined mechanism [15,16,34]. Under our heat shock conditions, hsp-70 (C12C8.1) mRNA is up-regulated over 100-fold and recovers to baseline levels within 24 hrs of return to the control temperature (S1D Fig). However, depletion of ALG-1 after HS resulted in significantly higher levels of hsp-70 mRNA relative to control strains that maintained expression of ALG-1 (Fig 1E). A requirement for ALG-1 in the down-regulation of hsp-70 following HS raised the possibility that it could be targeted by a miRNA. Using the miRNA target prediction tool TargetScanWorm, we identified two predicted miR-85 binding sites in the 3’UTR of hsp-70 (Fig 1F) [31]. While additional miRNAs are predicted to target hsp-70, miR-85 was the only miRNA with a target site conserved in other nematodes. Furthermore, gene ontology (GO) enrichment analysis using DAVID [32] revealed that the most enriched molecular functions of the 133 predicted miR-85 targets include protein folding chaperone, misfolded protein binding, and heat shock protein binding (Fig 1G). The predicted binding sites within the 3’UTR of hsp-70 and the potential for targeting other stress response genes focused our attention on miR-85 as a candidate for functioning in the HSR.

miR-85 regulates genes in stress response pathways

Since miRNA regulation often results in target mRNA degradation [18,35,36], we predicted that hsp-70 and potentially other stress response target genes might be up-regulated in the absence of miR-85. To test this idea, we performed total RNA sequencing of RNA from last larval stage (L4) WT and miR-85(n4117) animals cultured at 20°C and identified differentially expressed genes using DESeq2 [37]. Consistent with the lack of obvious developmental defects in the miR-85 deletion mutants [38], few genes were up- (61 genes) or down-regulated (76 genes) by at least 2-fold in miR-85(n4117) compared to WT (S1 Table). Strikingly, within the set of up-regulated genes, hsp-70 and several other stress responsive genes were highly over-expressed in the miR-85(n4117) mutants (Fig 2A). Additionally, stress response and transit peptide were the only two terms identified among the upregulated genes by GO enrichment analysis using DAVID [32] (Fig 2B). Although the enrichment of these terms was modest, this finding is consistent with a role for miR-85 in regulating stress response genes. Down-regulated genes were enriched for terms associated with collagen, nucleosome assembly and modification, and signaling.
Fig 2

mir-85 regulates genes in stress response pathways.

A. Volcano plot of differentially expressed PCGs in WT and miR-85(n4117) animals synchronized to L4 at 20°C. Three biological replicates were used for RNA sequencing analysis. Genes were considered significant if they had a base mean > 10, Log2FC +/- 1, and p-adj. < 0.05. B. Gene ontology enrichment analysis of PCGs up-regulated in loss of miR-85 animals vs WT (n = 61) using DAVID [32]. C. Venn-diagram of miR-85 predicted targets from TargetScanWorm [31] and PCGs up-regulated in loss of miR-85 animals. Hsp-70 is the only gene identified in both groups. D. Depiction of the hsp-70 3’UTR with miR-85 target sites in bold and deletion region in the hsp-70ΔTS animals marked in red. E. RT-qPCR of hsp-70 mRNA in WT, miR-85(n4117), and hsp-70ΔTS animals. All replicates were normalized to ama-1 mRNA. Relative expression was calculated by comparing to hsp-70 expression in WT. Three biological replicates were assayed. Student’s t-tests were performed to determine significance compared to WT (**P < 0.01, ***P < 0.001). Error bars represent SEM.

mir-85 regulates genes in stress response pathways.

A. Volcano plot of differentially expressed PCGs in WT and miR-85(n4117) animals synchronized to L4 at 20°C. Three biological replicates were used for RNA sequencing analysis. Genes were considered significant if they had a base mean > 10, Log2FC +/- 1, and p-adj. < 0.05. B. Gene ontology enrichment analysis of PCGs up-regulated in loss of miR-85 animals vs WT (n = 61) using DAVID [32]. C. Venn-diagram of miR-85 predicted targets from TargetScanWorm [31] and PCGs up-regulated in loss of miR-85 animals. Hsp-70 is the only gene identified in both groups. D. Depiction of the hsp-70 3’UTR with miR-85 target sites in bold and deletion region in the hsp-70ΔTS animals marked in red. E. RT-qPCR of hsp-70 mRNA in WT, miR-85(n4117), and hsp-70ΔTS animals. All replicates were normalized to ama-1 mRNA. Relative expression was calculated by comparing to hsp-70 expression in WT. Three biological replicates were assayed. Student’s t-tests were performed to determine significance compared to WT (**P < 0.01, ***P < 0.001). Error bars represent SEM. As hsp-70 was the only predicted miR-85 target up-regulated in miR-85 Mutants (Fig 2C), it stood out as a prospective candidate for direct regulation by miR-85. To explore this possibility, we used CRISPR-Cas9 to generate a deletion in the hsp-70 3’UTR that removes both miR-85 target sites (hsp-70ΔTS) (Fig 2D). Like miR-85 mutants, The hsp-70ΔTS strain did not exhibit any obvious developmental abnormalities (S2A Fig). We then examined relative hsp-70 mRNA levels by RT-qPCR in WT, miR-85(n4117), and hsp-70ΔTS L4 stage animals cultured at 20°C. Consistent with the RNA sequencing results, hsp-70 mRNA was up-regulated ~2-fold in miR-85(n4117) compared to WT animals (Fig 2E). The hsp-70ΔTS animals exhibited a similar level of hsp-70 mRNA overexpression relative to WT (Fig 2E). These results show that miR-85 and the 3’UTR of hsp-70 are important for regulating the levels of hsp-70 during optimal temperature (20°C) conditions in C. elegans.

miR-85 regulates hsp-70 during recovery from heat shock

We next asked if miR-85 also plays a role in regulating hsp-70 as part of the heat shock response. Despite higher basal levels of hsp-70 mRNA in miR-85(n4117) animals (Fig 2D), after 3 hrs of HS at 35°C we detected no significant difference in hsp-70 mRNA in miR-85(n4117) compared to WT animals (Fig 3A, 0 hr time point). HSP-70 protein also accumulated to similar levels immediately following HS, with no Detectable difference in miR-85(n4117) compared to WT (Fig 3B, 0 hr time point). In addition, RNA sequencing after 3 hrs of HS at 35°C revealed very few differences in gene expression with only 4 up- and 9 down-regulated genes (Fig 3C, S1 Table). Given the similar gene expression profiles in WT and miR-85 strains during HS, we wondered if this congruence might be explained by reduced miR-85 levels in response to HS. This does not seem to be the case as Northern blot analysis showed that miR-85 levels were maintained in HS conditions (Fig 3D). Similar to miR-85(n4117), the hsp-70ΔTS animals expressed hsp-70 mRNA and protein at levels comparable to WT (Fig 3A and 3F, 0 hr time point). These results indicate that the robust induction of hsp-70 upon HS is not influenced by miR-85 or the hsp-70 3’UTR.
Fig 3

miR-85 regulates hsp-70 during recovery from heat shock.

