Quinolinonyl Non-Diketo Acid Derivatives as Inhibitors of HIV-1 Ribonuclease H and Polymerase Functions of Reverse Transcriptase.

Novel anti-HIV agents are still needed to overcome resistance issues, in particular inhibitors acting against novel viral targets. The ribonuclease H (RNase H) function of the reverse transcriptase (RT) represents a validated and promising target, and no inhibitor has reached the clinical pipeline yet. Here, we present rationally designed non-diketo acid selective RNase H inhibitors (RHIs) based on the quinolinone scaffold starting from former dual integrase (IN)/RNase H quinolinonyl diketo acids. Several derivatives were synthesized and tested against RNase H and viral replication and found active at micromolar concentrations. Docking studies within the RNase H catalytic site, coupled with site-directed mutagenesis, and Mg2+ titration experiments demonstrated that our compounds coordinate the Mg2+ cofactor and interact with amino acids of the RNase H domain that are highly conserved among naïve and treatment-experienced patients. In general, the new inhibitors influenced also the polymerase activity of RT but were selective against RNase H vs the IN enzyme.

Introduction

The human immunodeficiency vn class="Gene">irus type 1 (HIV-1) is the agent responsible for the acquired immunodeficiency syndrome (AIDS). According to the last estimates by the World Health Organization (WHO) and the Joint United Nations Programme on HIV and AIDS (UNAIDS), globally, there were 38 million people living with HIV in 2018 and only 62% of them were receiving antiretroviral treatment by the end of 2018.[1]

In total, 44 Food and Drug Administration (FDA)-approved medicines can be used in the treatment of HIV, including multiclass combination products, nucleoside reverse transcriptase (RT) inhibitors (NRTIs), non-n class="Chemical">nucleoside RT inhibitors (NNRTIs), protease inhibitors (PIs), integrase (IN) inhibitors (INSTIs), fusion inhibitors, CCR5 antagonists, postattachment inhibitors, and pharmacokinetic enhancers.[2] Treatment with HIV medicines is called antiretroviral therapy (ART), which involves taking a combination of drugs as a single pill or in various pill combinations and which generally comprehends combinations of at least three drugs from different HIV drug classes (usually NRTIs, NNRTIs, and INSTIs).[2,3] These approaches have resulted in suppression of viral replication, with decreased death rates[4] and morbidity.[5] Still, therapy suspension or lack of adherence is associated with a rapid viral rebound because such therapies do not affect the viral reservoir of latently infected cells, being the main obstacle to viral eradication.

Despite the undisputed advantage of ART, this therapy still has several drawbacks, which include long-term n class="Disease">toxicity and drug–drug interactions.[6] Moreover, life-long treatment strongly impairs the adherence, drastically promoting the selection of variants of the virus resistant to current therapies.[7] This resistance phenomenon represents the major clinical challenge in the fight against AIDS. Therefore, new anti-HIV agents are still urgently needed, in particular, inhibitors acting against novel viral targets that can contribute overcoming the resistance issue.[8−10]

Since the discovery of HIV, RT has been the first exploited therapeutic target. RT is an RNA-dependent DNA polymerase that utilizes a strand of RNA to synthesize double-stranded vin class="Gene">ral DNA that can eventually integrate into the genome of the infected cell.[11] It is a multifunctional enzyme with DNA polymerase RNA- and DNA-dependent (RDDP and DDDP, respectively) and endonuclease (ribonuclease H, RNase H) activities. RNase H function is essential for virus replication since it specifically cleaves the RNA moiety of the RNA/DNA hybrid to generate a DNA duplex to be integrated into the host cell. The RNase H active site contains a highly conserved DEDD motif consisting of four carboxylate amino acid residues in close proximity (D443, E478, D498, and D549) that interact with two Mg2+ ions.[11] It is worthy of note that a similar arrangement is observed in the active site of HIV-1 IN, another metalloenzyme that plays critical roles in viral infection. Indeed, three highly conserved residues in the catalytic core domain of this enzyme (D64, D116, and E152; DDE motif) coordinate the two Mg2+ ions necessary for its trans-esterase activity.[12]

Despite being a valid and promising drug target, RNase H inhibitors have not reached the clinical pipeline yet. Indeed, all of the RT-targeting drugs approved thus far are inhibitors of the n class="Chemical">RDDP activity and the development of RNase H inhibitors (RHIs) has lagged behind so that no drug targeting RNase H has been approved yet. This can be attributed to two reasons: (i) the availability of expertise on inhibitors of other DNA polymerases[13] that encouraged the development of drugs targeting the RT-associated RDDP function, and (ii) the open morphology of the RNase H function that is hard to target and showing a strong competition with the substrate for access to the catalytic core.[14]

However, RNase H plays a key role in the vin class="Gene">ral life cycle and shows a high degree of conservation of the entire domain upon naïve and treatment-experienced patients.[15] Thus, more recently, efforts were boosted in the development of new RHIs as relevant to enhance the antiretroviral armory and potentially able to counteract circulating HIV-1 strains resistant to the approved drugs.[15−17] In recent years, the development of more effective screening techniques[18,19] and the availability of more and more detailed structural data helped design and identify new inhibitors that can be grouped into two main categories: active-site and allosteric inhibitors. The first ones are small molecules that showed RNase H inhibitory activity at low micromolar or submicromolar ranges. These inhibitors mainly contain a hydrophobic moiety linked to a two-metal-cation chelating core, an element reminiscent of that observed for canonical HIV-1 INSTIs.[20−23] This moiety plays a key role as a driving force for the binding, conferring a high potency of inhibition, but leads to limited selectivity towards RT-associated RDDP and/or IN activities.[20−22,24]

In this field of research, our group has previously reported DKA derivatives that proved to be dual inhibitors of IN and RH[25−27] or INSTIs endowed with marginal RH inhibition activities.[10,28]

Among the dual inhibitors, an example is the pyrrolyl diketo hexenoic ester (RDS 1643, 1), which was the fn class="Gene">irst DKA derivative reported as RHI to have an antiviral effect[29−32] (Figure ), further developed on RDS 1759,[25] with a selective mode-of-action and the ability to target conserved residues within the RT RNase H domain. Conversely, quinolinonyl diketo butanoic derivative 2 (Figure ) showed a more prominent IN inhibitory activity with respect to that against RNase H, reporting IC50 values of 0.028 and 5.1 μM, respectively.[33]

Figure 1

Inhibitors of HIV-1 RNase H function of RT and/or IN enzymes.

Inhibitors of HIV-1 n class="Gene">RNase H function of RT and/or IN enzymes.

Despite the relevance of the DKA branch in the inhibitory activity, it is well-known that the DKA chain suffers from seven class="Gene">ral limits related to the pharmacokinetic and pharmacodynamic profiles. Indeed, the DKA chain is responsible for the poor solubility, high metabolic turnover, and low permeability through the cell membrane of molecules containing such a chain. Furthermore, a time-dependent decrease in the activity in solution at room temperature has been proven, even during short periods.[30−34] Therefore, to overcome the limits of the DKA moiety, a variety of compounds were developed by transferring the DKA chain to scaffolds characterized by improved druglike qualities that dialed out the undesirable DKA properties. A notable example is the INSTI elvitegravir (3, Figure ) approved by the FDA as a successful anti-HIV drug. In this compound, the DKA chain was shortened into a carboxylic acid function that, together with the ketone group in the 4-position of the quinolinone ring, chelates the two Mg2+ ions within the IN catalytic site.[35]

Recently, we successfully obtained a new selective RHIs by design of pyrrolyl pyrazole carboxylic acids.[36] This new scaffold has been achieved converting the diketo group of our previously reported dual IN/RH inhibitors pyrrolyl DKA derivatives[25−27] into a n class="Chemical">pyrazole moiety (Figure A). In this way, we obtained compounds active at micromolar/submicromolar concentrations against RNase H and selective for RNase H vs IN from 5 to >18 times. Also, these non-DKA inhibitors blocked the viral replication and proved to interact with conserved residues within the RNase H active site domain.[36]

Figure 2

Design of pyrrolyl pyrazole carboxylates as RH inhibitors (A), quinolinones as INIs (B), and the new quinolinonyl non-DKA derivatives as RHIs (C).

Design of pyrrolyl pyrazole carboxylates as RH inhibitors (A), n class="Chemical">quinolinones as INIs (B), and the new quinolinonyl non-DKA derivatives as RHIs (C).

Besides pyrrolyl DKA inhibitors, we also reported quinolinonyl DKA derivatives. We recently designed a few series of n class="Chemical">quinolinones and defined the structural elements that were vital in influencing the activity. Indeed, the bifunctional DKA derivatives were IN inhibitors nonselective against 3′-processing vs strand transfer steps,[37] while the quinolinones with small substituents on 6- and 7-positions gave potent INSTIs,[28] and finally, the basic quinolinones bearing an amino substituent in the 7-position resulted in IN inhibitors with marginal activity against RH (nM against ST and >10 μM against RH) (Figure B).[10]

In this paper, we applied an isosteric approach to those quinolonyl DKAs, with the aim to obtain a new class of compounds endowed with selective inhibitory activity against RNase H. We referred to n class="Gene">integrase inhibitor 3, conceived as a DKA isoster capable of chelating ions within the catalytic site. Thus, starting from quinolonyl DKA, we designed non-DKA quinolinonyl derivatives in which the DKA unit is replaced by the carboxylic unit in the 3-position and the carbonyl group in the 4-position of the quinolone moiety. In this way, we retained the chelating unit capable of binding the ions within the catalytic site. At the same time, we changed the distance between the benzyl moiety and the chelating group, critical to achieving optimal interaction with the IN catalytic site, with the aim to produce selectivity toward the RH function of the RT (Figure C).

All of the newly designed compounds 4a–t and 5a–t are characterized by the introduction of different substituents in the 6-position of the n class="Chemical">quinolinone ring (Chart ). In detail, we introduced (i) a hydrogen atom or a hydroxyl group; (ii) various ether groups characterized by different degrees of freedom or steric hindrance as methoxy, phenoxy, aminoalkyloxy, and arylmethyloxy; (iii) acetyl, cyano, nitro, trifluoromethyl, and methylsulfonyl groups; and (iv) a phenylpropenone moiety.

Chart 1

Structures of the Newly Designed Quinolinonyl Derivatives 4a–t and 5a–t

The newly synthesized compounds have been evaluated in vitro for their ability to inhibit the specific enzymatic activity of recombinant n class="Gene">RNase H, for their cytotoxicity and antiviral activity against HIV-1 in human cells. Besides, a rationalization of the interaction with the biological target has been proposed, based on docking studies using the crystal structure of RNase H, and validated by site-directed mutagenesis on the residues indicated as being crucial for the binding. Finally, selected derivatives have been tested for their activity against IN and RDDP functions of the RT to evaluate their selectivity.

Results and Discussion

Chemistry

Compounds 4d and 5d were obtained as already reported.[38] The synthesis of derivatives 4a–c,e–i,k and n class="Chemical">5a–c,e–i,k is outlined in Scheme . Condensation of (E)-3-(4-aminophenyl)-1-phenylprop-2-en-1-one[39] (6) with diethyl ethoxymethylenemalonate (EMME) gave intermediate 7, which was submitted to thermal ring closure to give 8k (Gould–Jacobs reaction).[40] Derivatives 5a–c,e–i,k were obtained by alkylation in position 1 of the proper quinolinonyl derivative 8a–c,e–i(41−49) or 8k with p-fluorobenzyl bromide in the alkaline medium. The subsequent base-catalyzed hydrolysis of ester derivatives 5a–c,e–i,k afforded the corresponding acids 4a–c,e–i,k.

Scheme 1

Synthetic Route to 4a–c,e–i,k and 5a–c,e–i,k Derivatives

Reagents and conditions: (i) EMME, 90 °C, 3 h, 90% yield; (ii) diphenyl ether, reflux, 2 h, 100% yield; (iii) 4-fluorobenzyl bromide, K2CO3, N,N-dimethylformamide (DMF), 100 °C, 2–3 h, 70–93% yield; (iv) proper base, 1:1 tetrahydrofuran (THF)/EtOH, reflux or room temp, 1–4 h, 80–100% yield.

