Literature DB >> 22722835

Autoregulation of microRNA biogenesis by let-7 and Argonaute.

Dimitrios G Zisoulis1, Zoya S Kai, Roger K Chang, Amy E Pasquinelli.   

Abstract

MicroRNAs (miRNAs) comprise a large family of small RNA molecules that post-transcriptionally regulate gene expression in many biological pathways. Most miRNAs are derived from long primary transcripts that undergo processing by Drosha to produce ~65-nucleotide precursors that are then cleaved by Dicer, resulting in the mature 22-nucleotide forms. Serving as guides in Argonaute protein complexes, mature miRNAs use imperfect base pairing to recognize sequences in messenger RNA transcripts, leading to translational repression and destabilization of the target messenger RNAs. Here we show that the miRNA complex also targets and regulates non-coding RNAs that serve as substrates for the miRNA-processing pathway. We found that the Argonaute protein in Caenorhabditis elegans, ALG-1, binds to a specific site at the 3′ end of let-7 miRNA primary transcripts and promotes downstream processing events. This interaction is mediated by mature let-7 miRNA through a conserved complementary site in its own primary transcript, thus creating a positive-feedback loop. We further show that ALG-1 associates with let-7 primary transcripts in nuclear fractions. Argonaute also binds let-7 primary transcripts in human cells, demonstrating that the miRNA pathway targets non-coding RNAs in addition to protein-coding messenger RNAs across species. Moreover, our studies in C. elegans reveal a novel role for Argonaute in promoting biogenesis of a targeted transcript, expanding the functions of the miRNA pathway in gene regulation. This discovery of autoregulation of let-7 biogenesis establishes a new mechanism for controlling miRNA expression.

Entities:  

Mesh:

Substances:

Year:  2012        PMID: 22722835      PMCID: PMC3387326          DOI: 10.1038/nature11134

Source DB:  PubMed          Journal:  Nature        ISSN: 0028-0836            Impact factor:   49.962


Recent studies from our lab provided a global map of interactions between Argonaute and endogenous mRNAs in C. elegans at the fourth larval (L4) stage of development[6]. Using cross-linking immunopurification with high-throughput sequencing (CLIP-seq), over 3,000 mRNA transcripts were found to have sequences bound by the C. elegans Argonaute Like Gene 1 (ALG-1). Surprisingly, the non-coding let-7 primary transcripts (pri-let-7), which are processed into the mature let-7 miRNA, were among the RNAs targeted by Argonaute, as indicated by the presence of an ALG-1 binding site towards the 3′ end of the transcripts (Fig. 1a and Supplementary Fig. 1). To verify that Argonaute associates with pri-let-7, we performed RNA Immunopurification (RIP) assays, using an anti-ALG-1 antibody, in L4 stage lysates from wild-type (WT) worms and alg-1(gk214) mutants, which lack the anti-ALG-1 epitope and exhibit slightly delayed development (Supplementary Fig. 2). A robust signal for pri-let-7 sequences was observed in WT but not alg-1(gk214) extracts (Fig. 1b and Supplementary Fig. 3a). Two unspliced (A and B) and one SL1 trans-spliced primary let-7 isoforms are produced by the let-7 gene in C. elegans[7], and they all appear to associate with Argonaute (Supplementary Fig. 3a). Control actin mRNA or pri-mir-2 transcripts were not detected in ALG-1 immunopurifications, demonstrating the specificity of Argonaute association with primary let-7 transcripts (Fig. 1b and Supplementary Fig. 3a). Human Argonaute (Ago) proteins also associate with a subset of let-7 primary transcripts, suggesting that this interaction is conserved in higher organisms (Fig. 1c and Supplementary Fig. 3b).
Figure 1

Argonaute binds and regulates pri-let-7

a, The let-7 gene: precursor sequence, two transcriptional start sites (A, B), splice site for SL1 trans-splicing and the ALG-1 binding site, which includes a let-7 complementary site (LCS), are indicated. b–c, Detection of the indicated transcripts by RIP of WT and alg-1(gk214) or HeLa cell extracts. d, Northern analysis of RNA from WT and alg-1(gk214). e–g, Levels of pri-let-7 relative to 18S rRNA and pre- or mature let-7 relative to 5.8S rRNA in WT or alg-1(gk214) quantified from d.