A. RT-qPCR of hsp-70 mRNA in WT, mir-85(n4117), and hsp-70ΔTS animals after 3 hr HS at 35°C and allowed to recover at 20°C for 4, 16, and 24 hrs at 20°C. All replicates were normalized to ama-1 mRNA. Three biological replicates were assayed. Student’s t-tests were performed to determine significance relative to levels immediately after HS (0 hr) in WT animals (*P < 0.05, ***P < 0.001). Compared to the WT 0 hr time point, mir-85(n4117) showed no significant difference in hsp-70 mRNA levels through the recovery time course. Error bars represent SEM. B. Western blot of HSP-70 protein levels in WT and miR-85(n4117) animals subjected to 3 hr HS at 35°C and allowed to recover at 20°C for 4, 16, and 24 hrs at 20°C. Tubulin was used as a loading control. C. Volcano plot of differentially expressed PCGs in WT and miR-85(n4117) animals synchronized to L4 and heat shocked for 3 hrs at 35°C. Three biological replicates were used for RNA sequencing analysis. Genes were considered significant if they had a base mean > 10, Log2FC +/- 1, and p-adj. < 0.05. D. Northern blot of RNA from L4 synchronized WT animals maintained at 20°C (CTL) or after 3 hrs of HS at 35°C, and collected 24 hrs later from CTL and HS animals recovered at 20°C to detect miR-85-3p; ethidium bromide staining of rRNAs shows similar levels of loaded RNA for each sample. E. Western blot of HSP-70 protein levels in WT and hsp-70ΔTS animals subjected to 3 hr HS at 35°C and allowed to recover at 20°C for 4, 16, and 24 hrs at 20°C. Tubulin was used as a loading control.

miR-85 regulates hsp-70 during recovery from heat shock.

A. RT-qPCR of hsp-70 mRNA in WT, mir-85(n4117), and hsp-70ΔTS animals after 3 hr HS at 35°C and allowed to recover at 20°C for 4, 16, and 24 hrs at 20°C. All replicates were normalized to ama-1 mRNA. Three biological replicates were assayed. Student’s t-tests were performed to determine significance relative to levels immediately after HS (0 hr) in WT animals (*P < 0.05, ***P < 0.001). Compared to the WT 0 hr time point, mir-85(n4117) showed no significant difference in hsp-70 mRNA levels through the recovery time course. Error bars represent SEM. B. Western blot of HSP-70 protein levels in WT and miR-85(n4117) animals subjected to 3 hr HS at 35°C and allowed to recover at 20°C for 4, 16, and 24 hrs at 20°C. Tubulin was used as a loading control. C. Volcano plot of differentially expressed PCGs in WT and miR-85(n4117) animals synchronized to L4 and heat shocked for 3 hrs at 35°C. Three biological replicates were used for RNA sequencing analysis. Genes were considered significant if they had a base mean > 10, Log2FC +/- 1, and p-adj. < 0.05. D. Northern blot of RNA from L4 synchronized WT animals maintained at 20°C (CTL) or after 3 hrs of HS at 35°C, and collected 24 hrs later from CTL and HS animals recovered at 20°C to detect miR-85-3p; ethidium bromide staining of rRNAs shows similar levels of loaded RNA for each sample. E. Western blot of HSP-70 protein levels in WT and hsp-70ΔTS animals subjected to 3 hr HS at 35°C and allowed to recover at 20°C for 4, 16, and 24 hrs at 20°C. Tubulin was used as a loading control. During HS recovery, however, WT and miR-85(n4117) animals showed striking differences in hsp-70 expression. After return to 20°C, WT animals displayed a rapid decline of hsp-70 mRNA (Fig 3A) and protein (Fig 3B), following temporal changes previously reported for hsp-70 during recovery from HS [39]. By 24 hrs after HS, hsp-70 mRNA had almost returned to non-stress levels in WT but persisted at levels nearly as high as during HS in miR-85(n4117) animals (Fig 3A). Furthermore, we found that efficient down-regulation of hsp-70 during HS recovery was dependent on its 3’UTR. Compared to WT, hsp-70ΔTS animals exhibited higher hsp-70 mRNA and protein levels up to 24 hrs after return to 20°C (Fig 3A and 3F). It should be noted that the antibody used to detect HSP-70 likely reacts with homologs of this protein not expected to be regulated by miR-85 as their 3’UTRs lack binding sites for this miRNA. Thus, the Western blot results are likely an underestimate of the accumulation of HSP-70 in miR-85(n4117) compared to WT animals during recovery from HS. These results demonstrate a requirement for mir-85 and the 3’UTR of hsp-70 in down-regulating hsp-70 levels after HS.

Down-regulation of hsp-70 by miR-85 is important for recovery from heat shock

While the miR-85 and hsp-70ΔTS strains exhibited no obvious developmental or viability defects (S2A Fig), we wondered if these animals might differ from WT in their ability to survive HS. To examine this possibility, L4 populations of WT, miR-85(n4117), and hsp-70ΔTS animals were subjected to 4 hrs of HS at 35°C, and the percent survival was calculated after allowing the animals to recover for 24 hrs at 20°C. Compared to the nearly 60% viability observed in WT, only about 30% of miR-85(n4117) and hsp-70ΔTS animals survived (Fig 4A). To rule out possible phenotypes associated with F49E12.8, which is partially disrupted in miR-85(n4117), we generated a new miR-85 mutant, miR-85(ap437). This allele contains a short deletion within the pre-miR-85 sequence that does not overlap the F49E12.8 coding region. The miR-85(ap437) animals lacked mature miR-85 (Fig 4B) and phenocopied miR-85(n4117), displaying an average survival around 32% after HS (Fig 4A). Additionally, Mos-1 Mediated Single Copy Insertion (MosSCI) [40] of miR-85 in the loss-of-function miR-85(n4117) mutant (miR-85(n4117);miR-85+) restored mature miR-85 expression (Fig 4B) and rescued the HS viability phenotype to WT levels (Fig 4A). Taken together, these findings show that miR-85 and the 3’UTR of hsp-70 facilitate HS survival.
Fig 4

Down-regulation of hsp-70 by miR-85 is important for recovery from heat shock.

A. Heat shock viability of WT, miR-85(n4117), miR-85(ap437), miR-85(n4117); miR-85+, and hsp-70ΔTS animals subjected to 4 hr of HS at 35°C. Percent survival was determined after 24 hrs recovery at 20°C. miR-85(ap437) was generated using CRISPR-Cas9 to disrupt the production of mature miR-85. The miR-85(n4117); miR-85+ rescue strain was generated using MosSci. The rescue strain genotype is knuSi832[pNU2156(miR-85 in cxTi10882, unc-119(+))] IV; unc-119(ed3) III; miR-85(n4117). Three blinded biological replicates were performed with at least 50 worms per strain, per condition. Student’s t-tests were performed to determine significance compared to WT (**P < 0.01, ***P < 0.001). Error bars represent SEM. B. Northern blot of L4 synchronized WT, miR-85(n4117), miR-85(ap437) and miR-85(n4117); miR-85+ strains probed for miR-85-3p and let-7 as a control to ensure strains were developmentally synchronized to the L4 stage; ethidium bromide staining of rRNA shows similar levels of loaded RNA for each sample. C. Following 4 hr of HS at 35°C, WT and miR-85(n4117) animals were subjected to vector RNAi or hsp-70 RNAi and percent survival was determined after 24 hrs recovery at 20°C. Three blinded biological replicates were performed with at least 50 worms per strain, per condition. Student’s t-tests were performed to determine significance for each strain relative to survival on vector RNAi (*P < 0.05). D. Following 4 hr of HS at 35°C, WT and hsp-70ΔTS animals were subjected to vector RNAi or hsp-70 RNAi and percent survival was determined after 24 hrs recovery at 20°C. Three blinded biological replicates were performed with at least 50 worms per strain, per condition. Student’s t-tests were performed to determine significance for each strain relative to survival on vector RNAi (*P < 0.05). E. Model for the role of miR-85 role in regulating hsp-70. At 20°C, miR-85 represses hsp-70 by binding to complementary sites in the 3’UTR of its mRNA. Heat shock induces transcriptional up-regulation of hsp-70 and the very high levels of hsp-70 mRNA override the regulatory potential of miR-85. Upon return to 20°C, the transcriptional induction ceases and miR-85 aids in the rapid down-regulation of the abundant hsp-70 mRNAs.