Reagents and conditions: (i) EMME, 90 °C, 3 h, 90% yield; (ii) n class="Chemical">diphenyl ether, reflux, 2 h, 100% yield; (iii) 4-fluorobenzyl bromide, K2CO3, N,N-dimethylformamide (DMF), 100 °C, 2–3 h, 70–93% yield; (iv) proper base, 1:1 tetrahydrofuran (THF)/EtOH, reflux or room temp, 1–4 h, 80–100% yield.

The synthesis of compounds 4j,l–t and n class="Chemical">5j,l–t was performed as reported in Scheme . The synthetic approach resembles the one described above for compounds 4a–c,e–i,k and 5a–c,e–i,k. Noteworthy, the synthetic pathway starts with an O-alkylation of diethyl 2-(((4-hydroxyphenyl)amino)methylene)malonate[50] (9) with the appropriate alkyl halide to obtain intermediates 10a–j.

Scheme 2

Synthetic Route to 4j,l–t and 5j,l–t Derivatives

Reagents and conditions: (i) appropriate halide, t-BuOK, DMF, 0 °C to room temp, 2–3 h, 60–90% yield; (ii) diphenyl ether, reflux, 2–3 h, 90–100% yield; (iii) 4-fluorobenzyl bromide, KCO, DMF, 100 °C, 2–3 h, 40–90% yield; (iv) NaOH 20%, 1:1 THF/EtOH, reflux, 1–2 h, 50–100% yield.

Reagents and conditions: (i) appropriate halide, t-BuOK, n class="Chemical">DMF, 0 °C to room temp, 2–3 h, 60–90% yield; (ii) diphenyl ether, reflux, 2–3 h, 90–100% yield; (iii) 4-fluorobenzyl bromide, KCO, DMF, 100 °C, 2–3 h, 40–90% yield; (iv) NaOH 20%, 1:1 THF/EtOH, reflux, 1–2 h, 50–100% yield.

Evaluation of Biological Activities

In Vitro Screening for RNase H Inhibitory Activity

All compounds 4a–t and 5a–t were tested in vitro in enzyme inhibition assays against recombinant n class="Gene">RNase H (Table ), using the known RNase H inhibitors RDS 1759[25] (11) and β-thujaplicinol (BTP) used as positive controls. The assays were performed in conditions of competition with the substrate, without preincubation, starting the reaction by adding the enzyme, to avoid overestimation of compound potency and proving that it was not affected by substrate displacement, as reported for other active compounds.[14,51]

Table 1

Enzymatic Activities on RNase H of the Newly Synthesized Compounds 4a–t and 5a–t

cpd	X	R	anti-RH activity (IC50 ± SD)a
4a	H	H	>100
4b	H	CN	>100
4c	H	CF3	>100
4d	H	COCH3	16.3 ± 1.42
4e	H	NO2	56.0 ± 4
4f	H	SO2CH3	100
4g	H	OH	74 ± 9
4h	H	OCH3	>100
4i	H	OPh	32.0 ± 11.0
4j	H	O(CH2)3N(CH3) 2	15.4 ± 3.0
4k	H		5.9 ± 0.6
4l	H	H	34.0 ± 0.1
4m	H	2,3-Cl2	8.19 ± 0.05
4n	H	3,4-Cl2	29.5 ± 0.5
4o	H	1-yl	1.51 ± 0.21
4p	H	2-yl	30.3 ± 1.7
4q	H		13.5 ± 1.7
4r	H		8.27 ± 0.45
4s	H	Ph	7.47 ± 1.55
4t	H	OBnb	7.48 ± 0.28
5a	Et	H	ntc
5b	Et	CN	>100
5c	Et	CF3	59.0 ± 5.0
5d	Et	COCH3	11.0 ± 1.0
5e	Et	NO2	47.8 ± 10
5f	Et	SO2CH3	>100
5g	Et	OH	>100
5h	Et	OCH3	>100
5i	Et	OPh	45.5 ± 1.5
5j	Et	O(CH2)3N(CH3)2	>100
5k	Et		15.3 ± 1.6
5l	Et	H	8.0 ± 1.6
5m	Et	2,3-Cl2	24.0 ± 4.9
5n	Et	3,4-Cl2	37.2 ± 7.6
5o	Et	1-yl	1.49 ± 0.33
5p	Et	2-yl	19.6 ± 0.05
5q	Et		55.3 ± 1.7
5r	Et		28.4 ± 4.3
5s	Et	Ph	>100
5t	Et	OBnb	>100
11(25)			7.50 ± 1.32
BTPd			0.19 ± 0.03

Inhibitory concentration 50% (μM) determined from dose-response curves: experiments performed against HIV-1 RT-associated RNase H activity.

Bn, benzyl.

nt, not tested.

BTP, β-thujaplicinol.

Inhibitory concentration 50% (μM) determined from dose-response curves: experiments performed against HIV-1 RT-associated n class="Gene">RNase H activity.

In general, the newly designed n class="Chemical">quinolinones were proven active against RH, with 27 out of 39 tested compounds showing measurable IC50 under 100 μM concentration. Moreover, 20 compounds were active at concentrations up to 34 μM, and 8 compounds were active in the low micromolar range. The most active compounds of the series were 4o and 5o having comparable IC50 values (about 1.5 μM).

The acid derivatives were generally more active than the n class="Chemical">ester counterparts, although notable exceptions can be cited like the equipotent couples 4d–5d, 4o–5o, and 4e–5e and the case of ester 5l being more active than the acid counterpart 4l.

In general, compounds with small substituents (4a–h and n class="Chemical">5a–h) were found to be active in the high micromolar range (IC50 ≥ 50 μM) or were inactive, with the sole exception of the couple 4d and 5d showing IC50 values 16.3 and 11.0 μM, respectively.

Indeed, within this subseries, the best acting compound, 5e, showed a decrease of 3–4-fold in activity with respect to the acetyl counterparts 4d and 5d.

The removal of the substituent in position 6 of the quinolinonyl ring led to a loss of activity, as observed for the acid 4a. Similarly, by replacing the acetyl group proper of compounds n class="Chemical">4d and 5d with a hydroxyl one, a decrease in inhibitory potency was observed (5g, IC50 > 100 μM; 4g, IC50 = 74 μM). It is also worthy of note that the methylation of compounds 4g and 5g led to derivatives 4h and 5h, which reported no activity.

An increase in the dimension of the substituent gave compounds endowed with better activity. Indeed, within the ether subseries n class="Chemical">4h–j and 5h–j, the methoxy compounds 4h and 5h were inactive, phenyl ethers 4i and 5i reported a moderate inhibition with IC50 values of 32.0 and 45.5 μM, respectively, while the dimethylaminopropyl derivative 4j showed good efficacy (IC50 = 15.4 μM). Definitively, among the acid 4h–j, it is possible to notice that the activity increases in the following order: 4h < 4i < 4j.

A further increase in the moiety placed in the 6-position of the quinolinone ring, like the one with the n class="Chemical">phenylpropenone substituent (4k and 5k), gave good inhibitory potencies. In particular, the ester 5k showed comparable activity with respect to that of compounds 4d and 5d, while its acid counterpart 4k reported a twofold gain in activity shifting to low micromolar activity (5k, IC50 = 15.3 μM; 4k, IC50 = 5.9 μM).

Following this trend, arylmethyloxy ether derivatives 4l–t and 5l–t reported the most promising inhibitory profile. Indeed, although the n class="Chemical">esters 5s,t containing two aromatic rings in the 6-position of the quinolinone core were found inactive, the acid counterparts 4s,t were found highly active (IC50 values 7.47 and 7.48 μM, respectively). This trend of activity could be ascribable to the coexistence of the carboxylic acid function in the 3-position, along with substituents characterized by both moderate degrees of freedom and steric hindrance in the 6-position of the quinolinonyl ring (a benzyloxybenzyl group in the case of derivative 4t and a biphenylmethyl moiety for derivative 4s).

Within this subseries, 7 derivatives (4m,o,r–t and 5l,o) out of 18 tested showed high inhibitory activities, with IC50 values lower than 10 μM, 5 compounds (4n,q and 5m,p,r) proved to be active with 10 μM < IC50 < 30, and only 6 n class="Chemical">ethers (4l,p and 5n,q,s,t) reported inhibitory activity with IC50 values >30 μM.

Compounds 4q and n class="Chemical">5p reported inhibitory potencies comparable to those of compounds 4d and 5d (4q, IC50 = 13.48 μM; 5p, IC50 = 19.59 μM).

The ester n class="Chemical">5o and its acid counterpart 4o, characterized by a methylnapht-1-yl group in position 6 of the quinolinonyl ring, proved to be the best acting compounds among the newly synthesized quinolinonyl derivatives showing IC50 values of 1.49 and 1.51 μM, respectively.

Interestingly, the regioisomers 4p and n class="Chemical">5p of the compounds described above, obtained by replacing the methylnapht-1-yl group with a methylnapht-2-yl one, showed a decrease in activity by about 13–20 times.

A similar decrease in potency was obtained by substituting the methylnapht-1-yl group with a benzyl ring (4l and 5l, IC50 = 34.0 and 8.0 μM, respectively), thus suggesting that for both acid and ester compounds, the methylnapht-1-yl group is advisable for enzymatic inhibition.

The dichloro derivatives 4m and 5m, isosters of compounds n class="Chemical">4o and 5o, reported lower inhibitory potencies, as well. Indeed, the ester 5m showed an IC50 value 16 times lower than its isoster 5o (5m, IC50 = 24.03 μM; 5o, IC50 = 1.49 μM). The decrease in activity was less evident for the corresponding acid 4m, resulting in a 5-fold loss in activity with respect to its isosteric counterpart 4o (4m, IC50 = 8.19 μM; 4o, IC50 = 1.51 μM).

Differently, this trend of activity is not detected for the methylnapht-2-yl derivatives 6q, 7q, 4p, and n class="Chemical">5p and their dichloro isosters 4n and 5n, which showed comparable activity.

Likewise, no big difference in inhibitory potencies can be outlined between the dichloro derivatives n class="Chemical">4n and 5n and the corresponding isomers 4m and 5m, with the sole exception of the acid 3,4-dichloro derivative 4m, which is active at the micromolar concentration level (4m, IC50 = 8.19 μM). Finally, collectively, the arylmethyloxy acid derivatives resulted in more potent RHIs than the ester counterparts. Indeed, we obtained five acids active in the micromolar range, one compound around 10 μM, and three derivatives active around 30 μM concentrations. Only two of the corresponding esters showed IC50 values in the micromolar range, five compounds were active at concentrations higher that 20 μM, and two compounds were inactive up to 100 μM.

Cell-Based Assays

To determine the effect of compounds on viral replication, compounds n class="Chemical">4d,k–t and 5d,k–p,r were chosen to test the antiviral activity in HeLa-CD4-LTR-β-gal cells (Table ). In general, the acid derivatives gave measurable EC50 values that ranged from 1.73 to 16.1 μM with only compounds 4d,p,r (out of 11 tested) inactive up to 50 μM. Among them, compound 4t reported the lowest EC50 of the series, proving not to be cytotoxic up to high concentrations (100 μM), thus showing the best antiviral profile (SI > 57.8). In general, the ester derivatives showed a weaker activity when compared to the ones of the acid series, and only two compounds out of the eight tested were active in the low micromolar range (5n, IC50 = 14.6 μM; 5m, IC50 = 17.8 μM).

Table 2

Biological Effects on RT-RDDP and IN Activities, Cytotoxicity, and Antiviral Activities of Compounds 4d,k–t and 5d,k–p,r

	activity in the enzyme assay IC50 (μM)a		antiviral activity (μM)
cpd	RDDPb	INc	EC50d	CC50e	SIf
4d	ntg	>100	>50	>200
4k	>100	3.38 ± 0.42	5.4 ± 3.1	17.0 ± 4.0	3.1
4l	38.5 ± 7.1	0.41 ± 0.03	11.7 ± 2.5	>100	>8.6
4m	5.6 ± 0.6	>100	13.3 ± 4.5	>200	>15
4n	2.0 ± 0.8	3.25 ± 0.85	16.1 ± 5.5	>200	>12.4
4o	11.4 ± 2.6	>100	8.4 ± 0.7	51 ± 11	6.1
4p	nt	nt	>50	>200
4q	5.1 ± 1.8	>100	11.3 ± 3.5	>200	>17.7
4r	nt	nt	>50	>200
4s	11.6 ± 5.5	>250	2.5 ± 1.03	>100	>40
4t	2.2 ± 0.1	>100	1.73 ± 0.47	>100	>57.8
5d	nt	>100	>50	>200
5k	nt	nt	>50	>100
5l	nt	nt	>100	>100
5m	1.88 ± 0.04	0.05 ± 0.01	17.8 ± 2.3	21.6 ± 2.8	1.2
5n	24.1 ± 8.6	9.45 ± 0.55	14.6 ± 3.1	20.6 ± 4.4	1.4
5o	nt	nt	>100	>100
5p	nt	nt	>50	73 ± 24
5r	nt	nt	>16	>200
11		>100	2.9 ± 0.5	68 ± 10	>13.7
RALh		0.019 ± 0.01
EFVi	0.035 ± 0.011		0.53 ± 0.04

Inhibitory concentration 50% (μM) determined from dose-response curves.