Argonaute-mediated post-transcriptional regulation can result in mRNA degradation[4,5], and many established miRNA targets in C. elegans are up-regulated in alg-1(gk214) mutant worms[6]. To test if alg-1 also regulates the levels of primary let-7 transcripts, we performed Northern blotting on RNA extracted from WT and alg-1(gk214) worms at every two hours of development from mid L3, when mature let-7 starts to accumulate, until early adulthood. The three primary let-7 transcripts were detected at similar levels in WT and alg-1(gk214) worms at 24 hours of development (Fig. 1d). However, by four hours later the total let-7 primary transcript levels in WT had decreased to almost undetectable levels whereas the levels in alg-1(gk214) remained high (Fig. 1d–e). While the expression of let-7 primary transcripts in both strains still followed the previously described oscillation behaviour[8], the cycling was muted in the alg-1(gk214) worms. Overall the pattern is consistent in independent biological replicates though the rapid cycling of let-7 can shift the expression peaks of individual time courses (Supplementary Fig. 3d–e). In contrast to let-7, the levels of other primary miRNA transcripts exhibited modest, if any, changes in alg-1(gk214) versus WT at the L4 stage, and none of these primary miRNAs were detected in ALG-1 RIP assays (Supplementary Fig. 3c and data not shown). At all time points, precursor let-7 (pre-let-7) accumulated to higher levels in alg-1(gk214) compared to WT, whereas mature let-7 was more abundant in WT (Fig. 1d,f–g and Supplementary Fig. 3d,f–g). An accumulation of precursor and diminished level of mature was observed for all miRNAs tested (mir-58, mir-90, lin-4), regardless of changes in primary transcript levels, in alg-1(gk241) compared to WT worms (Supplementary Fig. 3d and data not shown). These observations are consistent with previous reports of a general role for Argonaute in precursor processing and mature miRNA stabilization[9-12]. The Argonaute-bound region in let-7 primary transcripts is about 500 nucleotides downstream of the mature let-7 sequence and covers about 100 nucleotides, as mapped by ALG-1 CLIP-seq[6] (Fig. 1a). To test if this site is required for interaction of ALG-1 with let-7 primary transcripts, transgenic strains with a single copy insertion of the let-7 locus lacking the ALG-1 binding site were created. These animals express the endogenous primary let-7 transcripts from the X Chromosome (WT pri-let-7) and primary let-7 transcripts with the ALG-1 binding site deleted (Δalg-1 pri-let-7) from Chromosome II. Both the WT and Δalg-1 pri-let-7 transcripts were expressed in the transgenic animals, but only the WT pri-let-7 with the ALG-1 binding site intact immunopurified with Argonaute (Fig. 2a and Supplementary Fig. 4a).
Figure 2

The ALG-1 binding site in pri-let-7 regulates expression of let-7

a, Detection of the indicated transcripts by RIP from two independent transgenic strains. b, Ratio of the levels of pri-let-7 inΔalg-1 versus WT determined by qRT-PCR and normalised to 18S rRNA. c, Northern analysis of RNA from WT orΔalg-1 pri-let-7 transgenes in let-7(mn112). d, Ratio of the levels of let-7 transcripts expressed fromΔalg-1 versus WT pri-let-7 transgenes in let-7(mn112) determined by qRT-PCR and normalized to 18S rRNA. e–f, Levels of pre- or mature let-7 relative to 5.8S rRNA expressed from WT or Δalg-1 pri-let-7 transgenes in let-7(mn112) quantified from c.