Down-regulation of hsp-70 by miR-85 is important for recovery from heat shock.

A. Heat shock viability of WT, miR-85(n4117), miR-85(ap437), miR-85(n4117); miR-85+, and hsp-70ΔTS animals subjected to 4 hr of HS at 35°C. Percent survival was determined after 24 hrs recovery at 20°C. miR-85(ap437) was generated using CRISPR-Cas9 to disrupt the production of mature miR-85. The miR-85(n4117); miR-85+ rescue strain was generated using MosSci. The rescue strain genotype is knuSi832[pNU2156(miR-85 in cxTi10882, unc-119(+))] IV; unc-119(ed3) III; miR-85(n4117). Three blinded biological replicates were performed with at least 50 worms per strain, per condition. Student’s t-tests were performed to determine significance compared to WT (**P < 0.01, ***P < 0.001). Error bars represent SEM. B. Northern blot of L4 synchronized WT, miR-85(n4117), miR-85(ap437) and miR-85(n4117); miR-85+ strains probed for miR-85-3p and let-7 as a control to ensure strains were developmentally synchronized to the L4 stage; ethidium bromide staining of rRNA shows similar levels of loaded RNA for each sample. C. Following 4 hr of HS at 35°C, WT and miR-85(n4117) animals were subjected to vector RNAi or hsp-70 RNAi and percent survival was determined after 24 hrs recovery at 20°C. Three blinded biological replicates were performed with at least 50 worms per strain, per condition. Student’s t-tests were performed to determine significance for each strain relative to survival on vector RNAi (*P < 0.05). D. Following 4 hr of HS at 35°C, WT and hsp-70ΔTS animals were subjected to vector RNAi or hsp-70 RNAi and percent survival was determined after 24 hrs recovery at 20°C. Three blinded biological replicates were performed with at least 50 worms per strain, per condition. Student’s t-tests were performed to determine significance for each strain relative to survival on vector RNAi (*P < 0.05). E. Model for the role of miR-85 role in regulating hsp-70. At 20°C, miR-85 represses hsp-70 by binding to complementary sites in the 3’UTR of its mRNA. Heat shock induces transcriptional up-regulation of hsp-70 and the very high levels of hsp-70 mRNA override the regulatory potential of miR-85. Upon return to 20°C, the transcriptional induction ceases and miR-85 aids in the rapid down-regulation of the abundant hsp-70 mRNAs. Given the dramatic mis-regulation of hsp-70 during recovery from HS in miR-85(n4117) and hsp-70ΔTS strains (Fig 3A, 3B and 3F), we predicted that the failure to down-regulate hsp-70 levels after HS might be responsible for the decreased survival of these animals. To test this idea, we used RNA interference (RNAi) to repress hsp-70 expression during recovery from HS. Compared to vector RNAi control, hsp-70(RNAi) resulted in ~10-fold reduction in hsp-70 mRNA levels in WT, miR-85(n4117), and hsp-70ΔTS strains (S3A and S3B Fig). While survival rates for WT animals recovered on vector or hsp-70(RNAi) were indistinguishable at about 50%, RNAi depletion of hsp-70 rescued the reduced viability of miR-85(n4117) and hsp-70ΔTS strains from ~35% to near WT levels (Fig 4C and 4D). This rescue was not due to a nonspecific RNAi response, as RNAi Against GFP or dpy-6 did not affect survival of the WT, miR-85(n4117) or hsp-70ΔTS strains after HS. These results indicate that overexpression of hsp-70 during recovery from HS contributes to the diminished survival of animals lacking miR-85 or the miR-85 target sites in the hsp-70 3’UTR. Furthermore, they highlight the importance of down-regulating hsp-70 levels after HS and reveal a new role for the miRNA pathway in this process (Fig 4E).

Discussion

Here we demonstrate a novel role for the microRNA pathway in heat shock recovery in Caenorhabditis elegans. We identified a specific miRNA, miR-85, that represses the expression of stress response genes, including a HS-induced chaperone, hsp-70. We show that animals lacking miR-85 or miR-85 target sites within the 3’UTR of hsp-70 overexpress hsp-70 under optimal temperature (20°C) conditions. Upon HS, though, this difference vanishes as the expression of hsp-70 and other HS-induced genes is robustly activated at the transcriptional level. However, during recovery from HS, the normally rapid decline in hsp-70 expression falters in the absence of miR-85 or its target sites in the hsp-70 3’UTR. Moreover, we present evidence that this over-expression of hsp-70 during HS recovery reduces organismal viability. Our study reveals the importance of downregulating hsp-70 levels after HS in an intact animal and highlights the role of miR-85 in facilitating this process.

Role of the miRNA pathway in stress responses

Across animal species, disruption of a single miRNA rarely results in overt phenotypes [18,41]. However, the majority of studies have been performed under well-controlled laboratory conditions that seldom reflect stressful events encountered in the wild. When animals are challenged by bouts of stress, specific miRNAs have emerged as important regulatory tools that add robustness to developmental pathways and promote survival programs [41,42]. One striking example is illustrated by the role of miR-7 in Drosophila. Flies lacking this highly conserved miRNA exhibit no apparent abnormalities under controlled laboratory conditions [43]. However, when miR-7 mutants were subjected to a series of temperature fluctuations eye development failed [44]. Examples can also be found in tumor microenvironments, where localized cellular stress can reveal roles for specific miRNAs [45]. In mice, deletion of miR-10a caused no obvious defects until the mutant strain was challenged with a model of intestinal neoplasia [46]. In this background, the lack of miR-10a was associated with a dramatic increase in the development of adenomas in female mice [46]. There is also extensive evidence of miRNAs acting as key regulators in plants responding to various forms of stress, again unveiling previously unappreciated functions that are not evident under optimal growth conditions [47]. In C. elegans, few miRNA-associated phenotypes have been identified under normal laboratory conditions [38]. However, stress-responsive miRNAs have been reported [20-22] and a few miRNAs, such as miR-71 and miR-246, have been shown to influence viability after a bout of stress [23]. Nonetheless, there remains much to learn about the precise roles and targets of miRNAs in C. elegans, underscoring the importance of investigating miRNA function under conditions that mimic challenges faced in the natural world. Here, we demonstrate a role for the miRNA pathway in regulating heat shock survival in C. elegans. The auxin-inducible degron system allowed us to deplete ALG-1 during the HS period or immediately following it. This method enabled us to conclude that ALG-1 functions in the HSR, but it is unclear if this role is restricted to the recovery phase or also engaged during high temperatures. The ability of the miRNA complex to regulate gene expression during HS is an open question. In mammalian cell culture, stress can result in modification of Argonaute proteins with poly(ADP-ribose) moieties and accumulation in Stress Granules (SGs), which store translationally inert mRNAs [48,49]. These events are associated with relief of miRNA-mediated repression [49]. There is also evidence that arsenite stress induces changes in target interactions by Argonaute that, instead, might enhance translational repression [50]. A further consideration is the general stabilization and translational repression of pre-existing mRNAs upon heat shock, which is a conserved response across organisms including those that lack the miRNA pathway, such as S. cerevisiae and E. coli [51-53]. Thus, the importance of miRNA-mediated gene regulation during elevated temperatures remains an open question.