Experiments performed against HIV-1 RT-RDDP activity.

Experiments performed against HIV-1 IN activity.

Effective concentration 50% (μM).

Cytotoxic concentration 50% (μM).

Selectivity index = CC50/EC50.

nt, not tested.

RAL, raltegravir.

EFV, efavirenz.

Experiments performed against HIV-1 n class="Chemical">RT-RDDP activity.

RAL, n class="Chemical">raltegravir.

Counter-Assays against IN and RDDP HIV-1 Activities

Since several n class="Gene">RNase H active site inhibitors were reported to inhibit also other related viral targets;[22] compounds 4e,k,l–o,r–t and 5m,n active against viral replication were tested for their ability to inhibit the other HIV-RT enzymatic function RDDP and the activity of the HIV-1 IN, structurally related to HIV-1 RNase H (Table ).

The results showed that seven out of the 12 compared derivatives were selective for HIV-1 n class="Gene">RNase H inhibition over HIV-1 IN inhibition, showing IC50 > 100 μM against the IN enzyme, three compounds showed comparable activities, and only two derivatives were substantially more active against IN than against RH.

Conversely, we did not observe a selectivity against the RT-RDDP activity since most of the tested compounds inhibited the polymerase function with IC50 values on the same order of magnitude of n class="Gene">RNase H IC50 values. Here, we cannot exclude the possibility that the RDDP inhibition might result from an allosteric modulation of this RT function rather than a direct binding to the NNRTI binding site as already demonstrated for other RHIs.[52] Nevertheless, this additional inhibition may contribute to the antiviral activity displayed in cell-based assays. Only two compounds showed selectivity for RH, namely, derivative 4k that did not influence the RDDP activity up to 100 μM and 4o. Interestingly, the last one was the best performing RNase H inhibitor, with an increase of 7.5-fold against RDDP (1.51 vs 11.4 μM) and was totally inactive against HIV-1 IN (IC50 > 100 μM). It was chosen to be further characterized for its binding mode, together with compound 4t, which showed the most promising antiviral activity.

Molecular Modeling

To clarify the reasons behind the inhibitory activity displayed by the novel compounds, molecular docking studies were performed on 4o and 4t. In particular, to predict the binding poses of compounds n class="Chemical">4o and 4t in the RNase H binding site (X-ray crystal structure with the PDB code 3QIP)[53] and to adequately probe the possible conformational changes in the active site induced by the rather bulky side chains at the 6-position of the quinolinonyl core, we elected to employ the Induced Fit routine of Glide docking software[54,55] (see Molecular Modeling methods). In general, we expect that the whole set of newly designed inhibitors would bind to the viral enzyme with similar poses to those that we are reporting for 4o (Figure A) and 4t (Figure B).

Figure 3

Predicted binding poses of 4o (A) and 4t (B) in the HIV RNase H binding site (PDB 3QIP). Important residues are labeled. 4o is represented as yellow sticks, 4t as orange sticks, the magnesium ions are depicted in purple, and their coordination with the nearby atoms is also represented in purple. H-bonds are depicted as dashed green lines. Charge-transfer interactions are represented as dashed red lines. The protein is depicted as blue ribbons and sticks.

Predicted binding poses of 4o (A) and 4t (B) in the HIV n class="Gene">RNase H binding site (PDB 3QIP). Important residues are labeled. 4o is represented as yellow sticks, 4t as orange sticks, the magnesium ions are depicted in purple, and their coordination with the nearby atoms is also represented in purple. H-bonds are depicted as dashed green lines. Charge-transfer interactions are represented as dashed red lines. The protein is depicted as blue ribbons and sticks.

Our model suggests for both 4o and 4t that the n class="Chemical">oxygen atoms of the ketone and the position-4 carboxyl/ester moiety tightly chelate the Mg2+ atoms in the active site, in a geometry that is consistent with other cocrystallized HIV-1 RNase H inhibitors.[53,56]

Interestingly, the 4-carboxyl group is localized in a highly polar section of the binding site, which comprises H539, D549, D443, D498, and E478 and two conserved n class="Chemical">water molecules that take part in the chelation of one of the magnesium ions. While we infer that the ester derivatives 5a–t should engage in the same interaction pattern that characterizes their acidic counterparts, our theoretical model would place the esters’ lipophilic ethyl chain toward the above-described highly hydrophilic area. In some cases, this should unfavorably impact the binding affinity.

The quinolinonyl core of n class="Chemical">4o forms van der Waals contacts with the side chains of W535 and A538. In the 4t case, the said core adopts a slightly different pose, possibly diminishing the strength of the van der Waals contacts with the two residues. The 4o pendant p-fluorobenzyl ring is lodged in a cleft lined by the side chains of the polar residues H539 and K540. Here, the phenyl ring establishes a T-shaped charge-transfer interaction with H539, which is intensified by the electron-withdrawing (EWG) fluorine substituent and a H-bonding interaction between its p-fluorine atom and the K540 side chain.

Regarding the 4t pendant p-fluorobenzyl ring, while it is predicted to point toward the same cleft, it would be oriented away from H539 and closer to the side chains of P537 and W535, possibly giving rise to a pan class="Gene">rallel-displaced π–π interaction with the latter residue, also enhanced by the p-fluorine atom. Besides, the K540 side chain would be oriented to form a cation-π with the ligand pendant phenyl ring, although this interaction should be weakened by the presence of an EWG substituent such as fluorine.[57,58]

As for the 6-position substituent, several of the newly designed compounds feature an n class="Chemical">oxygen atom, which should be well-positioned to accept a H-bond from either the backbone NH of Q500, as exemplified by the 4o binding pose, or the side chain of the nearby S499, as in the 4t case. Furthermore, the 4o naphthylmethoxy group would be positioned in a polar pocket lined by the residues R448, N474, Q475, S499, and Y501. Here, like the other arylmethyloxy ether derivatives, 4o naphthyl can form a parallel-displaced charge-transfer interaction with the aromatic side chain of Y501, similar to what we already demonstrated for another class of RNase H inhibitors.[36] On the other hand, our in silico analysis also revealed that the compound 4t methylphenyl-4-oxybenzyl group should reach an enzyme region that is only partially overlapping with the binding site area contacted by the naphthylmethoxy moiety of 4o. While the 4t extended chain should still engage in a π–π interaction with Y501 through its aromatic portions, it should also be able to access an adjacent cavity lined by the residues Q475, L479, Y501, and I505, providing further anchoring points for the ligand. It could also be inferred that the other compounds with a comparably long 6-position substituent, such as 4r and 4s, might lodge their chain in the same pocket contacted by 4t. To better elucidate the interaction pattern established by derivatives devoid of aromatic moieties at the 6-position (4a–h,j and 5a–h,j), we also docked compounds 4c and 4d in the RNase H binding site. The resulting docking solutions are presented in Figure . Indeed, with the exception of the missing contacts with Y501, the predicted binding poses for the two ligands are largely congruent with what we detailed for 4o. Here, the 4d carbonyl oxygen of the acetyl group at the 6-position seems to be favorably positioned to accept a H-bond from the backbone NH of Q500. However, in 4c, the trifluoride substituent would establish a weak H-bond with the Q500 backbone NH. Thus, it could be inferred that only some substituents, such as the acetyl and the nitro group in 4d and 4e, respectively, possess a spatial arrangement that can tightly engage in this specific contact.

Figure 4

Predicted binding poses of 4c (A) and 4d (B) in the HIV RNase H binding site (PDB 3QIP). Important residues are labeled. 4c is represented as salmon sticks, 4t as magenta sticks, the magnesium ions are depicted in purple, and their coordination with the nearby atoms is also represented in purple. H-bonds are depicted as dashed green lines. Charge-transfer interactions are represented as dashed red lines. The protein is depicted as blue ribbons and sticks.

Predicted binding poses of 4c (A) and n class="Chemical">4d (B) in the HIV RNase H binding site (PDB 3QIP). Important residues are labeled. 4c is represented as salmon sticks, 4t as magenta sticks, the magnesium ions are depicted in purple, and their coordination with the nearby atoms is also represented in purple. H-bonds are depicted as dashed green lines. Charge-transfer interactions are represented as dashed red lines. The protein is depicted as blue ribbons and sticks.

Arguably, the described interacting points (i.e., a strong H-bond-accepting atom and/or an aromatic ring) in position 6 of the quinolone core should provide anchoring points that help in stabilizing the cn class="CellLine">helation geometry. Thus, these considerations could account for the weaker activity, or complete lack thereof, of the derivatives 4a–c,f–h and 5a–c,f–h.

Site-Directed Mutagenesis

To experimentally verify the binding model suggested by computational studies, compounds n class="Chemical">4o and 4t were tested against the RNase H activity of several point-mutants of HIV-1 RNase H, generated by independently introducing an alanine substitution at residues R448, K451, N474, Q475, Y501, W535, and K540 (Figure ). An activity curve was performed for all of the enzymes (Figure S1), and a concentration was chosen in the linear dose-response range to perform the enzymatic-inhibition assays. In agreement with the proposed binding pose, results showed that the potency of inhibition of compound 4o was significantly affected when tested against all of the mutated enzymes (Figure A) with a loss of potency of 3.7-fold against R448A, 2.2-fold against K451A, 6.0-fold against K540A, 16.3-fold against N474A, and completely losing inhibitory activity against the mutants Q475A, Y501A, and W535A, with a loss of potency greater than 19.1-fold (see the Supporting Information Table S1). According to the binding model, results showed that compound 4t binds in a slightly different orientation, establishing a less extended network of interactions: its inhibitory activity was not affected by the presence of R448A, K451A, N474A, or K540A substitutions (Figure A) (p value > 0.05; see the Supporting Information Table S2), while it lost 8.2-fold potency against Q475A RT and was totally inactive against the RNase H function of Y501A and W535A RTs, with a decrease in potency greater than >52.4-fold. Interestingly, the analyzed residues are among the most conserved toward naïve and treated patients,[15] with a degree of conservation up to 99.9% for Y501, N474, and Y501 and greater than 100% for W535 and Q475, thereby increasing the evidence that the design of inhibitors targeting conserved regions within the RNase H active site is a possible path for lead development.

Figure 5

Inhibition of HIV-1 RT-associated RNase H activity of mutated HIV-1 RTs by quinolinonyl non-diketo acid derivatives. Panel A: 4o; panel B: 4t.

Inhibition of HIV-1 RT-associated n class="Gene">RNase H activity of mutated HIV-1 RTs by quinolinonyl non-diketo acid derivatives. Panel A: 4o; panel B: 4t.

Investigation of Magnesium Complexation

To investigate the potential importance of the interaction between the active compounds and Mg2+ ions, spectrophotometric complexation studies were carried out on the best active derivatives n class="Chemical">4o and 5o. Titration of compound 5o with MgCl2 produced an increase in absorbance at 246 nm (Figure panel B), thereby indicating coordination of this compound with Mg2+. Moreover, as observed in Job’s plot (Figure , panel C), the stoichiometry of the complex 5o–Mg2+ is 1:1. Similarly, for acid 4o, an increase in absorbance was observed at 256 nm (see the Supporting Information Figure S2 panel B), supporting our hypothesis according to which the shortening of the DKA branch into a carboxylic acid function could, together with the ketone group of the quinolinone ring, interact with the Mg2+ ions. Also for derivative 4o, we observed a stoichiometry of 1:1 for the complex 4o–Mg2+(see the Supporting Information Figure S1 panel C).