Compared to the control strain, worms harbouring the Δalg-1 pri-let-7 transgene expressed overall higher levels of primary let-7 (Fig. 2b and Supplementary Fig. 4b). In these assays, primary transcripts expressed from the endogenous let-7 locus are detected in addition to those of transgenic origin. To specifically analyse transgenic let-7 expression, we crossed the transgenic strains into the let-7(mn112) background. The let-7(mn112) mutation removes 190 base pairs just upstream and including the first nucleotide of the let-7 precursor, resulting in undetectable precursor or mature miRNA production[13]. Northern blotting showed higher levels of primary let-7 transcripts lacking the ALG-1 binding site compared to WT for most time points in the let-7(mn112) background (Fig. 2c and Supplementary Fig. 4c). Using primers that detect the unspliced versus SL1-spliced primary transcripts derived from the transgenes in qRT-PCR assays, we found that the SL1-spliced isoform was responsible for the increase detected in the Δalg-1 pri-let-7 transgenic worms (Fig. 2d and Supplementary Fig. 4d). Surprisingly, although the Δalg-1 pri-let-7 levels were elevated, the precursor and mature let-7 levels in those animals were 2- to 5-fold lower than the levels in their WT counterparts (Fig. 2c,e–f and Supplementary Fig. 4c,e–f). This deficiency reduced the rescue activity of the Δalg-1 pri-let-7 transgene in the let-7(mn112) background (Supplementary Fig. 4g). We found a potential let-7 complementary site (LCS) within the ALG-1 binding region of pri-let-7 that is conserved in other Caenorhabditis species (Fig. 3a and Supplementary Fig. 5a,b). To test if let-7 miRNA mediates association of ALG-1 with primary let-7 transcripts, we performed RIP assays, using late L3 stage WT and let-7(n2853) mutant animals. The let-7(n2853) mutant animals harbour a point mutation (G→A) at the fifth nucleotide of the mature miRNA (Fig. 3a), which disrupts base-pairing to target mRNAs[13-17]. Primary let-7 immunopurified with ALG-1 in WT, but not in let-7(n2853) extracts (Fig. 3b and Supplementary Fig. 6a), indicating that the association of Argonaute with primary let-7 transcripts requires the mature let-7 miRNA.
Figure 3

Mature let-7 regulates its own maturation

a, Base-pairing of mature let-7 to a site in pri-let-7 with the G→A mutation in let-7(n2853) indicated. b, Detection of the indicated transcripts by RIP of WT and let-7(n2853). c, Northern analysis of RNA from WT and let-7(n2853). d–f, Levels of pri-let-7 relative to 18S rRNA and pre- or mature let-7 relative to 5.8S rRNA in WT or let-7(n2853) quantified from c. g, Analysis of mature let-7(n2853) relative to 18S rRNA from the indicated strains or a 1:1 mix of RNA from let-7(n2853) and WT (mean ± s.e.m., n = 3, *, P < 0.05).

Northern blot analysis of primary let-7 in staged let-7(n2853) and WT animals during development from mid L3 until the mid-L4 stages showed similar or higher levels in let-7(n2853) compared to WT animals (Fig. 3c–d and Supplementary Fig. 6b–d). Despite the generally higher levels of primary let-7, precursor and mature let-7 were substantially reduced in let-7(n2853) compared to WT worms (Fig. 3c–f and Supplementary Fig. 6b–f). Our cumulative data indicate that binding of ALG-1 via mature let-7 miRNA to pri-let-7 results in reduced transcript levels and increased mature levels, consistent with a role for ALG-1 in promoting the processing of primary let-7 transcripts. To further test this idea, we asked if introduction of WT let-7 would boost the levels of mature let-7 (n2853). Since the let-7(n2853) primary transcript has an intact LCS, the presence of WT mature let-7 miRNA is predicted to recruit ALG-1 to the transcript to promote processing and increase mature let-7(n2853) levels. Strains containing the WT let-7 gene integrated on chromosome II and the let-7(n2853) allele on the X chromosome [let-7(n2853); let-7(+)] were tested for effects on the levels of mature let-7(n2853) RNAs. Compared to the let-7(n2853) strain, the levels of mature let-7(n2853) were increased in the let-7(n2853); let-7(+) strain (Fig. 3g). This up-regulation is likely muted by destabilization of the mature miRNA attributed to the n2853 mutation, which impairs the target-mediated protection conferred to mature miRNAs by their target mRNAs[15]. Since processing of miRNA primary transcripts typically occurs in the nucleus, we investigated the association of ALG-1 with pri-let-7 in this compartment. About 20% of ALG-1 protein localized to the nuclear fraction (Fig. 4a). Notably, almost half of the mature let-7 miRNA was associated with the nuclear fraction, which was double the amount of three other tested miRNAs (Fig. 4a). Using ALG-1 RIP assays of whole cell and nuclear fractions from WT animals, we observed strong and specific association of pri-let-7 with ALG-1 in both extracts (Fig. 4b).
Figure 4