Post-transcriptional regulation of hsp-70

From bacteria to humans, dramatic up-regulation of hsp-70 is a conserved feature of the heat shock response [54]. While many organisms also have constitutively expressed hsp-70 homologs, the stress induced members are distinguished by their rapid induction in response to increased temperature [55]. The rapid accumulation of hsp-70 triggered by HS and other stresses is regulated at the transcriptional level by Heat Shock Factor 1 (HSF1) [9]. Upon return to non-stress conditions, this transcriptional program ceases and, at least in some organisms, a post-transcriptional mechanism acts to reduce hsp-70 to near basal levels [16]. Studies in human and Drosophila cells have shown that under control temperatures, Hsp70 mRNA is relatively unstable [56,57]. During HS though, accelerated decay of Hsp70 mRNA appears to be suspended, allowing high levels of the transcripts to accumulate for translation. Then, during recovery rapid degradation of Hsp70 mRNA resumes [56,57]. It has been shown in Drosophila cells that degradation of Hsp70 mRNA is achieved through efficient deadenylation and subsequent 5’-decapping and decay, and, consistent with previous studies, this process appears to arrest during stress and resume during recovery [17,58]. Regulation of Drosophila Hsp70 mRNA stability is mediated by its 3’UTR [16,17,34]. Inspection of the hsp-70 3’UTR sequence revealed well-conserved “instability motifs” (AUUUA), which were hypothesized to contribute to the targeted deadenylation of Hsp70 [16]. However, disruption of these elements in reporters fused to the Hsp70 3’UTR did not affect mRNA decay rates in Drosophila cells, leaving the precise destabilizing elements within the 3’UTR yet to be defined [17]. Our study establishes a regulatory role for the 3’UTR of hsp-70 in C. elegans. Our results are consistent with a model whereby miR-85 binds target sites in the hsp-70 3’UTR to promote mRNA degradation (Fig 4E). Despite multiple attempts, we failed to generate precise mutations that only changed the miR-85 target sites in the 3’UTR of hsp-70, so it remains possible that additional 3’UTR regulatory elements are disrupted in hsp-70ΔTS animals. While hsp-70 mRNA levels were elevated to similar extents in miR-85 or hsp-70ΔTS mutants under control temperatures and up to 4 hours into HS recovery, levels were markedly higher at the later recovery time points in animals lacking miR-85 (Fig 3A, 16, 24 hr time points). This difference may stem from mis-regulation of other miR-85 targets in the miR-85 mutant, which could indirectly affect hsp-70 expression during recovery. The apparent pause in miRNA-mediated regulation of hsp-70 during HS in C. elegans is reminiscent of the halt in Hsp70 mRNA decay observed in Drosophila and human cells [56,57]. Given the parallels, it is tempting to speculate that the miRNA pathway may also contribute to the post-transcriptional regulation of Hsp70 in other organisms. As described above, modification and re-localization of Argonaute during stress could limit the repressive ability of the miRNA complex and potentially release hsp-70 mRNA for maximal expression. Another mechanism that can override effective regulation by the miRNA pathway is an over-production of target transcripts [41]. As miR-85 levels remain constant during HS, it is possible that the bolus of hsp-70 mRNA and possibly other miR-85 targets induced by transcription exceeds a threshold where miRNA regulation contributes little to overall target levels.

Down-regulation of hsp-70 after heat shock is important for survival

We found that maintenance of high hsp-70 levels after HS negatively impacts survival in C. elegans. Since depletion of hsp-70 mRNA by RNAi could compensate for the lack of miR-85 mediated regulation, overexpression of hsp-70 is likely the primary cause of reduced viability in miR-85 or hsp-70ΔTS mutants subjected to HS. HSP-70 is a molecular chaperone that can promote protein folding, refolding, disaggregation or degradation, activities under high demand in elevated temperatures [12]. Given these protective roles, why then would excess HSP-70 be detrimental? This is a longstanding question as previous studies have shown that constitutive overexpression of Hsp70 in Drosophila cells reduced growth rates [59] and in mice negatively impacted development and lifespan [60]. Given its many roles in the cell under normal growth conditions, which include facilitation of protein folding, translocation across membranes, complex assembly and disassembly, and regulation of protein activity and stability [12], there are several possibilities that could explain the danger of excess Hsp70. The ability of Hsp70 to interact promiscuously with a variety of clients could result in a general disruption in protein homeostasis where deviations in folding or complex formation dynamics lead to aberrant or unstable complexes. High levels of Hsp70 could also change the stoichiometry with binding partners, such as the transcription factor HSF1 or the endoribonuclease Ire that mediates ER stress, reducing their active concentrations [60,61]. There is also evidence that Hsp70 interacts with lipids in mammalian culture cells, and it has been speculated that aberrant membrane interactions could contribute to the cellular toxicity caused by excess Hsp70 [61,62]. While it is yet to be determined how high levels of HSP-70 hinder the ability of C. elegans to recover from HS, this finding highlights the importance of down-regulating hsp-70 expression post stress. Curiously, the overexpression of hsp-70 observed in miR-85 or hsp-70ΔTS mutants was not associated with developmental abnormalities in animals cultured at ambient temperatures. Despite the up-regulation of several stress-related genes in the miR-85 mutants, the development of these animals is indistinguishable from wildtype. These observations suggest that under ideal conditions the robustness of developmental programs is not dependent on regulation by miR-85. However, this miRNA was found to be required for recovery from HS. Thus, environmental perturbations likely to be encountered in the wild, such as elevated temperatures, can reveal roles for miRNA genes previously considered to be dispensable. Furthermore, our study demonstrates that repression of hsp-70 by miR-85 promotes survival after HS in C. elegans, establishing an important role for the miRNA pathway in post stress gene regulation.

Materials and methods

Nematode culture and heat shock viability assays

C. elegans strains were cultured under standard conditions and synchronized by hypochlorite treatment [63]. Heat shock viability assays were performed by plating synchronized L1 worms on NGM plates seeded with OP50 that were grown for 44 hrs at 20°C before raising the temperature to 35°C for 4 hrs of heat shock. Worms were recovered for 24hrs at 20°C before scoring. When possible, assays were blinded before synchronization and were unblinded only after scoring viability. Alg-1(gk214) worms were grown for 47 hrs before HS treatment as they are slightly developmentally delayed [64]. The auxin-induced degradation was performed by moving worms to NGM plates supplemented with 1% auxin (indole-3-acetic acid) during either 4 hrs of HS or 24 hrs of recovery. Numerical data are provided in S2 Table.

Western blotting

Western blotting was performed as previously described using mouse monoclonal antibodies against Tubulin or FLAG (Sigma), and rabbit polyclonal antibodies against Hsp70 (Proteintech) [65,66].