Figure 6

[A] UV spectra of 5o in EtOH 3.81 10–5 M (black trace) and 5o (3.81 10–5 M) + MgCl2 (3.81 10–3 M) (red trace). [B] Increments of A at 246 nm obtained during the titration of 5o with MgCl2. [C] Job’s plot obtained for 5o and MgCl2. ΔA at 246 nm was plotted vs the molar ratio of 5o. The maximum ΔA was observed at X = 0.54, which corresponds to a stoichiometry of 1:1 for the complex 5o–Mg2+.

[A] UV spectra of 5o in n class="Chemical">EtOH 3.81 10–5 M (black trace) and 5o (3.81 10–5 M) + MgCl2 (3.81 10–3 M) (red trace). [B] Increments of A at 246 nm obtained during the titration of 5o with MgCl2. [C] Job’s plot obtained for 5o and MgCl2. ΔA at 246 nm was plotted vs the molar ratio of 5o. The maximum ΔA was observed at X = 0.54, which corresponds to a stoichiometry of 1:1 for the complex 5o–Mg2+.

Conclusions

In this work, we reported a new series of quinolonyl non-DKA derivatives as RHIs. This new class of compounds was conceived by shortening the quinolonyl DKA chain typical of INSTI into a carboxylic acid function that, togn class="Chemical">ether with the ketone group in the 4-position of the quinolinone ring, could still chelate the two Mg2+ ions. The newly designed compounds showed activity against RH and were also confirmed to be able to chelate the magnesium ions by spectrophotometric complexation studies.

Among the newly synthesized derivatives, arylmethyloxy acid quinolonyl derivatives demonstrated inhibitory activities within the micromolar/low micromolar range, resulting in IC50 values lower than that of the ester counterparts, with compound n class="Chemical">4o being the most potent acid derivative (IC50 = 1.51 μM). Docking studies within the RNase H catalytic site highlighted a possible reason for this trend of activity. Indeed, the 4-carboxyl group is localized in a highly polar section of the binding site. As a result, the esters would place their lipophilic ethyl chain toward this highly hydrophilic area and this should unfavorably impact the binding affinity. Interestingly, this trend was also observed in acutely infected cells, with derivative 4t being the best acting compound (EC50 = 1.73 μM) with no cytotoxic activity. Site-directed mutagenesis experiments confirmed the docking calculations, demonstrating also that our compounds are capable of interacting with amino acids highly conserved among naïve and treated patients. Overall, these results confirmed the effectiveness of this class of quinolonyl non-DKA derivatives as new RHIs.

It is worth noting that the quinolonyl DKAs were in genen class="Gene">ral active at low nanomolar concentrations against IN, showing marginal activity against RH. Conversely, the new quinolonyl non-DKAs were good RH inhibitors, with marginal activity against IN, as hypothesized in the rationale. This series was nonselective against RDDP of the RT so that the antiviral activity that resulted can be ascribed to inhibiting effects of both RT functions.

Experimental Section

General

Melting points were determined on a Bobby Stuart Scientific SMP1 melting point apparatus and are uncorrected. Compound purity was always >95% as determined by combustion analysis. Analytical results agreed to within ±0.40% of the theoretical values. n class="Gene">IR spectra were recorded on a PerkinElmer Spectrum-One spectrophotometer. 1H NMR spectra were recorded at 400 MHz on a Bruker AC 400 Ultrashield 10 spectrophotometer (400 MHz). Dimethyl sulfoxide-d6 99.9% (CAS 2206–27–1), deuterochloroform 98.8% (CAS 865–49–6), and acetone-d6 99.9% (CAS 666–52–4) of isotopic purity (Aldrich) were used. Column chromatographies were performed on silica gel (Merck; 70–230 mesh). All compounds were routinely checked on thin-layer chromatography (TLC) using aluminum-baked silica gel plates (Fluka DC-Alufolien Kieselgel 60 F254). Developed plates were visualized by UV light. Solvents were of reagent grade and, when necessary, were purified and dried by standard methods. Concentration of solutions after reactions and extractions involved the use of a rotary evaporator (Büchi) operating at a reduced pressure (ca. 20 Torr). Organic solutions were dried over anhydrous sodium sulfate (Merck). All solvents were freshly distilled under nitrogen and stored over molecular sieves for at least 3 h prior to use. Analytical results agreed to within ±0.40% of the theoretical values.

General Experimental Procedures

General Procedure A (GP-A) to Obtain O-Alkyl Derivatives 10a–j

To a mixture of diethyl 2-(((4-hydroxyphenyl)amino)methylene)malonate (17.9 mmol) in anhydrous DMF (80 mL), n class="Chemical">t-BuOK (26.9 mmol) and the proper halide (26.9 mmol) were added at 0 °C. Then, the resulting mixture was stirred at room temperature for the proper time and monitored by TLC.

The reaction was quenched with water (30 mL) and extracted with n class="Chemical">ethyl acetate (3 × 50 mL). The combined organic layers were washed with brine (200 mL), dried over Na2SO4, concentrated, and purified by column chromatography on silica gel. For derivate 10a, the alkylating agent was obtained as a free base, upon the reaction between the commercially available 3-dimethylamino-1-propyl chloride hydrochloride and triethylamine in anhydrous THF. For each compound, alkylating agent; reaction time; chromatography eluent; recrystallization solvent; yield (%); melting point (°C); IR; 1H NMR; and elemental analysis are reported.

General Procedure B (GP-B) to Obtain Quinolinonyl Ester Derivatives (8b,k,j,l–t)

The proper substituted anilidomethylenemalonic ester (19.0 mmol) was suspended in n class="Chemical">diphenyl ether (0.304 mol, 48 mL), stirred under reflux for the proper time, and monitored by TLC. Upon completion of the reaction, the mixture was cooled down and poured into n-hexane (50 mL). The resulting precipitate was filtered, washed three times with n-hexane (10 mL) and petroleum ether, and dried under an IR lamp to afford the pure product. For each compound, reaction time; recrystallization solvent; yield (%); melting point (°C); IR; 1H NMR; and elemental analysis are reported.

General Procedure C (GP-C) to Obtain N-Alkyl Quinolinonyl Ester Derivatives (5a–t)

A mixture of the appropriate quinolinonyl ester (15.0 mmol), 4-fluorobenzyl bromide (45.0 mol), and n class="Chemical">K2CO3 anhydrous (21.0 mmol) in DMF anhydrous (130 mL) was stirred at 100 °C for the proper time and monitored by TLC. The mixture was cooled, treated with water (40 mL), and extracted with ethyl acetate (3 × 100 mL). The organic layer was washed with brine (200 mL), dried over anhydrous sodium sulfate, and concentrated under vacuum. The crude product was purified by chromatography (SiO2) to afford the pure product. For each compound, reaction time; chromatography eluent; recrystallization solvent; yield (%); melting point (°C); IR; 1H NMR; and elemental analysis are reported.

General Procedure D (GP-D) to Obtain Quinolinonyl Carboxylic Acid Derivatives (4a–t)

A solution of NaOH 20% (0.172 mol) in distilled n class="Chemical">water was added to a suspension of the appropriate ester (0.010 mol) in 1:1 THF/ethanol (50 mL), and the reaction was stirred vigorously under reflux for the proper time. The reaction was monitored by TLC. Upon completion of the reaction, the organic phase was removed under vacuum and the resulting suspension was acidified with 1 N HCl (pH 4–5). The resulting solid was filtered, washed with water, and dried under an IR lamp to afford the product of interest. For 4b, 0.4 M LiOH (50.0 mmol) was used as a base instead of NaOH and the reaction was performed at room temperature. For each compound, reaction time; recrystallization solvent; yield (%); melting point (°C); IR; 1H NMR; and elemental analysis are reported.

1-(4-Fluorobenzyl)-4-oxo-1,4-dihydroquinoline-3-carboxylic Acid (4a)

Synthesis, analytical, and spectroscopic data are reported in the literature.[41]

6-Cyano-1-(4-fluorobenzyl)-4-oxo-1,4-dihydroquinoline-3-carboxylic Acid (4b)

Compound 4b was prepared from ethyl 6-cyano-1-(4-fluorobenzyl)-4-oxo-1,4-dihydroquinoline-3-carboxylate by means of n class="Gene">GP-D; 4 h; ethanol; 80% as a yellow solid; 247 °C; IR ν 1604 (C=O), 1717 (C=O), 2232 (CN), 3049 (COOH) cm–1; 1H NMR (400 MHz DMSO-d6, δ) 5.87 (s, 2H, CH2), 7.16–7.21 (m, 2H, benzene H), 7.35–7.39 (m, 2H, benzene H), 8.01 (d, J = 8.5 Hz, 2H, quinolinone H), 8.23 (d, J = 8.5 Hz, 2H, quinolinone H), 8.75 (s, 1H, quinolinone H), 9.33 (s, 1H, quinolinone H), 14.5 (br s, 1H, COOH). Anal. calcd for C18H11FN2O3: C, 67.08; H, 3.44; F, 5.89; N, 8.69%. Found: C, 67.22; H, 3.45; F, 5.91; N, 8.70%.

1-(4-Fluorobenzyl)-4-oxo-6-(trifluoromethyl)-1,4-dihydroquinoline-3-carboxylic Acid (4c)

Compound 4c was prepared from n class="Chemical">ethyl 1-(4-fluorobenzyl)-4-oxo-6-(trifluoromethyl)-1,4-dihydroquinoline-3-carboxylate by means of GP-D; 1 h; ethanol; 100% as a white solid; >300 °C; IR ν 1612 (C=O), 1706 (C=O), 3078 (COOH) cm–1; 1H NMR (400 MHz DMSO-d6, δ) 6.00 (s, 2H, CH2), 7.14–7.19 (m, 2H, benzene H), 7.47–7.50 (m, 2H, benzene H), 8.13–8.15 (m, 2H, quinolinone H), 8.72 (s, 1H, quinolinone H), 9.19 (s, 1H quinolinone H), 14.38 (br s, 1H, COOH). Anal. calcd for C18H11F4NO3: C, 59.19; H, 3.04; F, 20.80; N, 3.83%. Found: C, 59.39; H, 3.03; F, 20.82; N, 3.84%.

6-Acetyl-1-(4-fluorobenzyl)-4-oxo-1,4-dihydroquinoline-3-carboxylic Acid (4d)

Synthesis, analytical, and spectroscopic data are reported in the literature.[38]

1-(4-Fluorobenzyl)-6-nitro-4-oxo-1,4-dihydroquinoline-3-carboxylic Acid (4e)

Compound 4e was prepared from n class="Chemical">ethyl 1-(4-fluorobenzyl)-6-nitro-4-oxo-1,4-dihydroquinoline-3-carboxylate by means of GP-D; 1 h; ethanol; 93% as a yellow solid; 256 °C; IR ν 1454 (NO2), 1617 (C=O), 1719 (C=O) cm–1, 3070 (COOH); 1H NMR (400 MHz DMSO-d6, δ) 5.89 (s, 2H, CH2), 7.18–7.22 (m, 2H, benzene H), 7.33–7.38 (m, 2H, benzene H), 8.08 (d, J = 8.5 Hz, 1H, quinolinone H), 8.58 (d, J = 8.5 Hz, 1H, quinolinone H), 9.02 (s, 1H, quinolinone H), 9.36 (s, 1H, quinolinone H), 14.35 (br s, 1H, COOH). Anal. calcd for C17H11FN2O5: C, 59.65; H, 3.24; F, 5.55; N, 8.18%. Found: C, 59.72; H, 3.25; F, 5.56; N, 8.20%.

1-(4-Fluorobenzyl)-6-(methylsulfonyl)-4-oxo-1,4-dihydroquinoline-3-carboxylic Acid (4f)

Compound 4f was prepared from n class="Chemical">ethyl 1-(4-fluorobenzyl)-6-(methylsulfonyl)-4-oxo-1,4-dihydroquinoline-3-carboxylate by means of GP-D; 2 h; methanol; 87% as a white solid; 254 °C; IR ν 1033 (SO2CH3), 1622 (C=O), 1736 (C=O), 3680 (COOH) cm–1; 1H NMR (400 MHz DMSO-d6, δ) 3.35 (s, 3H, CH3), 5.88 (s, 2H, CH2), 7.18 (t, 2H, benzene H), 7.35–7.39 (m, 2H, benzene H), 8.08 (d, J = 8.5 Hz, 1H, quinolinone H), 8.29 (s, J = 8.5 Hz, 1H, quinolinone H), 8.81 (s, 1H, quinolinone H), 9.36 (s, 1H, quinolinone H), 14.56 (s, 1H, COOH). Anal. calcd for C18H14FNO5S: C, 57.60; H, 3.76; F, 5.06; N, 3.73; S, 8.54%. Found: C, 57.72; H, 3.77; F, 5.08; N, 3.72; S, 8.55%.