Association of ALG-1 with pri-let-7 in nuclear fractions

a, Detection in whole cell (W), nuclear (N) or cytoplasmic (C) fractions of the indicated proteins or RNAs (mean ± s.e.m., n = 3). b, Levels of the indicated transcripts relative to their respective inputs analysed by RIP and detected by qRT-PCR (mean ± s.e.m., n = 2). c, Ratio of mature let-7 from xpo-1 relative to control RNAi after normalization to 18S rRNA (mean ± s.e.m., n = 7, *, P < 0.001). d, Detection of the ALG-1 protein in fractions from WT and xpo-1-depleted animals. e, Analysis of pri-let-7 or 18S rRNA relative to their respective inputs by RIP and qRT-PCR of control (WT) or xpo-1 RNAi (mean ± s.e.m., n = 4, *, P < 0.001).

Recently, the nuclear transport receptor Exportin-1 (XPO-1) was implicated in regulating primary miRNA processing through an unknown mechanism[18]. As previously reported, depletion of xpo-1 by RNAi resulted in a two-fold decrease in mature let-7 levels (Fig. 4c)[18]. Moreover, xpo-1(RNAi) reduced the nuclear localization of ALG-1 by a factor of 3.5 ± 0.1 (mean ± s.e.m., n = 5, P < 0.001), but did not affect total ALG-1 levels, compared to WT controls (Fig. 4d). Additionally, RIP assays revealed reduced association of ALG-1 with pri-let-7 in xpo-1 depleted animals (Fig. 4e). Although Exportin-1 is best characterized as a nuclear export factor, it has been shown to interact with Argonaute proteins in mammalian cells[19] and, thus, it remains to be determined how direct the role is for XPO-1 in mediating nuclear interactions between ALG-1 and pri-let-7. Our studies reveal a novel paradigm of ncRNAs as targets of miRNA induced silencing complexes. We find that Argonaute associates with let-7 miRNA primary transcripts in C. elegans and with a subset of pri-let-7 RNAs in human cells, indicating that transcripts other than mRNAs can also be miRNA targets and should be considered in target prediction endeavours. Argonaute is best characterized for its role in directing deadenylation and translational repression of bound mRNAs through incompletely resolved mechanisms[4,5]. Although the mechanism by which ALG-1 regulates let-7 primary transcripts is yet to be fully elucidated, it appears to depend on the subcellular localization of Argonaute, as regulated by XPO-1, and to be independent of LIN-28 (Supplementary Fig. 7). Recently, miR-709 was reported to inhibit the processing of pri-miR-15a/16-1 in mouse cells[20]. The discovery that the miRNA complex can regulate the processing of primary transcripts reveals a new role for Argonaute in the miRNA pathway. Moreover, this is the first example of a direct miRNA auto-regulatory loop, whereby mature let-7 binds and promotes processing of its own primary transcript. This amplification mechanism may be important for efficient production of mature let-7 from the oscillating levels of primary transcript substrates during C. elegans development. Our demonstration of direct miRNA regulation of let-7 biogenesis adds to the growing list of factors that impose post-transcriptional control on production of this important miRNA[8,21-27]. Since misregulation of let-7 leads to disease[28], the let-7 positive feedback loop presents a new target for therapeutic interventions designed to restore appropriate miRNA levels.

METHODS SUMMARY

C. elegans worms were grown and synchronized by standard methods at 25°C. Polyacrylamide gel electrophoresis and Agarose Northern blotting methods were used to detect smaller and larger RNAs species, respectively[7]. For reverse transcription PCR (RT-PCR) assays, RNA was extracted and cDNA was synthesized using random hexamers[8]. For quantification of mature let-7 miRNA from the let-7(n2853) strain we used Taqman Small RNA Assays with a custom-made RT primer, specific for the mutant sequence (Applied Biosystems). RNA Immunopurification (RIP) assays in C. elegans were performed with anti-ALG-1 antibodies (Thermo Fisher Scientific) and in HeLa cells with antibodies that recognize Ago1–4 (4F9, sc-53521, Santa Cruz; 2e12/1c9, Sigma)[8,29].