RT-qPCR

Quantitative RT-PCR analyses of mRNA (SYBR Green) levels were performed according to manufacturer’s instructions using the QuantSudio machine (ABI Biosystems). The housekeeping gene, ama-1, was used for normalization of experimental Ct values. Three biological replicates were performed with three technical replicates for each target gene. Numerical data are provided in S2 Table. Primer sequences: ama-1 Forward: 5’–CACTGGAGTTGTCCCAATTCTTG– 3’ ama-1 Reverse: 5’–TGGAACTCTGGAGTCACACC– 3’ hsp-70 Forward: 5’–CCGCTCGTAATCCGGAGAATACAG– 3’ hsp-70 Reverse: 5’–CAACCTCAACAACGGGCTTTCC– 3’

Northern blotting

PAGE northern blotting was performed as previously described using IDT StarFire probes for cel-miR-85-3p and let-7 [66]. let-7: AACTATACAACCTACTACCTCA/3StarFire /miR-85-3p: GCACGACTTTTCAAATACTTTGTA/3StarFire/

RNA sequencing

N2 wildtype (WT) and miR-85(n4117) worms were grown to L4 stage (47 hrs at 20°C) under standard growth conditions [63].The experimental group was subjected to heat stress by raising the temperature to 35°C for 3 hrs after developing for 44 hrs at 20°C. Animals from the control (20°C) and experimental group (35°C) were collected, snap-frozen and total RNA was isolated using a standard TRIzol (Life Technologies) RNA extraction. cDNA sequencing libraries from three independent biological replicates were prepared from 1ug of total RNA (with RIN > 8.4) using the standard protocol from the Illumina Stranded TruSeq RNA library prep kit. Ribosomal RNA was removed prior to library preparation using RiboZero Gold (Illumina). cDNA libraries were sequenced on the Illumina High Seq 4000 (SR75). Libraries were at least 28 million reads per sample. Reads were aligned to the C. elegans genome WS235 using STAR and the average percent of uniquely mapped reads was 84.4% [67]. Aligned reads were sorted using Samtools [68]. Reads were counted using FeatureCounts and Ensembl 88 gene annotations [69]. Differential gene expression was determined using DESeq2 with default parameters [37]. Classes of genes were filtered, and protein-coding genes (PCGs) were used for downstream analysis. PCGs with +/- 1 Log2FC, a basemean of at least 10, and adjusted p-value of < 0.05 were considered significantly mis-regulated (S1 Table). Volcano plots were generated using EnhancedVolcano [70]. Gene ontology enrichment was determined using DAVID Gene Ontology Analysis of the PCGs determined to be significantly up or down-regulated in miR-84(n4117) compared to WT animals by RNA sequencing [32].

RNAi

Feeding RNAi was performed as previously described [71]. Briefly, animals were moved to either empty vector, GFP, dpy-6 or hsp-70 RNAi plates during a 24 hr recovery period at 20°C after a 3 hr HS for RT-qPCR analysis or after 4 hr HS for viability experiments. RNAi plates were supplemented with 1mM of IPTG, tetracycline (12.5ug/ml), and ampicillin (100ug/ml). RNAi bacteria was grown for 16 hrs at 37°C and concentrated 10x before adding to plates. Numerical data are provided in S2 Table.

Strains

The following strains were used in this study: wild type (WT) N2 Bristol, QK155 (AID::ALG-1): alg-1(xk20 | 4xflag::degron::alg-1) X; ieSi57 II (a gift from the John Kim Lab), VC446 alg-1(gk214), RB574 alg-2(ok304), PQ629 miR-85(n4117). PQ610 miR-85(ap437) and PQ659 hsp-70ΔTS(ap443) strains were generated using CRISPR/Cas9 with a single guide RNA and back-crossed to N2 three times. The miR-85 rescue strain PQ602 was made by crossing miR-85(n4117) to COP2068: knuSi832[pNU2156 (miR-85 in cxTi10882, unc-119(+))] IV; unc-119(ed3) III), using a MosSCi integration system (Nemametrix) [40].

List of up- and down-regulated PCGs from RNA sequencing experiments at control (20°C) and heat shock (35°C) conditions in WT versus miR-85(n4117) animals.

Three independent biological replicates were used for RNA sequencing. (XLSX) Click here for additional data file.

Numerical data underlying graphs and summary statistics.

(XLSX) Click here for additional data file.

Viability assay controls and hsp-70 RT-qPCR during heat shock and recovery.

A. Percent survival of WT, alg-1(gk214), and AID::ALG-1 animals grown at 20°C for 72 hrs. Three biological replicates were performed with at least 50 worms per strain. Error bars represent SEM. B. Percent survival of synchronized WT and alg-2(ok304) animals grown at 20°C for 44 hrs before heat shock for 4 hrs at 35°C. Viability was scored after 24 hrs of recovery at 20°C. Three biological replicates were performed with at least 50 worms per strain. Error bars represent SEM. C. Percent survival of synchronized WT, alg-1(gk214), and AID::ALG-1 animals grown to stage L4 before being moved to auxin-containing media either for 24 hrs at 20°C, during 4 hrs HS, or during 24 hrs recovery after HS. Three biological replicates were performed with at least 50 worms per strain. Error bars represent SEM. D. RT-qPCR of hsp-70 mRNA levels in WT animals subjected to 3 hr HS and allowed to recover for 24hrs. All replicates were normalized to ama-1. Three biological replicates were assayed. Student’s t-tests were performed to determine significance relative to hsp-70 mRNA expression compared to HS (***P < 0.001). Error bars represent SEM. (PDF) Click here for additional data file.

Viability assay at control temperatures (20°C).

A. Percent survival of WT, miR-85(n4117), miR-85(ap437), and hsp-70ΔTS animals grown at 20°C for 72 hrs. Three blinded biological replicates were performed with at least 50 worms per strain. Error bars represent SEM. (PDF) Click here for additional data file.

RT-qPCR of RNAi knock down and non-specific RNAi heat shock viability assay controls.