1-(4-Fluorobenzyl)-6-hydroxy-4-oxo-1,4-dihydroquinoline-3-carboxylic Acid (4g)

Compound 4g was prepared from ethyl 1-(4-fluorobenzyl)-6-hydroxy-4-oxo-1,4-dihydroquinoline-3-carboxylate by means of n class="Gene">GP-D; 1 h; methanol; 89% as a white solid; >300 °C; IR ν 1619 (C=O), 1718 (C=O), 3045 (COOH) cm–1; 1H NMR (400 MHz DMSO-d6, δ) 5.82 (s, 2H, CH2), 7.17–7.21 (m, 2H, benzene H), 7.32–7.36 (m, 3H, benzene H and quinolone H), 7.66 (s, 1H, quinolinone H), 7.77 (d, J = 8.5 Hz, 1H, quinolinone H), 9.17 (s, 1H, quinolinone H), 10.41 (s, 1H, OH), 15.35 (s, 1H, COOH). Anal. calcd for C17H12FNO4: C, 65.18; H, 3.86; F, 6.06; N, 4.47%. Found: C, 65.36; H, 3.87; F, 6.05; N, 4.46%.

1-(4-Fluorobenzyl)-6-methoxy-4-oxo-1,4-dihydroquinoline-3-carboxylic Acid (4h)

Compound 4h was prepared from n class="Chemical">ethyl 1-(4-fluorobenzyl)-6-methoxy-4-oxo-1,4-dihydroquinoline-3-carboxylate by means of GP-D; 2 h; ethanol; 98% as a white solid; >300 °C; IR ν 1609 (C=O), 1700 (C=O), 3091 (COOH) cm–1; 1H NMR (400 MHz DMSO-d6, δ) 3.90 (s, 3H, −OCH3), 5.86 (s, 2H, CH2), 7.17–7.21 (m, 2H, benzene H), 7.32–7.33 (m, 2H, benzene H), 7.51 (d, J = 8.5 Hz, 1H, quinolinone H), 7.75 (s, 1H, quinolinone H), 7.84 (d, J = 8.5 Hz, 1H, quinolinone H), 9.23 (s, 1H, quinolinone), 15.33 (br s, 1H, COOH). Anal. calcd for C18H14FNO4: C, 66.05; H, 4.31; F, 5.80; N, 4.28%. Found: C, 66.17; H, 4.32; F, 5.81; N, 4.29%.

1-(4-Fluorobenzyl)-4-oxo-6-phenoxy-1,4-dihydroquinoline-3-carboxylic Acid (4i)

Compound 4i was prepared from n class="Chemical">ethyl 1-(4-fluorobenzyl)-4-oxo-6-phenoxy-1,4-dihydroquinoline-3-carboxylate by means of GP-D; 2 h; THF; 95% as a white solid; 274 °C; IR ν 1617 (C=O), 1707 (C=O), 3059 (COOH) cm–1; 1H NMR (400 MHz DMSO-d6, δ) 5.84 (s, 2H, CH2), 7.14–7.21 (m, 4H, benzene H, and quinolinone H), 7.27 (t, J = 8.0 Hz, 1H, benzene H), 7.28–7.49 (m, 4H, benzene H), 7.62–7.64 (m, 2H, benzene H and quinolinone H), 7.93 (d, J = 8.5 Hz, 1H, quinolinone H), 9.21 (s, 1H, quinolone H), 15.00 (br s, 1H, COOH). Anal. calcd for C23H16FNO4: C, 70.95; H, 4.14; F, 4.88; N, 3.60%. Found: C, 71.08; H, 4.15; F, 4.89; N, 3.59%.

6-(3-(Dimethylamino)propoxy)-1-(4-fluorobenzyl)-4-oxo-1,4-dihydroquinoline-3-carboxylic Acid (4j)

Compound 4j was prepared from n class="Chemical">ethyl 6-(3-(dimethylamino)propoxy)-1-(4-fluorobenzyl)-4-oxo-1,4-dihydroquinoline-3-carboxylate by means of GP-D; 1 h; ethanol; 87% as a brown solid; >300 °C; IR v 1554 (C=O) and 1702 (C=O), 3105 (OH) cm–1; 1H NMR (400 MHz DMSO-d6, δ) 2.04 (t, J = 7.0 Hz, 2H, CH2), 2.40 (s, 3H, CH3), 2.42 (s, 3H, CH3), 2.81–2.86 (m, 2H, CH2), 4.18 (t, J = 7.0 Hz, 2H, CH2), 5.86 (s, 2H, CH2), 7.17–7.19 (m, 2H, benzene H), 7.21–7.23 (m, 2H, benzene H), 7.34 (d, J = 8.5 Hz, 1H, quinolinone H), 7.75 (s, 1H, quinolinone H), 7.83–7.85 (d, J = 8.5 Hz, 1H, quinolinone H), 9.23 (s, 1H, quinolinone), 15.30 (br s, 1H, COOH). Anal. calcd for C22H23FN2O4: C, 66.32; H, 5.82; F, 4.77; N, 7.03%. Found: C, 66.40; H, 5.83; F, 4.76; N, 7.02%.

(E)-1-(4-Fluorobenzyl)-4-oxo-6-(3-oxo-3-phenylprop-1-en-1-yl)-1,4-dihydroquinoline-3 carboxylic Acid (4k)

Compound 4k was prepared from (E)-ethyl 1-(4-fluorobenzyl)-4-oxo-6-(3-oxo-3-phenylprop-1-en-1-yl)-1,4-dihydroquinoline-3-carboxylate by means of n class="Gene">GP-D; 1 h; ethanol; 86% as a white solid; IR ν 1599 (C=O), 1623 (C=O), 1655 (C=O), 3361 (COOH) cm–1; 1H NMR (400 MHz DMSO-d6, δ) 5.82 (s, 2H, CH2), 7.12–7.20 (m, 2H, benzene H), 7.32–7.36 (m, 2H, benzene H), 7.54–7.59 (m, 3H, benzene H, and alkene H), 7.79–7.83 (m, 2H, benzene H), 8.01–8.10 (m, 3H, benzene H, and alkene H), 8.67 (s, 1H, quinolinone H), 9.22 (s, 1H, quinolinone H), 14,95 (s, 1H, COOH). Anal. calcd for C26H18FNO4: C, 73.06; H, 4.24; F, 4.44; N, 3.28%. Found: C, 73.15; H, 4.25; F, 4.43; N, 3.29%.

6-(Benzyloxy)-1-(4-fluorobenzyl)-4-oxo-1,4-dihydroquinoline-3-carboxylic Acid (4l)

Compound 4l was prepared from ethyl 6-(benzyloxy)-1-(4-fluorobenzyl)-4-oxo-1,4-dihydroquinoline-3-carboxylate by means of n class="Gene">GP-D; 1.5 h; ethanol; 89% as a white solid; 248 °C; IR ν 1616 (C=O), 1711 (C=O), 3073 (OH) cm–1; 1H NMR (400 MHz DMSO-d6, δ) 5.22 (s, 2H, CH2), 5.83 (s, 2H, CH2), 7.17–7.21 (m, 4H, benzene H), 7.31–7.33 (m, 2H, benzene H), 7.51–55 (m, 4H, benzene H, and quinolinone H), 7.81 (m, 2H, benzene H, and quinolinone H), 9.20 (d, 1H, J = 8.5 Hz, quinolinone H), 15.30 (br s, 1H, COOH). Anal. calcd for C24H18FNO4: C, 71.46; H, 4.50; F, 4.71; N, 3.47%. Found: C, 71.35; H, 4.49; F, 4.70; N, 3.48%.

6-((2,3-Dichlorobenzyl)oxy)-1-(4-fluorobenzyl)-4-oxo-1,4-dihydroquinoline-3-carboxylic Acid (4m)

Compound 4m was prepared from ethyl 6-((2,3-dichlorobenzyl)oxy)-1-(4-fluorobenzyl)-4-oxo-1,4-dihydroquinoline-3-carboxylate by means of n class="Gene">GP-D; 2 h; toluene; 72% as a white solid; 263 °C; IR ν 1615 (C=O), 1702 (C=O), 3063 (COOH) cm–1; 1H NMR (400 MHz DMSO-d6, δ) 5.37 (s, 2H, CH2), 5.86 (s, 2H, CH2), 7.17–7.22 (m, 2H, benzene H), 7.33–7.37 (m, 2H, benzene H), 7.41–7.45 (m, 1H, benzene H), 7.59–7.62 (m, 2H, benzene H, and quinolinone H), 7.68 (d, J = 8.5 Hz, 1H, benzene H), 7.85–7.89 (m, 2H, quinolinone H), 9.24 (s, 1H, quinolinone H), 15.25 (s, 1H, COOH). Anal. calcd for C24H16Cl2FNO4: C, 61.03; H, 3.41; Cl, 15.01; F, 4.02; N, 2.97%. Found: C, 61.13; H, 3.42; Cl, 15.05; F, 4.01; N, 2.98%.

6-((3,4-Dichlorobenzyl)oxy)-1-(4-fluorobenzyl)-4-oxo-1,4-dihydroquinoline-3-carboxylic Acid (4n)

Compound 4n was prepared from n class="Chemical">ethyl 6-((3,4-dichlorobenzyl)oxy)-1-(4-fluorobenzyl)-4-oxo-1,4-dihydroquinoline-3-carboxylate by means of GP-D; 1 h; toluene; 73% as a white solid; 260 °C; IR ν 1626 (C=O), 1705 (C=O), 3675 (COOH) cm–1; 1H NMR (400 MHz DMSO-d6, δ) 5.29 (s, 2H, CH2), 5.86 (s, 2H, CH2), 7.17–7.20 (m, 2H, benzene H), 7.32–7.36 (m, 2H, benzene H), 7.49 (d, J = 8.5 Hz, 1H, quinolinone H), 7.55 (d, J = 8.0 Hz, 1H, benzene H), 7.60 (d, J = 8.5 Hz, 1H, quinolinone H), 7.67 (s, 1H, benzene H), 7.69–7.88 (m, 2H, benzene H, and quinolinone H), 9.23 (s, 1H, quinolinone H), 15.27 (s, 1H, COOH). Anal. calcd for C24H16Cl2FNO4: C, 61.03; H, 3.41; Cl, 15.01; F, 4.02; N, 2.97%. Found: C, 60.98; H, 3.39; Cl, 15.00; F, 4.03; N, 2.96%.

1-(4-Fluorobenzyl)-6-(naphthalen-1-ylmethoxy)-4-oxo-1,4-dihydroquinoline-3-carboxylic Acid (4o)

Compound 4o was prepared from n class="Chemical">ethyl 1-(4-fluorobenzyl)-6-(naphthalen-1-ylmethoxy)-4-oxo-1,4-dihydroquinoline-3-carboxylate by means of GP-D; 2 h; toluene; 100% as an orange solid; 251 °C; IR ν 1598 (C=O), 1730 (C=O), 3081 (COOH) cm–1; 1H NMR (400 MHz DMSO-d6, δ) 5.72 (s, 2H, CH2), 5.86 (s, 2H, CH2), 7.16–7.21 (m, 2H, benzene H), 7.33–7.36 (m, 2H, benzene H), 7.50–7.61 (m, 4H, naphthalene H), 7.70 (d, J = 8.7 Hz, 1H, quinolinone H), 7.86 (d, J = 8.5 Hz, 1H, quinolinone H), 7.94–7.99 (m, 3H, naphthalene H), 8.10 (s, 1H, quinolinone H), 9.15 (s, 1H, quinolinone H), 15.22 (br s, 1H, COOH). Anal. calcd for C28H20FNO4: C, 74.16; H, 4.45; F, 4.19; N, 3.09%. Found: C, 74.21; H, 4.44; F, 4.21; N, 3.10%.