METHODS

Nematode culture and strains

C. elegans worms were synchronized by standard methods, cultured at 25°C and collected at the indicated time points. The wild-type strain used is N2 Bristol. The WT (PQ320) and Δalg-1 transgenic strains 1 & 2 (PQ402 & PQ404) express the WT pri-let-7 transcript or the Δalg-1 pri-let-7 transcript with the ALG-1 binding site deleted from single-copy transgenes integrated in Chromosome II using the MosSCI system[30] along with the endogenous primary let-7 from chromosome X. The WT (PQ425) and Δalg-1 (PQ426) transgenic animals in the let-7(mn112) background were created by crossing PQ320 or PQ404 into let-7(mn112) animals, which do not express precursor or mature let-7. The let-7(n2853);let-7(+) transgenic animals express the WT primary let-7 transcript from a single-copy transgene integrated in Chromosome II and the endogenous let-7(n2853) transcript from the X Chromosome and were created by crossing PQ320 into the let-7(n2853) strain.

Northern Blotting

Polyacrylamide gel electrophoresis (PAGE) and Agarose Northern blotting methods were used to detect smaller and larger RNAs species, respectively[7]. The primers used for probe templates are described in Supplemental Table 1. To detect let-7 primary transcripts expressed only from transgenes in the let-7(mn112) background, the probe was limited to the 190 nt deletion missing in the let-7(mn112) allele. Equal amounts of probes complementary for the WT and the let-7(n2853) miRNAs were used in PAGE Northern analyses for the mature and precursor forms. Precursor levels in the WT and let-7(n2853) strains were also analysed with a probe specific for the loop region, which is identical in the WT and mutant let-7 RNAs. RNA bands were quantified using the ImageJ software package.

Reverse Transcription – Polymerase Chain Reaction (RT-PCR) assays

RNA was extracted using standard Trizol (Invitrogen) procedure and treated with RQ1 DNAse (Promega). cDNA synthesis was performed with Superscript II or III reverse transcriptase (Invitrogen) using random hexamers. Standard PCR was performed with the primers listed in Supplemental Table 1 and the products were resolved on agarose gels. Quantitative Real Time-PCR (qRT-PCR) was performed using SYBR Green or Fast SYBR Green (Applied Biosystems) on ABI Prism 7000 Real Time PCR or StepOne instruments. Quantification of wildtype mature let-7 or let-7(n2853) miRNA at the L4 stage was performed with Taqman Small RNA Assays (Applied Biosystems) following the manufacturer’s instructions using the hsa-let-7a RT primer and Taqman probe or a custom-made RT primer and Taqman probe specific for the let-7(n2853) sequence, respectively. Expression data were normalized to 18S rRNA. Levels of mature let-7(n2853) for the 1:1 mix of RNA from WT and let-7(n2853) animals were adjusted by a factor of 2 to compensate for the 2-fold dilution of the mature WT and let-7(n2853) miRNAs. Statistical analysis was performed with paired one- or two-tailed Student’s t-test.

RNA Immunopurification (RIP) assays

RNA immunopurification assays in C. elegans extracts were performed in L4 stage worms as described previously with minor modifications[8]. An aliquot (5% of total volume) was collected as RNA input control, the lysates were pre-cleared for 1 h at 4°C with Protein G Dynabeads and incubated overnight with 2–7ug of custom polyclonal anti-ALG-1 antibody (Thermo Fisher Scientific) or control IgG (total, Caltag Laboratories or Rat anti-GFP Clone 1A5, Santa Cruz) with gentle shaking at 4°C. Protein G Dynabeads were added the next day, incubated at 4°C for 1 h with gentle shaking, washed twice with lysis buffer for 10 min at 4°C and RNA was extracted and cDNA was synthesized with random primers using Superscript III.