A. RT-qPCR of hsp-70 mRNA levels in WT and miR-85(n4117) animals subjected to HS and allowed to recover on vector RNAi or hsp-70 RNAi for 24 hrs. All replicates were normalized to ama-1 mRNA. Three biological replicates were assayed. Student’s t-tests were performed to determine significance relative to hsp-70 mRNA expression immediately after HS for each strain (***P < 0.001). Error bars represent SEM. B. RT-qPCR of hsp-70 mRNA levels in WT and hsp-70ΔTS animals subjected to HS and allowed to recover on vector RNAi or hsp-70 RNAi for 24 hrs. All replicates were normalized to ama-1 mRNA. Three biological replicates were assayed. Student’s t-tests were performed to determine significance relative to hsp-70 mRNA expression immediately after HS for each strain (*P < 0.05, **P <0.01). Error bars represent SEM. C. Following 4 hr of HS at 35°C, WT, miR-85(n4117), and hsp-70ΔTS animals were subjected to GFP and dpy-6 RNAi and percent survival was determined after 24 hrs recovery at 20°C. Three blinded biological replicates were performed with at least 50 worms per strain, per condition. Student’s t-tests were performed to determine significance for each strain relative to survival on vector RNAi (*P < 0.05, **P < 0.01, ***P < 0.001). Error bars represent SEM. (PDF) Click here for additional data file. 24 May 2021 Dear Dr Pasquinelli, Thank you very much for submitting your Research Article entitled 'Recovery from Heat Shock Requires the MicroRNA Pathway in Caenorhabditis elegans' to PLOS Genetics. The manuscript was fully evaluated at the editorial level and by independent peer reviewers. The reviewers appreciated the attention to an important topic but identified some concerns that we ask you address in a revised manuscript. We therefore ask you to modify the manuscript according to the review recommendations. Your revisions should address the specific points made by each reviewer. In addition we ask that you: 1) Provide a detailed list of your responses to the review comments and a description of the changes you have made in the manuscript. 2) Upload a Striking Image with a corresponding caption to accompany your manuscript if one is available (either a new image or an existing one from within your manuscript). If this image is judged to be suitable, it may be featured on our website. Images should ideally be high resolution, eye-catching, single panel square images. For examples, please browse our archive. If your image is from someone other than yourself, please ensure that the artist has read and agreed to the terms and conditions of the Creative Commons Attribution License. Note: we cannot publish copyrighted images. We hope to receive your revised manuscript within the next 30 days. If you anticipate any delay in its return, we would ask you to let us know the expected resubmission date by email to plosgenetics@plos.org. If present, accompanying reviewer attachments should be included with this email; please notify the journal office if any appear to be missing. They will also be available for download from the link below. You can use this link to log into the system when you are ready to submit a revised version, having first consulted our Submission Checklist. While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email us at figures@plos.org. Please be aware that our data availability policy requires that all numerical data underlying graphs or summary statistics are included with the submission, and you will need to provide this upon resubmission if not already present. In addition, we do not permit the inclusion of phrases such as "data not shown" or "unpublished results" in manuscripts. All points should be backed up by data provided with the submission. To enhance the reproducibility of your results, we recommend that you deposit your laboratory protocols in protocols.io, where a protocol can be assigned its own identifier (DOI) such that it can be cited independently in the future. Additionally, PLOS ONE offers an option to publish peer-reviewed clinical study protocols. Read more information on sharing protocols at https://plos.org/protocols?utm_medium=editorial-email&utm_source=authorletters&utm_campaign=protocols Please review your reference list to ensure that it is complete and correct. If you have cited papers that have been retracted, please include the rationale for doing so in the manuscript text, or remove these references and replace them with relevant current references. Any changes to the reference list should be mentioned in the rebuttal letter that accompanies your revised manuscript. If you need to cite a retracted article, indicate the article’s retracted status in the References list and also include a citation and full reference for the retraction notice. PLOS has incorporated Similarity Check, powered by iThenticate, into its journal-wide submission system in order to screen submitted content for originality before publication. Each PLOS journal undertakes screening on a proportion of submitted articles. You will be contacted if needed following the screening process. To resubmit, you will need to go to the link below and 'Revise Submission' in the 'Submissions Needing Revision' folder. [LINK] Please let us know if you have any questions while making these revisions. Yours sincerely, Eric A Miska, PhD Associate Editor PLOS Genetics Gregory P. Copenhaver Editor-in-Chief PLOS Genetics Reviewer's Responses to Questions Comments to the Authors: Please note here if the review is uploaded as an attachment. Reviewer #1: Pagliusio and collaborators report here the involvement of the microRNA pathway in the recovery of the nematode C. elegans upon heat shock. More particularly, the authors show that the Argonaute ALG-1, and more particularly a specific microRNA, miR-85, is needed for this biological process. Genetic and molecular experiments also suggest that miR-85 is involved in the regulation of hsp-70, a gene that needs to be down-regulated for allowing recovery and survival of the animal after heat shock. Overall, this is a very interesting study that shed light on a new gene regulatory pathway important for animal recovery upon heat shock that involved a specific microRNA. While the experiments presented here strongly support the contribution of ALG-1 and miR-85 in this process, it is still unclear how the microRNA pathway precisely contributes to heat shock recovery as the miR-85/hsp-70 regulatory axis appears not sufficient to fully explain this biological process. Therefore, it is important to perform the following experiments to help better define how miR-85 controls this stress response. -In silico identification of putative miR-85 targets and the comparative RNA sequencing analysis infer the potential regulation by miR-85 of other key mRNAs, besides hsp-70, involved in stress response. Furthermore, the data presented in Figure 3 suggest that miR-85 is needed for the acute clearance of hsp-70 mRNA, but at a later time point, the down-regulation of hsp-70 does not seem to directly involve miR-85 as hsp-70 mRNA deleted for miR-85 binding sites decreased substantially 16hr after heat shock. As mir-85 mutant retains high hsp-70 level after heat shock, other mRNAs targeted by miR-85 likely contributed to its down-regulation. Therefore, it will be important to test the involvement of other potential miR-85 targets in this process as performed for hsp-70. A subset of genes to be tested can be easily identified from the ones found by comparative RNA sequencing. -To better compare the effects on hsp-70 mRNA level detected in mir-85 mutant and in animals expressing hsp-70 without miR-85 target sites during heat shock recovery, plotting the data on the same graph will be necessary. That will allow the readers to appreciate the magnitude of effects seen in both conditions and determine the importance of the direct miR-85 regulation of hsp-70. -To better define the contribution of miR-85 during heat shock recovery, it will be warranted to monitor its level at the same time points where hsp-70 mRNA level has been surveyed (0, 4, 16 and 24h). Besides those crucial issues, the following also need to be corrected: -P.16, first paragraph: Figure 3E and 3A should be referred to rather than Figure 4E and 4A -Figure 1F: Please show the complete base-pairing of the miR-85 with the site 2 of hsp-70 3’UTR -P.6, line 112: Besides the paper listed, the fertility of alg-1(gk214) animals has directly been surveyed in Bukhari et al., Cell Research 2012 paper. Please add this citation. Reviewer #2: The manuscript titled “Recovery from Heat Shock Requires the MicroRNA Pathway in Caenorhabditis elegans” by Pagliuso et al. shows that miRNA pathway and specifically miR-85 in C. elegans is required to regulate the expression of the conserved heat shock protein HSP-70 during recovery from heat shock. This is a very interesting manuscript, well written and well presented. One particularly important aspect of the manuscript is that the authors focus on the recovery from heat shock. While there is many research publications describing stress response, attention to recovery from stress and how this part of the physiology is regulated has been lacking. In addition, the manuscript identifies an important biological role for the miRNA pathway in recovery from stress. The authors provide multiple lines of evidence of miRNA regulation of HSP-70 during the recovery phase by using miRNA miR-85 deletions lines, removal of sequences targeted by miR-85 within the HSP-70 3ʹ UTR. I recommend the publication of the manuscript at PLoS Genetics once the following issues are addressed either through additional data analysis or further clarification within the manuscript text. 1- It is not sufficiently clear why the authors focused on hsp-70 among all the other heat shock proteins to begin with. Have the authors investigated the response of other HS factors? 2- Authors use TargetScanWorm to identify two predicted miR-85 binding sites. Did the authors identify other miRNA binding sites in hsp-70 UTR? 3- Regarding the RNA-Seq experiment of miR-85 mutants, I couldn’t see a link to the deposited data in materials & methods. The authors should also include some QC data on their RNA-Seq, RNA RIN values if available, read counts of libraries, % mapped, %uniquely mapped, % multi-mapper, PCA analysis between samples and to RIN values. If any custom codes has been used these should be provided as well to enable independent validation of the data. 4- Line 162, Do the authors see enrichment of predicted miR-85 targets among the up regulated genes in comparison to the down-regulated genes? 5- Line 164, Can the authors compare the GO term enrichment analysis between the up and down regulated genes to see if the enrichment in up-regulated genes is specific to this set? How these Go enrichments are calculated is not clarified in materials and methods. 6- Page 7, line 139 - Authors mention that upon HS hsp-70 mRNA is up-regulated over 100 fold. However, in Figures 1 & 2, hsp-70 mRNA levels are only 2 fold higher when miR-85 regulation doesn’t happen during recovery. Can the authors clarify these differences and discuss more clearly how this is sufficient for the protein expression changes and the phenotypes? Reviewer #3: Summary: In their manuscript "Recovery from Heat Shock Requires the MicroRNA Pathway in Caenorhabditis elegans", Pasquinelli and colleagues analyze the requirement of miRNAs in a robust recovery from heat shock. They report that alg-1 mutants have reduced survival and retain elevated Hsp70, and that direct regulation of hsp-70 by miR-85 is required during recovery from heat stress. This is a short and focused study of a miRNA-target pair that has physiologically relevant effects, and exploits the clean genetic analysis that is now possible in the worm. The work is generally well-done and uses excellent in vivo reagents (AID-Alg1, miRNA mutants and 3'UTR site mutants). It follows up on a line of thinking in the miRNA field in general about miRNA control in stress response, but these genetic tests are superior to most prior works and so are a good fit for Plos Genetics. I am supportive of publication following addressing a few issues raised. Key findings: • alg-1 mutants, which are known to have are various defects, are sensitive to heat shock. They further use temporally controled AID system to show that Alg1 is required concomitant with heat shock, avoiding pre-existing defects. • hsp70 mRNA is induced 100X by heat shock, and returns to baseline by 24hrs. It's proposed not only due to transcriptional regulation, but post-transcriptional, since hsp70 is up about 2 fold in AID::ALG-1. miR-85 is a direct regulator of hsp70, since ∆mir85 mutants and an hsp70∆miR-85 sites (∆TS) strain shown 2-fold elevation of hsp70. While miR-85 and and hsp70∆TS strains seem normal, they have defective recovery from HS. The ∆mir85 can be rescued by miR-85 transgene, and hsp70-RNAi can increase survival of mir-85 and hsp70∆TS after heat shock. Major concerns: • I am not sure how precisely the hsp70-RNAi can result in depletion of Hsp70 protein. The rescue of mir-85 and hsp70∆TS mutants by hsp70-RNAi is a nice demonstration of the genetic impact of elevated Hsp70 in these mutants. However, its surprising since Hsp70 is a central coordinator of heatshock response. I think it could be quite difficult to precisely get back to a normal Hsp70 level by RNAi in these mutants and thus I think HS response could be negatively impacted. I may miss it, but I didn't see Hsp70 timecourse Western in these conditions (Figure 4) to know its induction and downregulation in hsp70-RNAi+mutants. • This is a very short