1-(4-Fluorobenzyl)-6-(naphthalen-2-ylmethoxy)-4-oxo-1,4-dihydroquinoline-3-carboxylic Acid (4p)

Compound 4p was prepared from n class="Chemical">ethyl 1-(4-fluorobenzyl)-6-(naphthalen-2-ylmethoxy)-4-oxo-1,4-dihydroquinoline-3-carboxylate by means of GP-D; 1 h; toluene; 68% as a white solid; 296 °C; IR ν 1613 (C=O), 1702 (C=O), 3660 (COOH) cm–1; 1H NMR (400 MHz DMSO-d6, δ) 5.36 (s, 2H, CH2), 5.76 (s, 2H, CH2), 7.08–7.17 (m, 2H, benzene H), 7.25–7.27 (m, 2H, benzene H), 7.43–7.45 (m, 3H, naphthalene H), 7.48–7.51 (m, 2H, naphthalene H, and quinolinone H), 7.55–7.88 (m, 5H, naphthalene H, and quinolinone H), 7.93 (s, 1H, quinolinone H), 9.13 (s, 1H, quinolinone H), 15.18 (s, 1H, COOH). Anal. calcd for C28H20FNO4: C, 74.16; H, 4.45; F, 4.19; N, 3.09%. Found: C, 74.22; H, 4.44; F, 4.21; N, 3.11%.

6-(Benzo[d][1,3]dioxol-5-ylmethoxy)-1-(4-fluorobenzyl)-4-oxo-1,4-dihydroquinoline-3-carboxylic Acid (4q)

Compound 4q was prepared from ethyl 6-(benzo[d][1,3]dioxol-5-ylmethoxy)-1-(4-fluorobenzyl)-4-oxo-1,4-dihydron class="Chemical">quinoline-3-carboxylate by means of GP-D; 2 h; methanol; 50% as a white solid; 289 °C; IR ν 1626 (C=O), 1715 (C=O), 3357 (COOH) cm–1; 1H NMR (400 MHz DMSO-d6, δ) 5.09 (s, 2H, CH2), 5.61 (s, 2H, CH2), 5.99 (s, 2H, CH2), 6.86–6.97 (m, 2H, benzodioxolane H), 7.02 (s, 1H, benzodioxolane H), 7.15–7.18 (m, 2H, benzene H), 7.19–7.25 (m, 2H, benzene H), 7.27 (d, J = 8.5 Hz, 1H, quinolinone H), 7.42 (d, J = 8.5 Hz, 1H, quinolone H), 7.82 (s, 1H, quinolone H), 8.98 (s, 1H, quinolinone H), 15.26 (br s, 1H, COOH). Anal. calcd for C30H22FNO5: C, 72.72; H, 4.48; F, 3.83; N, 2.83%. Found: C, 72.65; H, 4.47; F, 3.82; N, 2.81%.

1-(4-Fluorobenzyl)-4-oxo-6-(4-phenylbutoxy)-1,4-dihydroquinoline-3-carboxylic Acid (4r)

Compound 4r was prepared from n class="Chemical">ethyl 1-(4-fluorobenzyl)-4-oxo-6-(4-phenylbutoxy)-1,4-dihydroquinoline-3-carboxylate by means of GP-D; 1 h; toluene; 60% as a white solid; 285 °C; IR ν 1624 (C=O), 1767 (C=O), 3059 (COOH) cm–1; 1H NMR (400 MHz DMSO-d6, δ) 1.65–1.69 (m, 2H, CH2), 2.52–2.57 (m, 2H, CH2), 4.06 (t, J = 7.0 Hz, 2H, CH2), 4.51 (t, J = 7.0 Hz, 2H, CH2), 5.76 (s, 2H, CH2), 7.09–7.26 (m, 9H, benzene H), 7.49 (d, J = 8.5 Hz, 1H, quinolinone H), 7.56 (d, J = 8.5 Hz, 1H, quinolinone H), 8.89 (s, 1H, quinolinone H), 9.12 (s, 1H, quinolinone H), 15.32 (br s, 1H, COOH). Anal. calcd for C29H28FNO4: C, 73.56; H, 5.96; F, 4.01; N, 2.96%. Found: C, 73.45; H, 5.95; F, 3.99; N, 2.97%.

6-([1,1′-Biphenyl]-4-ylmethoxy)-1-(4-fluorobenzyl)-4-oxo-1,4-dihydroquinoline-3-carboxylic Acid (4s)

Compound 4s was prepared from ethyl 6-([1,1′-biphenyl]-4-ylmethoxy)-1-(4-fluorobenzyl)-4-oxo-1,4-dihydroquinoline-3-carboxylate by means of n class="Gene">GP-D; 2 h; toluene; 82% as a white solid; 275 °C; IR ν 1600 (C=O), 1765 (C=O), 3000 (COOH) cm–1; 1H NMR (400 MHz DMSO-d6, δ) 5.23 (s, 2H, CH2), 5.76 (s, 2H, CH2), 7.10–7.12 (m, 2H, benzene H), 7.23–7.30 (m, 2H, benzene H), 7.36–7.40 (m, 2H, benzene H), 7.47–7.51 (m, 3H, benzene H), 7.57–7.62 (m, 4H, benzene H, and quinolinone H), 7.76–7.78 (m, 3H, benzene H, and quinolinone H), 9.12 (s, 1H, quinolinone H), 15.18 (br s, 1H, OH). Anal. calcd for C30H22FNO4: C, 75.15; H, 4.62; F, 3.96; N, 2.92%. Found: C, 75.23; H, 4.64; F, 3.94; N, 2.92%.

6-((4-(Benzyloxy)benzyl)oxy)-1-(4-fluorobenzyl)-4-oxo-1,4-dihydroquinoline-3-carboxylic Acid (4t)

Compound 4t was prepared from ethyl 6-((4-(benzyloxy)benzyl)oxy)-1-(4-fluorobenzyl)-4-oxo-1,4-dihydroquinoline-3-carboxylate by means of n class="Gene">GP-D; 2 h; toluene; 100% as a yellow solid; 230 °C; IR ν 1600 (C=O), 1807 (C=O), 3025 (COOH) cm–1; 1H NMR (400 MHz DMSO-d6, δ) 5.01 (s, 2H, CH2), 5.08 (s, 2H, CH2), 5.76 (s, 2H, CH2), 6.93–6.95 (m, 2H, benzene H), 7.07–7.11 (m, 3H, benzene H), 7.21–7.41 (m, 9H, benzene H, and quinolinone H), 7.51 (d, J = 8.5 Hz, 1H, quinolinone H), 7.73 (s, 1H, quinolinone H), 9.12 (s, 1H, quinolinone), 15.21 (br s, 1H, COOH). Anal. calcd for C31H24FNO5: C, 73.07; H, 4.75; F, 3.73; N, 2.75%. Found: C, 73.11; H, 4.74; F, 3.72; N, 2.74%.

Ethyl 1-(4-Fluorobenzyl)-4-oxo-1,4-dihydroquinoline-3-carboxylate (5a)

Synthesis, analytical, and spectroscopic data are reported in the literature.[41]

Ethyl 6-Cyano-1-(4-fluorobenzyl)-4-oxo-1,4-dihydroquinoline-3-carboxylate (5b)

Compound 5b was prepared from ethyl 6-cyano-4-oxo-1,4-dihydroquinoline-3-carboxylate by means of GP-C; 2 h; n class="Chemical">ethyl acetate; ethanol; 93% as a yellow solid; 223 °C; IR ν 1592 (C=O), 1720 (C=O), 2231 (CN) cm–1; 1H NMR (400 MHz DMSO-d6, δ) 1.30 (t, J = 7.0 Hz, 3H, CH3), 4.26 (q, J = 7.0 Hz, 2H, CH2), 5.68 (s, 2H, CH2), 7.18–7.21 (m, 2H, benzene H), 7.32–7.36 (m, 2H, benzene H), 7.80 (d, J = 8.5 Hz, 1H, quinolinone H), 8.06 (d, J = 8.5 Hz, 1H, quinolinone H), 8.53 (s, 1H, quinolinone H), 8.95 (s, 1H, quinolinone H). Anal. calcd for C20H15FN2O3: C, 68.57; H, 4.32; F, 5.42; N, 8.00%. Found: C, 68.44; H, 4.31; F, 5.43; N, 8.01%.

Ethyl 1-(4-Fluorobenzyl)-4-oxo-6-(trifluoromethyl)-1,4-dihydroquinoline-3-carboxylate (5c)

Compound 5c was prepared from n class="Chemical">ethyl 6-(methylsulfonyl)-4-oxo-1,4-dihydroquinoline-3-carboxylate by means of GP-C; 3 h; ethyl acetate; THF; 92% as a white solid; 211 °C; THF; IR ν 1612 (C=O) and 1706 (C=O) cm–1; 1H NMR (400 MHz DMSO-d6, δ) 1.31 (t, J = 7.0 Hz, 3H, CH3), 4.27 (q, J = 7.0 Hz, 2H, CH2), 5.77 (s, 2H, CH2), 7.13–7.18 (m, 2H, benzene H), 7.41–7.45 (m, 2H, benzene H), 7.86 (d, J = 8.5 Hz, 1H, quinolinone H), 7.94 (d, J = 8.5 Hz, 1H, quinolinone H), 8.61 (s, 1H, quinolinone H), 8.88 (s, 1H, quinolinone H). Anal. calcd for C20H15F4NO3: C, 61.07; H, 3.84; F, 19.32; N, 3.56%. Found: C, 61.30; H, 3.83; F, 19.36; N, 3.55%.

Ethyl 6-Acetyl-1-(4-fluorobenzyl)-4-oxo-1,4-dihydroquinoline-3-carboxylate (5d)

Synthesis, analytical, and spectroscopic data are reported in the literature.[38]

Ethyl 1-(4-Fluorobenzyl)-6-nitro-4-oxo-1,4-dihydroquinoline-3-carboxylate (5e)

Compound 5e was prepared from ethyl 6-nitro-4-oxo-1,4-dihydroquinoline-3-carboxylate by means of GP-C; 2 h; n class="Chemical">ethyl acetate/methanol 95:5; ethanol; 86% as a brown solid; 211 °C; IR ν 1454 (NO2), 1617 (C=O), 1719 (C=O) cm–1; 1H NMR (400 MHz DMSO-d6, δ) 1.37 (t, J = 7.0 Hz, 3H, CH3), 4.29 (q, J = 7.0 Hz, 2H, CH2), 5.89 (s, 2H, CH2), 7.18–7.24 (m, 2H, benzene H), 7.34–7.39 (m, 2H, benzene H), 8.06 (d, J = 8.5 Hz, 1H, quinolinone H), 8.57 (d, J = 8.5 Hz, 1H, quinolinone H), 9.01 (s, 1H, quinolinone H), 9.35 (s, 1H, quinolinone H). Anal. calcd for C19H15FN2O5: C, 61.62; H, 4.08; F, 5.13; N, 7.56%. Found: C, 61.67; H, 4.09; F, 5.14; N, 7.55%.

Ethyl 1-(4-Fluorobenzyl)-6-(methylsulfonyl)-4-oxo-1,4-dihydroquinoline-3-carboxylate (5f)

Compound 5f was prepared from ethyl 6-(methylsulfonyl)-4-oxo-1,4-dihydroquinoline-3-carboxylate by means of GP-C; 2 h; n class="Chemical">ethyl acetate; methanol; 88% as a brown solid; 224 °C; IR ν 1033 (SO2CH3), 1631 (C=O), 1733 (C=O) cm–1; 1H NMR (400 MHz DMSO6, δ) 1.29 (t, J = 7.0 Hz, 3H, CH3), 3.30 (s, 3H, CH3), 4.25 (q, J = 7.0 Hz, 2H, CH2), 5.70 (s, 2H, CH2), 7.17–7.21 (m, 2H, benzene H), 7.24–7.31 (m, 2H, benzene H), 7.87 (d, J = 8.5 Hz, 1H, quinolinone H), 8.13 (d, J = 7.0 Hz, 1H, quinolinone H), 8.68 (s, 1H, quinolinone H), 8.99 (s, 1H, quinolinone H). Anal. calcd for C20H18FNO5S: C, 59.55; H, 4.50; F, 4.71; N, 3.47; S, 7.95%. Found: C, 59.47; H, 4.49; F, 4.72; N, 3.48; S, 7.94%.