RNA Immunopurification (RIP) in HeLa cells

RNA immunopurification in HeLa cell extracts were performed as described previously[29] with minor modifications. Following centrifugation the supernatant was incubated with 150 ul of Dynal My1 Streptavidin-coated magnetic beads (Invitrogen) coupled to 7.5 ug of biotinylated Ago-specific 4F9 antibody, which recognizes Ago1–4, (sc-53521, Santa Cruz) or coupled to biotinylated control anti-CD4+ antibody (L3T4, eBiosciences), which were previously equilibrated with lysis buffer. Immunopurified Ago proteins were visualised with the 2e12/1c9 antibody (Sigma). Biotinylation of the 4F9 antibody was performed as described[29]. Supernatant and beads were incubated for 2 h with gentle shaking at 4°C and then washed twice with ice-cold lysis buffer for 5 min each with gentle shaking. RNA was extracted with Trizol and the miRNeasy RNA extraction kit (Qiagen) or standard phenol/chloroform extraction followed by DNAse treatment.

Subcellular fractionation of C. elegans

Fractionation of whole C. elegans worms was performed according to a protocol provided by the Mello Lab, University of Massachusetts, with certain modifications. L4 staged worms were harvested, flash-frozen and lysed in ice-cold isotonic lysis buffer (ILB) [(25 mM HEPES, 10 mM KCl, 5% v/v glycerol, 0.5 mM DTT, protease inhibitor cocktail (Complete Mini) and 24 U/ml RNAsin], using a glass tissue grinder with pestle. Lysates were centrifuged at 500 g for 30 sec at 4°C and 1/3 of the supernatant volume was collected (whole cell fraction) while the rest was centrifuged at 2,000g for 5 min at 4°C. The supernatant (cytoplasmic fraction) was subjected to 2 further centrifugations (2,000g for 5 min at 4°C) while the pellet (nuclear fraction) was washed twice with ILB (2,000g for 5 min at 4°C). Nuclear fractions were resuspended in a volume of ILB equilvalent to the cytoplasmic fractions.

Western blot analysis

Western blot analysis was performed as described previously[14] with mouse monoclonal antibodies against tubulin (Sigma) and RNA polymerase II (Santa Cruz) or custom rabbit polyclonal antibody against a peptide in ALG-1 (Thermo Fisher Scientific). Goat-anti-mouse IgG and goat-anti-rabbit IgG secondary antibodies conjugated to horseradish peroxidase (Jackson Immunochemicals) were used along with ECL Plus chemiluminescence reagents (GE Healthcare) followed by exposure to MS Film (Kodak).

RNAi Treatments

One generation RNAi treatments on wildtype animals were performed, using the xpo-1 clone (JA:ZK742.1; primers: CAACGATTCCTCACCTGGAT and TTTTCGAGTTCATGCACGAG) from the commercially available C. elegans RNAi library (Source BioScience LifeSciences).
  30 in total

1.  Trans-splicing and polyadenylation of let-7 microRNA primary transcripts.

Authors:  John Bracht; Shaun Hunter; Rachel Eachus; Phillip Weeks; Amy E Pasquinelli
Journal:  RNA       Date:  2004-08-30       Impact factor: 4.942

2.  The 21-nucleotide let-7 RNA regulates developmental timing in Caenorhabditis elegans.

Authors:  B J Reinhart; F J Slack; M Basson; A E Pasquinelli; J C Bettinger; A E Rougvie; H R Horvitz; G Ruvkun
Journal:  Nature       Date:  2000-02-24       Impact factor: 49.962

3.  Regulation by let-7 and lin-4 miRNAs results in target mRNA degradation.

Authors:  Shveta Bagga; John Bracht; Shaun Hunter; Katlin Massirer; Janette Holtz; Rachel Eachus; Amy E Pasquinelli
Journal:  Cell       Date:  2005-08-26       Impact factor: 41.582

4.  Functional proteomics reveals the biochemical niche of C. elegans DCR-1 in multiple small-RNA-mediated pathways.

Authors:  Thomas F Duchaine; James A Wohlschlegel; Scott Kennedy; Yanxia Bei; Darryl Conte; Kaming Pang; Daniel R Brownell; Sandra Harding; Shohei Mitani; Gary Ruvkun; John R Yates; Craig C Mello
Journal:  Cell       Date:  2006-01-27       Impact factor: 41.582

5.  Genes and mechanisms related to RNA interference regulate expression of the small temporal RNAs that control C. elegans developmental timing.