report, which is ok. However, as they mention, organisms will face many stressors during life ("oxidative stress, pathogen infection, starvation, heat stress" etc. Let us add COVID19 life...) I think its relevant to test at least another, straightforward, stress response of ∆mir-85/ hsp70∆TS mutants to know the specificity. This is important for this study, because the mir-85/hsp70∆TS mutants have apparently no detectable phenotype in normal conditions. Minor comment: • What about hs response of alg-2, or some genetic interaction of alg-1 and alg-2? • "Down-regulation of hsp-70 after heat shock is important for survival". Is the presumed misexpression of Hsp70 in mir/3'UTR mutants required in all tissues to cause the defect, or is there any evidence for tissue-specific preference of regulation for survival. I think the detailed analysis can be a future study, but I wonder if they can comment for discussion eg of mir85 expression or hsp70 induction preferences, since I think this is an important point for considering the biology of this regulation. Reviewer #4: In this manuscript, Pagliuso and colleagues report on the involvement of microRNA miR85 in the heat-shock recovery (HSR) pathway in C. elegans. Leveraging CRISPR-Cas9 genome engineering and an acute protein degradation method (Auxin Induced Degradation), they show that deletion of ALG-1, miR85, or miR85 binding sites in hsp-70 mRNA are deleterious to the viability of the animal following heat-shock. They identify differentially regulated mRNAs in the miR85 deletion, and they show that loss of miR85, or deletion of miR85-binding sites in hsp-70 mRNA 3’UTR lead to persistence of hsp-70 mRNA and HSP-70 protein in HSR. Lastly, they show that hsp-70 RNAi in HSR rescues the viability phenotype associated with deletion of miR85 or its binding sites. Overall, this is a sharply focused manuscript with well-controlled experiments and convincing results. The authors unveil the novel linkage of a microRNA and HSR, and convincingly demonstrate the physiological importance of miRNA-mediated repression and decay of the hsp-70 mRNA in this process. The manuscript also features elegant experimental designs including a clever use of AID, and CRISPR edition of 3’UTR sites, which phenocopies miR85 deletion and the HSR viability defects of alg-1 alleles. Considering the importance of HS and the limited prior knowledge on HSR molecular mechanisms, the manuscript should be appealing to a broad readership. As it is often the case with briefer but exciting papers, the presented results raise several important questions that are left unanswered. Questions such as the reasons for the HSR viability defects resulting from hsp-70 persistence, the nature and mechanism of regulation of the miRNA function during HS remain open, are thoughtfully speculated upon in the Discussion section. To this reviewer, the most surprising but under-developed piece of data in the manuscript is the observation that hsp-70 mRNA is under limited control by miR85 under normal (non-HS) conditions -hsp-70 mRNA is virtually not de-repressed in hsp-70 delta TS in Figure 3-, and that in spite of not being over-expressed upon HS, miR85 appears to become extremely efficient in the clearance of a strongly induced hsp-70 mRNA. While we recognize that this may not be within the current scope of the manuscript, we suggest two possible explanations that would be worth considering: 1- Is hsp-70 mRNA 3’UTR the same at basal level, and upon HS induction? Alternative polyadenylation sites can lead to dramatically different miRNA responses, and APA usage can be affected by transcription speed and activity. At the very least, the authors could consider performing a 3’RACE on hsp-70 mRNA at basal (non-HS) and upon HS and confirm that the 3’UTR really is what they expect it to be. 2- Another possible mechanism for this is the reorganization of 3’UTR structures upon HS. One could imagine miR85 target site availability to change on hsp-70 mRNA upon ‘melting’ the 3’UTR structures. Can the authors detect candidate folding structures surrounding or overlapping the two neighbouring miR85 binding sites? Minor comments: Figure 3C is currently under-developed to an extent that it is next to useless. A more extensive description of the deg, even if only a few in this figure, would improve the value of this interesting experiment. This is the case for Figure 2A as well, where the authors could include an overlap of the OE mRNAs with predicted miR-85 binding sites beyond hsp-70 mRNA would add value to the manuscript.\\ A consideration of the expression domain of miR85 would be valuable as well (where is it expressed? All cells in C. e. Involve miR85 in hsp70?). ********** Have all data underlying the figures and results presented in the manuscript been provided? Large-scale datasets should be made available via a public repository as described in the PLOS Genetics data availability policy, and numerical data that underlies graphs or summary statistics should be provided in spreadsheet form as supporting information. Reviewer #1: None Reviewer #2: No: I couldn't locate the dataset for RNA-Seq experiments. Reviewer #3: Yes Reviewer #4: Yes ********** PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files. If you choose “no”, your identity will remain anonymous but your review may still be made public. Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy. Reviewer #1: No Reviewer #2: No Reviewer #3: No Reviewer #4: No 22 Jun 2021 Submitted filename: 2021-6-22 Pagliuso Rev comments FINAL.docx Click here for additional data file. 22 Jul 2021 Dear Dr Pasquinelli, We are pleased to inform you that your manuscript entitled "Recovery from Heat Shock Requires the MicroRNA Pathway in Caenorhabditis elegans" has been editorially accepted for publication in PLOS Genetics. Congratulations! Before your submission can be formally accepted and sent to production you will need to complete our formatting changes, which you will receive in a follow up email. Please be aware that it may take several days for you to receive this email; during this time no action is required by you. Please note: the accept date on your published article will reflect the date of this provisional acceptance, but your manuscript will not be scheduled for publication until the required changes have been made. Once your paper is formally accepted, an uncorrected proof of your manuscript will be published online ahead of the final version, unless you’ve already opted out via the online submission form. If, for any reason, you do not want an earlier version of your manuscript published online or are unsure if you have already indicated as such, please let the journal staff know immediately at plosgenetics@plos.org. In the meantime, please log into Editorial Manager at https://www.editorialmanager.com/pgenetics/, click the "Update My Information" link at the top of the page, and update your user information to ensure an efficient production and billing process. Note that PLOS requires an ORCID iD for all corresponding authors. Therefore, please ensure that you have an ORCID iD and that it is validated in Editorial Manager. To do this, go to ‘Update my Information’ (in the upper left-hand corner of the main menu), and click on the Fetch/Validate link next to the ORCID field.  This will take you to the ORCID site and allow you to create a new iD or authenticate a pre-existing iD in Editorial Manager. If you have a press-related query, or would like to know about making your underlying data available (as you will be aware, this is required for publication), please see the end of this email. If your institution or institutions have a press office, please notify them about your upcoming article at this point, to enable them to help maximise its impact. Inform journal staff as soon as possible if you are preparing a press release for your article and need a publication date. Thank you again for supporting open-access publishing; we are looking forward to publishing your work in PLOS Genetics! Yours sincerely, Eric A Miska, PhD Associate Editor PLOS Genetics Gregory P. Copenhaver Editor-in-Chief PLOS Genetics www.plosgenetics.org Twitter: @PLOSGenetics ---------------------------------------------------- Comments from the reviewers (if applicable): Reviewer's Responses to Questions Comments to the Authors: Please note here if the review is uploaded as an attachment. Reviewer #1: The authors did an excellent job of answering my comments adequately with this revised manuscript. I am therefore supportive of the publication of this interesting study in PLoS Genetics. Before the publication, the authors should confirm the appropriate use of genes nomenclature. For example, I think the microRNA gene name should be italicized mir-85 and not miR-85 (miR corresponds to gene product). Reviewer #2: Following the revision process authors have addressed all questions previously raised. Authors have added and altered figures to clarify their points and made clarifying changes to the text. They have also added additional information in materials and methods. Reviewer #4: This reviewer is satisfied by the revisions. The authors thoughtfully answered our queries and even discovered new avenues in the process ( the 3'UTR RNA folding is interesting). We also felt that the many additions to the text and figures in response to the other 3 reviewers were meaningful and improved the manuscript. ********** Have all data underlying the figures and results presented in the manuscript been provided? Large-scale datasets should be made available via a public repository as described in the PLOS Genetics data availability policy, and numerical data that underlies graphs or summary statistics should be provided in spreadsheet form as supporting information. Reviewer #1: None Reviewer #2: Yes Reviewer #4: Yes ********** PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files. If you choose “no”, your identity will remain anonymous but your review may still be made public. Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy. Reviewer #1: No Reviewer #2: No Reviewer #4: No ---------------------------------------------------- Data Deposition If you have submitted a Research Article or Front Matter that has associated data that are not suitable for deposition in a subject-specific public repository (such as GenBank or ArrayExpress), one way to make that data available is to deposit it in the Dryad Digital Repository. As you may recall, we ask all authors to agree to make data available; this is one way to achieve that. A full list of recommended repositories can be found on our website. The following link will take you to the Dryad record for your article, so you won't have to re‐enter its bibliographic information, and can upload your files directly: http://datadryad.org/submit?journalID=pgenetics&manu=PGENETICS-D-21-00466R1 More information about depositing data in Dryad is available at http://www.datadryad.org/depositing. If you experience any difficulties in submitting your data, please contact help@datadryad.org for support. Additionally, please be aware that our data availability policy requires that all numerical data underlying display items are included with the submission, and you will need to provide this before we can formally accept your manuscript, if not already present. ---------------------------------------------------- Press Queries If you or your institution will be preparing press materials for this manuscript, or if you need to know your paper's publication date for media purposes, please inform the journal staff as soon as possible so that your submission can be scheduled accordingly. Your manuscript will remain under a strict press embargo until the publication date and time. This means an early version of your manuscript will not be published ahead of your final version. PLOS Genetics may also choose to issue a press release for your article. If there's anything the journal should know or you'd like more information, please get in touch via plosgenetics@plos.org. 30 Jul 2021 PGENETICS-D-21-00466R1 Recovery from Heat Shock Requires the MicroRNA Pathway in Caenorhabditis elegans Dear Dr Pasquinelli, We are pleased to inform you that your manuscript entitled "Recovery from Heat Shock Requires the MicroRNA Pathway in Caenorhabditis elegans" has been formally accepted for publication in PLOS Genetics! Your manuscript is now with our production department and you will be notified of the publication date in due course. The corresponding author will soon be receiving a typeset proof for review, to ensure errors have not been introduced during production. Please review the PDF proof of your manuscript carefully, as this is the last chance to correct any errors. Please note that major changes, or those which affect the scientific understanding of the work, will likely cause delays to the publication date of your manuscript. Soon after your final files are uploaded, unless you have opted out or your manuscript is a front-matter piece, the early version of your manuscript will be published online. The date of the early version will be your article's publication date. The final article will be published to the same URL, and all versions of the paper will be accessible to readers. Thank you again for supporting PLOS Genetics and open-access publishing. We are looking forward to publishing your work! With kind regards, Zsofi Zombor PLOS Genetics On behalf of: The PLOS Genetics Team Carlyle House, Carlyle Road, Cambridge CB4 3DN | United Kingdom plosgenetics@plos.org | +44 (0) 1223-442823 plosgenetics.org | Twitter: @PLOSGenetics
  69 in total