Ethyl 1-(4-Fluorobenzyl)-6-hydroxy-4-oxo-1,4-dihydroquinoline-3-carboxylate (5g)

Compound 5g was prepared from ethyl 6-hydroxy-4-oxo-1,4-dihydroquinoline-3-carboxylate by means of GP-C; 2 h; chloroform/mn class="Chemical">ethanol 90:10; methanol; 70% as a brown solid; 220 °C; IR v 1554 (C=O), 1702 (C=O) cm–1; 1H NMR (400 MHz DMSO-d6, δ) 1.29 (t, J = 7.0 Hz, 3H, CH3), 4.25 (q, J = 7.0 Hz, 2H, CH2), 5.63 (s, 2H, CH2), 7.17–7.21 (m, 3H, benzene H, and quinolinone H), 7.28–7.31 (m, 2H, benzene H), 7.52 (d, J = 7.0 Hz, 1H, quinolinone H), 7.58 (s, 1H, quinolinone H), 8.83 (s, 1H, quinolinone H), 10.06 (br s, 1H, OH). Anal. calcd for C17H12FNO4: C, 65.18; H, 3.86; F, 6.06; N, 4.47%. Found: C, 65.27; H, 3.87; F, 6.07; N, 4.45%.

Ethyl 1-(4-Fluorobenzyl)-6-methoxy-4-oxo-1,4-dihydroquinoline-3-carboxylate (5h)

Compound 5h was prepared from n class="Chemical">ethyl 6-methoxy-4-oxo-1,4-dihydroquinoline-3-carboxylate by means of GP-C; 2 h; chloroform/methanol 90:10; methanol; 82% as a brown solid; 225 °C; IR v 1557 (C=O) and 1705 (C=O) cm–1; 1H NMR (400 MHz DMSO-d6, δ) 1.30 (t, J = 7.0 Hz, 3H, CH3), 3.84 (s, 3H, CH3), 4.25 (q, J = 7.0 Hz, 2H, CH2), 5.66 (s, 2H, CH2), 7.17–7.19 (m, 2H, benzene H), 7.28–7.32 (m, 3H, benzene H, and quinolinone H), 7.60 (d, J = 8.5 Hz, 1H, quinolinone H), 7.66 (s, 1H, quinolinone H), 8.87 (s, 1H, quinolinone H). Anal. calcd for C18H14FNO4: C, 66.05; H, 4.31; F, 5.80; N, 4.28%. Found: C, 66.31; H, 4.30; F, 5.82; N, 4.27%.

Ethyl 1-(4-Fluorobenzyl)-4-oxo-6-phenoxy-1,4-dihydroquinoline-3-carboxylate (5i)

Compound 5i was prepared from n class="Chemical">ethyl 4-oxo-6-phenoxy-1,4-dihydroquinoline-3-carboxylate by means of GP-C; 3 h; ethyl acetate/methanol 90:10; methanol; 73% as a yellow solid; >300 °C; IR ν 1556 (C=O) and 1703 (C=O) cm–1; 1H NMR (400 MHz DMSO-d6, δ) 1.27 (t, J = 7.0 Hz, 3H, CH3), 4.19–4.24 (q, J = 7.0 Hz, 2H, CH2), 5.66 (s, 2H, CH2), 7.09–7.11 (m, 2H, benzene), 7,17–7,24 (m, 3H, benzene H), 7.30–7.34 (m, 2H, benzene H), 7.14–7.47 (m, 2H, benzene H), 7.58–7.62 (m, 2H, quinolinone H), 7.71 (s, 1H, quinolinone H), 8.89 (s, 1H, quinolinone H). Anal. calcd for C25H20FNO4: C, 71.93; H, 4.83; F, 4.55; N, 3.36%. Found: C, 71.80; H, 4.84; F, 4.56; N, 3.37%.

Ethyl 6-(3-(Dimethylamino)propoxy)-1-(4-fluorobenzyl)-4-oxo-1,4-dihydroquinoline-3-carboxylate (5j)

Compound 5j was prepared from n class="Chemical">ethyl 6-(3-(dimethylamino)propoxy)-4-oxo-1,4-dihydroquinoline-3-carboxylate by means of GP-C; 2 h; chloroform/methanol 90:10; methanol; 70% as a brown solid; >300°C; IR v 1554 (CO) and 1702 (CO) cm–1; 1H NMR (400 MHz DMSO-d6, δ) 1.35 (t, J = 7.0 Hz, 3H, CH3), 1.89–1.96 (m, 2H, CH2), 2.19 (s, 3H, CH3), 2.20 (s, 3H, CH3), 2.40 (t, J = 7.0 Hz, 2H, CH2), 4.13 (t, J = 7.0 Hz, 2H, CH2), 4.29 (q, J = 7.0 Hz, 2H, CH2), 5.71 (s, 2H, CH2), 7.22–7.27 (m, 2H, benzene H), 7.33–7.37 (m, 3H, benzene H, and quinolinone H), 7.65 (d, J = 8.5 Hz, 1H, quinolinone H), 7.70 (s, 1H, quinolinone H), 8.92 (s, 1H, quinolinone H). Anal. calcd for C22H23FN2O4: C, 66.32; H, 5.82; F, 4.77; N, 7.03%. Found: C, 66.45; H, 5.83; F, 4.76; N, 7.05%.

(E)-Ethyl 1-(4-Fluorobenzyl)-4-oxo-6-(3-oxo-3-phenylprop-1-en-1-yl)-1,4-dihydroquinoline-3-carboxylate (5k)

Compound 5k was prepared from (E)-ethyl 4-oxo-6-(3-oxo-3-phenylprop-1-en-1-yl)-1,4-dihydroquinoline-3-carboxylate by means of GP-C; 2 h; n class="Chemical">ethyl acetate; acetonitrile; 80% as a yellow solid; 278 °C; IR ν 1570 (C=O), 1582 (C=O), 1684 (C=O) cm–1; 1H NMR (400 MHz DMSO-d6, δ) 1.28 (t, J = 7.0 Hz, 3H, CH3), 4.25 (q, J = 7.0 Hz, 2H, CH2), 5.69 (s, 2H, CH2), 7.17–7.21 (m, 2H, benzene H), 7.31–7.35 (m, 2H, benzene H), 7.54–7.57 (m, 2H, benzene H), 7.64–7.70 (t, J = 8.0 Hz, 1H, benzene H), 7.79–7.83 (m, 3H, benzene H, and alkene H), 7.98 (d, J = 16.0 Hz, 1H, alkene H), 8.15 (d, J = 8.5 Hz, 1H, quinolinone H), 8.25 (d, J = 7.0 Hz, 1H, quinolinone H), 8.55 (s, 1H, quinolinone), 8.91 (s, 1H, quinolinone). Anal. calcd for C26H18FNO4: C, 73.06; H, 4.24; F, 4.44; N, 3.28%. Found: C, 73.17; H, 4.25; F, 4.43; N, 3.27%.

Ethyl 6-(Benzyloxy)-1-(4-fluorobenzyl)-4-oxo-1,4-dihydroquinoline-3-carboxylate (5l)

Compound 5l was prepared from ethyl 6-(benzyloxy)-4-oxo-1,4-dihydroquinoline-3-carboxylate by means of GP-C; 2 h; n class="Chemical">ethyl acetate; ethanol; 90% as a brown solid; >300 °C; IR ν 1595 (C=O), 1722 (C=O) cm–1; 1H NMR (400 MHz DMSO-d6, δ) 1.39 (t, J = 7.0 Hz, 3H, CH3), 4.37 (q, J = 7.0 Hz, 2H, CH2), 5.06 (s, 2H, CH2), 5.35 (s, 2H, CH2), 7.00–7.05 (m, 4H, benzene H), 7.10–7.14 (m, 2H, benzene H), 7.16–7.26 (m, 3H, benzene H), 7.39–7.45 (m, 2H, quinolinone H), 7.96 (s, 1H, quinolinone H), 8.52 (s, 1H, quinolinone H). Anal. calcd for C26H22FNO4: C, 72.38; H, 5.14; F, 4.40; N, 3.25%. Found: C, 72.56; H, 5.15; F, 4.41; N, 3.26%.

Ethyl 6-((2,3-Dichlorobenzyl)oxy)-1-(4-fluorobenzyl)-4-oxo-1,4-dihydroquinoline-3-carboxylate (5m)

Compound 5m was prepared from ethyl 6-((2,3-dichlorobenzyl)oxy)-4-oxo-1,4-dihydroquinoline-3-carboxylate by means of GP-C; 2 h; n class="Chemical">ethyl acetate; cyclohexane; 65% as a brown solid; 267 °C; IR ν 1626 (C=O), 1738 (C=O) cm–1; 1H NMR (400 MHz DMSO-d6, δ) 1.30 (t, J = 7.0 Hz, 3H, CH3), 4.25 (q, J = 7.0 Hz, 2H, CH2), 5.30 (s, 2H, CH2), 5.67 (s, 2H, CH2), 7.17–7.22 (m, 2H, benzene H), 7.29–7.31 (m, 2H, benzene H), 7.40–7.44 (m, 2H, benzene H, and quinolinone H), 7.58–7.68 (m, 3H, benzene H, and quinolinone H), 7.75 (s, 1H, quinolone H), 8.88 (s, 1H, quinolinone H). Anal. calcd for C26H20Cl2FNO4: C, 62.41; H, 4.03; Cl, 14.17; F, 3.80; N, 2.80%. Found: C, 62.56; H, 4.04; Cl, 14.21; F, 3.79; N, 2.81%.

Ethyl 6-((3,4-Dichlorobenzyl)oxy)-1-(4-fluorobenzyl)-4-oxo-1,4-dihydroquinoline-3-carboxylate (5n)

Compound 5n was prepared from n class="Chemical">ethyl 6-((3,4-dichlorobenzyl)oxy)-4-oxo-1,4-dihydroquinoline-3-carboxylate by means of GP-C; 3 h; ethyl acetate; benzene; 40% as a brown solid; 273 °C; IR ν 1615 (C=O), 1732 (C=O) cm–1; 1H NMR (400 MHz DMSO-d6, δ) 1.40 (t, J = 7.0 Hz, 3H, CH3), 4.40 (q, J = 7.0 Hz, 2H, CH2), 5.06 (s, 2H, CH2), 5.64 (s, 2H, CH2), 7.96–7.22 (m, 2H, benzene H), 7.29–7.31 (m, 2H, benzene H), 7.40–7.44 (m, 2H, benzene H, and quinolinone H), 7.58–7.68 (m, 3H, benzene H, and quinolinone H), 7.75 (s, 1H, quinolone H), 8.88 (s, 1H, quinolinone H). Anal. calcd for C26H20Cl2FNO4: C, 62.41; H, 4.03; Cl, 14.17; F, 3.97; N, 2.80%. Found: C, 62.56; H, 4.06; Cl, 14.20; F, 3.98; N, 2.81%.

Ethyl 1-(4-Fluorobenzyl)-6-(naphthalen-1-ylmethoxy)-4-oxo-1,4-dihydroquinoline-3-carboxylate (5o)

Compound 5o was prepared from n class="Chemical">ethyl 6-(naphthalen-1-ylmethoxy)-4-oxo-1,4-dihydroquinoline-3-carboxylate by means of GP-C; 2 h; ethyl acetate; toluene; 59% as a yellow solid; 222 °C; IR ν 1598 (C=O), 1730 (C=O) cm–1; 1H NMR (400 MHz DMSO-d6, δ) 1.21 (t, J = 7.0 Hz, 3H, CH3), 4.15 (q, J = 7.0 Hz, 2H, CH2), 5.21 (s, 2H, CH2), 5.57 (s, 2H, CH2), 7.08–7.13 (m, 3H, benzene H, and naphthalene H), 7.20–7.24 (m, 2H, naphthalene H), 7.29–7.35 (m, 2H, quinolinone H), 7.41–7.60 (m, 3H, benzene H, and naphthalene H), 7.79 (d, J = 8.5 Hz, 1H, naphthalene H), 7.85–7.91 (m, 2H, naphthalene H), 8.01 (s, 1H, quinolinone H), 8.89 (s, 1H, quinolinone). Anal. calcd for C30H24FNO4: C, 74.83; H, 5.02; F, 3.95; N, 2.91%. Found: C, 74.90; H, 5.00; F, 3.96; N, 2.90%.