Authors:  A Grishok; A E Pasquinelli; D Conte; N Li; S Parrish; I Ha; D L Baillie; A Fire; G Ruvkun; C C Mello
Journal:  Cell       Date:  2001-07-13       Impact factor: 41.582

6.  Lin-28 interaction with the Let-7 precursor loop mediates regulated microRNA processing.

Authors:  Martin A Newman; J Michael Thomson; Scott M Hammond
Journal:  RNA       Date:  2008-06-19       Impact factor: 4.942

7.  The C. elegans microRNA let-7 binds to imperfect let-7 complementary sites from the lin-41 3'UTR.

Authors:  Monica C Vella; Eun-Young Choi; Shin-Yi Lin; Kristy Reinert; Frank J Slack
Journal:  Genes Dev       Date:  2004-01-16       Impact factor: 11.361

8.  Dual role for argonautes in microRNA processing and posttranscriptional regulation of microRNA expression.

Authors:  Sven Diederichs; Daniel A Haber
Journal:  Cell       Date:  2007-12-14       Impact factor: 41.582

9.  Systematic identification of mRNAs recruited to argonaute 2 by specific microRNAs and corresponding changes in transcript abundance.

Authors:  David G Hendrickson; Daniel J Hogan; Daniel Herschlag; James E Ferrell; Patrick O Brown
Journal:  PLoS One       Date:  2008-05-07       Impact factor: 3.240

10.  Selective blockade of microRNA processing by Lin28.

Authors:  Srinivas R Viswanathan; George Q Daley; Richard I Gregory
Journal:  Science       Date:  2008-02-21       Impact factor: 47.728

View more
  114 in total

1.  Autoregulation of lin-4 microRNA transcription by RNA activation (RNAa) in C. elegans.

Authors:  Michael J Turner; Alan L Jiao; Frank J Slack
Journal:  Cell Cycle       Date:  2014-01-07       Impact factor: 4.534

Review 2.  RNA-mediated gene activation.

Authors:  Alan L Jiao; Frank J Slack
Journal:  Epigenetics       Date:  2013-11-01       Impact factor: 4.528

3.  Towards elucidating the connection between epithelial-mesenchymal transitions and stemness.

Authors:  Mohit Kumar Jolly; Bin Huang; Mingyang Lu; Sendurai A Mani; Herbert Levine; Eshel Ben-Jacob
Journal:  J R Soc Interface       Date:  2014-12-06       Impact factor: 4.118

4.  Resolving Subcellular miRNA Trafficking and Turnover at Single-Molecule Resolution.

Authors:  Sethuramasundaram Pitchiaya; Laurie A Heinicke; Jun I Park; Elizabeth L Cameron; Nils G Walter
Journal:  Cell Rep       Date:  2017-04-18       Impact factor: 9.423

Review 5.  Overview of microRNA biology.

Authors:  Ashley M Mohr; Justin L Mott
Journal:  Semin Liver Dis       Date:  2015-01-29       Impact factor: 6.115

Review 6.  MicroRNA biogenesis: regulating the regulators.

Authors:  Emily F Finnegan; Amy E Pasquinelli
Journal:  Crit Rev Biochem Mol Biol       Date:  2012-11-19       Impact factor: 8.250

Review 7.  MicroRNAs and DNA damage response: implications for cancer therapy.

Authors:  Yemin Wang; Toshi Taniguchi
Journal:  Cell Cycle       Date:  2012-12-19       Impact factor: 4.534

8.  Targeted decay of a regulatory small RNA by an adaptor protein for RNase E and counteraction by an anti-adaptor RNA.

Authors:  Yvonne Göpel; Kai Papenfort; Birte Reichenbach; Jörg Vogel; Boris Görke
Journal:  Genes Dev       Date:  2013-03-01       Impact factor: 11.361

Review 9.  Nuclear microRNAs and their unconventional role in regulating non-coding RNAs.

Authors:  Hongwei Liang; Junfeng Zhang; Ke Zen; Chen-Yu Zhang; Xi Chen
Journal:  Protein Cell       Date:  2013-04-13       Impact factor: 14.870

10.  Identifying Argonaute binding sites in Caenorhabditis elegans using iCLIP.

Authors:  James P Broughton; Amy E Pasquinelli
Journal:  Methods       Date:  2013-04-10       Impact factor: 3.608

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.