1.  The Caenorhabditis elegans Argonautes ALG-1 and ALG-2: almost identical yet different.

Authors:  B B J Tops; R H A Plasterk; R F Ketting
Journal:  Cold Spring Harb Symp Quant Biol       Date:  2006

Review 2.  Control of translation and mRNA degradation by miRNAs and siRNAs.

Authors:  Marco Antonio Valencia-Sanchez; Jidong Liu; Gregory J Hannon; Roy Parker
Journal:  Genes Dev       Date:  2006-03-01       Impact factor: 11.361

3.  Role of the heat shock response in stability of mRNA in Escherichia coli K-12.

Authors:  M D Henry; S D Yancey; S R Kushner
Journal:  J Bacteriol       Date:  1992-02       Impact factor: 3.490

Review 4.  MicroRNAs and Their Regulatory Roles in Plant-Environment Interactions.

Authors:  Xianwei Song; Yan Li; Xiaofeng Cao; Yijun Qi
Journal:  Annu Rev Plant Biol       Date:  2019-03-08       Impact factor: 26.379

Review 5.  Metazoan MicroRNAs.

Authors:  David P Bartel
Journal:  Cell       Date:  2018-03-22       Impact factor: 41.582

Review 6.  Cells in stress: transcriptional activation of heat shock genes.

Authors:  R I Morimoto
Journal:  Science       Date:  1993-03-05       Impact factor: 47.728

7.  Sequence and structure determinants of Drosophila Hsp70 mRNA translation: 5'UTR secondary structure specifically inhibits heat shock protein mRNA translation.

Authors:  M A Hess; R F Duncan
Journal:  Nucleic Acids Res       Date:  1996-06-15       Impact factor: 16.971

8.  The Drosophila hsp70 message is rapidly degraded at normal temperatures and stabilized by heat shock.

Authors:  R Petersen; S Lindquist
Journal:  Gene       Date:  1988-12-10       Impact factor: 3.688

9.  Most Caenorhabditis elegans microRNAs are individually not essential for development or viability.

Authors:  Eric A Miska; Ezequiel Alvarez-Saavedra; Allison L Abbott; Nelson C Lau; Andrew B Hellman; Shannon M McGonagle; David P Bartel; Victor R Ambros; H Robert Horvitz
Journal:  PLoS Genet       Date:  2007-12       Impact factor: 5.917

10.  The auxin-inducible degradation (AID) system enables versatile conditional protein depletion in C. elegans.

Authors:  Liangyu Zhang; Jordan D Ward; Ze Cheng; Abby F Dernburg
Journal:  Development       Date:  2015-11-09       Impact factor: 6.868

View more
  1 in total

Review 1.  New Roles for MicroRNAs in Old Worms.

Authors:  Corrina R Elder; Amy E Pasquinelli
Journal:  Front Aging       Date:  2022-04-12
  1 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.