Ethyl 1-(4-Fluorobenzyl)-6-(naphthalen-2-ylmethoxy)-4-oxo-1,4-dihydroquinoline-3-carboxylate (5p)

Compound 5p was prepared from n class="Chemical">ethyl 6-(naphthalen-2-ylmethoxy)-4-oxo-1,4-dihydroquinoline-3-carboxylate by means of GP-C; 3 h; ethyl acetate; toluene; 59% as a brown solid; 284 °C; IR ν 1630 (C=O), 1716 (C=O) cm–1; 1H NMR (400 MHz DMSO-d6, δ) 1.35 (t, J = 7.0 Hz, 3H, CH3), 4.28 (q, J = 7.0 Hz, 2H, CH2), 5.43 (s, 2H, CH2), 5.71 (s, 2H, CH2), 7.22–7.28 (m, 2H, benzene H), 7.33–7.36 (m, 2H, benzene H), 7.45 (d, J = 8.5 Hz, 1H, quinolinone H), 7.57–7.59 (m, 2H, naphthalene H), 7.64–7.69 (m, 2H, naphthalene H), 7.81 (s, 1H, quinolinone H), 7.96–8.05 (m, 4H, naphthalene H), 8.92 (s, 1H, quinolinone H). Anal. calcd for C30H24FNO4: C, 74.83; H, 5.02; F, 3.95; N, 2.91%. Found: C, 74.99; H, 5.03; F, 3.96; N, 2.90%.

Ethyl 6-(Benzo[d][1,3]dioxol-5-ylmethoxy)-1-(4-fluorobenzyl)-4-oxo-1,4-dihydroquinoline-3-carboxylate (5q)

Compound 5q was prepared from n class="Chemical">ethyl 6-(benzo[d][1,3]dioxol-5-ylmethoxy)-4-oxo-1,4-dihydroquinoline-3-carboxylate by means of GP-C; 3 h; ethyl acetate; 2-propanol; 71% as a brown solid; 291 °C; IR ν 1608 (C=O), 1718 (C=O) cm–1; 1H NMR (400 MHz DMSO-d6, δ) 1.26 (t, J = 7.0 Hz, 3H, CH3), 4.25 (q, J = 7.0 Hz, 2H, CH2), 5.09 (s, 2H, CH2), 5.66 (s, 2H, CH2), 6.02 (s, 2H, CH2), 6.88–6.97 (m, 2H, benzodioxolane H), 7.03 (s, 1H, benzodioxolane H), 7.17–7.22 (m, 2H, benzene H), 7.27–7.30 (m, 2H, benzene H), 7.37 (d, J = 8.5 Hz, 1H, quinolinone H), 7.60 (d, 1H, J = 8.5 Hz, quinolone H), 7.75 (s, 1H, quinolone H), 8.86 (s, 1H, quinolinone H). Anal. calcd for C27H22FNO6: C, 68.21; H, 4.66; F, 4.00; N, 2.95%. Found: C, 68.34; H, 4.67; F, 4.01; N, 2.96%.

Ethyl 1-(4-Fluorobenzyl)-4-oxo-6-(4-phenylbutoxy)-1,4-dihydroquinoline-3-carboxylate (5r)

Compound 5r was prepared from n class="Chemical">ethyl 4-oxo-6-(4-phenylbutoxy)-1,4-dihydroquinoline-3-carboxylate by means of GP-C; 3 h; ethyl acetate; toluene; 90% as a brown solid; 285 °C; IR ν 1606 (C=O), 1725 (C=O) cm–1; 1H NMR (400 MHz DMSO-d6, δ) 1.19 (q, J = 7.0 Hz, 3H, CH3), 1.65–1.68 (m, 4H, CH2), 2.52–2.57 (m, 2H, CH2), 3.99 (t, J = 7.0 Hz, 2H, CH2), 4.15 (t, J = 7.0 Hz, 2H, CH2), 5.56 (s, 2H, CH2), 7.06–7.29 (m, 9H, benzene H), 7.49 (d, J = 8.5 Hz, 1H, quinolinone H), 7.57 (s, 1H, quinolinone H), 7.63–7.65 (d, 1H, quinolinone H), 8.76 (s, 1H, quinolinone H). Anal. calcd for C29H28FNO4: C, 73.56; H, 5.96; F, 4.01; N, 2.96%. Found: C, 73.67; H, 5.95; F, 4.00; N, 2.95%.

Ethyl 6-([1,1′-Biphenyl]-4-ylmethoxy)-1-(4-fluorobenzyl)-4-oxo-1,4-dihydroquinoline-3-carboxylate (5s)

Compound 5s was prepared from ethyl 6-([1,1′-biphenyl]-4-ylmethoxy)-4-oxo-1,4-dihydroquinoline-3-carboxylate by means of GP-C; 2 h; n class="Chemical">ethyl acetate; ethanol; 88% as a brown solid; 285 °C; IR ν 1591 (C=O), 1748 (C=O) cm–1; 1H NMR (400 MHz DMSO-d6, δ) 1.21 (t, J = 7.0 Hz, 3H, CH3), 4.15 (q, J = 7.0 Hz, 2H, CH2), 5.17 (s, 2H, CH2), 5.57 (s, 2H, CH2), 7.08–7.12 (m, 2H, benzene H), 7.19–7.23 (m, 2H, benzene H), 7.28–7.33 (m, 2H, benzene H), 7.36–7.61 (m, 9H, benzene H, and quinilinone H), 7.69 (s, 1H, quinolinone H), 8.77 (s, 1H, quinolinone). Anal. calcd for C32H26FNO4: C, 75.73; H, 5.16; F, 3.74; N, 2.76%. Found: C, 75.65; H, 5.15; F, 3.75; N, 2.75%.

Ethyl 6-((4-(Benzyloxy)benzyl)oxy)-1-(4-fluorobenzyl)-4-oxo-1,4-dihydroquinoline-3-carboxylate (5t)

Compound 5t was prepared from ethyl 6-((4-(benzyloxy)benzyl)oxy)-4-oxo-1,4-dihydroquinoline-3-carboxylate by means of GP-C; 2.5 h; n class="Chemical">ethyl acetate; toluene; 69% as a yellow solid; 256 °C; IR ν 1600 (C=O), 1730 (C=O) cm–1; 1H NMR (400 MHz DMSO-d6, δ) 1.21 (t, J = 7.0 Hz, 3H, CH3), 4.15 (q, J = 7.0 Hz, 2H, CH2), 5.01 (s, 2H, CH2), 5.06 (s, 2H, CH2), 5.57 (s, 2H, CH2), 6.93 (d, J = 8.0 Hz, 2H, benzene H), 7.09 (t, J = 8.0 Hz, 1H, benzene H), 7.21–7.41 (m, 11H, benzene H, and quinolinone H), 7.50 (d, J = 8.5 Hz, 1H, quinolinone H), 7.66 (s, 1H, quinolinone H), 8.78 (s, 1H, quinolinone H). Anal. calcd for C33H28FNO5: C, 73.73; H, 5.25; F, 3.53; N, 2.61%. Found: C, 73.65; H, 5.26; F, 3.52; N, 2.60%.

(E)-3-(4-Aminophenyl)-1-phenylprop-2-en-1-one (6)

Synthesis, analytical, and spectroscopic data are reported in the literature.[37]

Synthesis of (E)-Diethyl 2-(((4-(3-oxo-3-phenylprop-1-en-1-yl)phenyl)amino)methylene)malonate (7)

(E)-3-(4-Aminophenyl)-1-phenylprop-2-en-1-one (2.20 mmol) was suspended in n class="Chemical">diethyl ethoxymethylenemalonate (0.44 mL; 2.20 mmol), and the reaction was stirred at 90 °C for 3 h and monitored by TLC. Upon completion of the reaction, the mixture was cooled down and poured into n-hexane (20 mL). The resulting precipitate was filtered, washed three times with n-hexane (5 mL) and petroleum ether, and dried under an IR lamp to afford the pure product as a brown solid (90%). Chromatography eluent: n-hexane/ethyl acetate 60:40. Recrystallization solvent: cyclohexane; mp 150 °C; IR ν 1589 (C=O), 1609 (C=O), 1681 (C=O), 2984 (NH) cm–1; 1H NMR (400 MHz, CDCl3, δ) 1.36–1.40 (m, 6H, CH3), 4.24–4.35 (m, 4H, CH2), 7.18 (d, J = 8.0 Hz, 2H, benzene H), 7.50 (d, J = 16.0 Hz, 1H, alkene H), 7.55 (d, J = 8.0 Hz, 2H, benzene H), 7.59 (d, J = 16.0 Hz, 1H, alkene H), 7.67 (d, J = 8.0 Hz, 2H, benzene H), 7.79 (t, J = 8.0 Hz, 1H, benzene H), 8.02 (d, J = 8.0 Hz, 2H, benzene H), 8,55 (d, J = 7.0 Hz, 1H, alkene H) 11.11 (d, J = 7.0 Hz, 1H, NH). Anal. calcd for C23H23NO5: C, 70.21; H, 5.89; N, 3.56%. Found: C, 70.25; H, 5.90; N, 3.55%.

Ethyl 4-Oxo-1,4-dihydroquinoline-3-carboxylate (8a)

Synthesis, analytical, and spectroscopic data are reported in the literature.[41]

Ethyl 6-Cyano-4-oxo-1,4-dihydroquinoline-3-carboxylate (8b)

Synthesis, analytical, and spectroscopic data are reported in the literature.[43]

Ethyl 6-(Trifluromethyl)-4-oxo-1,4-dihydroquinoline-3-carboxylate (8c)

Synthesis, analytical, and spectroscopic data are reported in the literature.[44]

Ethyl 6-Acetyl-4-oxo-1,4-dihydroquinoline-3-carboxylate (8d)

Synthesis, analytical, and spectroscopic data are reported in the literature.[38]

Ethyl 6-Nitro-4-oxo-1,4-dihydroquinoline-3-carboxylate (8e)

Synthesis, analytical, and spectroscopic data are reported in the literature.[42]

Ethyl 6-(Methylsulfonyl)-4-oxo-1,4-dihydroquinoline-3-carboxylate (8f)

Synthesis, analytical, and spectroscopic data are reported in the literature.[47]

Ethyl 6-Hydroxy-4-oxo-1,4-dihydroquinoline-3-carboxylate (8g)

Synthesis, analytical, and spectroscopic data are reported in the literature.[45]

Ethyl 6-Methoxy-4-oxo-1,4-dihydroquinoline-3-carboxylate (8h)

Synthesis, analytical, and spectroscopic data are reported in the literature.[46]

Ethyl 4-Oxo-6-phenoxy-1,4-dihydroquinoline-3-carboxylate (8i)

Synthesis, analytical, and spectroscopic data are reported in the literature.[48]

Ethyl 6-(3-(Dimethylamino)propoxy)-4-oxo-1,4-dihydroquinoline-3-carboxylate (8j)

Compound 8j was prepared from (E)-diethyl diethyl 2-(((4(4(dimethylamino)butoxy)phenyl)amino)methylene)malonate by means of GP-B; 3 h; n class="Chemical">ethanol; 90% as a yellow solid; 293 °C; IR ν 1623 (C=O), 1717 (C=O), 2965 (NH) cm–1; 1H NMR (400 MHz DMSO-d6, δ) 1.36 (t, J = 7.0 Hz, 3H, CH3), 1.89–1.96 (m, 2H, CH2), 2.15 (s, 3H, CH3), 2.16 (s, 3H, CH3), 2.42 (t, J = 7.0 Hz, 2H, CH2), 4.15 (t, J = 7.0 Hz, 2H, CH2), 4.32 (q, J = 7.0 Hz, 2H, CH2), 7.39 (d, J = 8.5 Hz, 1H, quinolinone H), 7.65 (d, J = 8.5 Hz, 1H, quinolinone H), 7.71 (s, 1H, quinolinone H), 8.92 (s, 1H, quinolinone H), 10.31 (br s, 1H, NH). Anal. calcd for C17H22N2O4: C, 64.13; H, 6.97; N, 8.80%. Found: C, 64.24; H, 6.95; N, 8.81%.

(E)-Ethyl 4-Oxo-6-(3-oxo-3-phenylprop-1-en-1-yl)-1,4-dihydroquinoline-3-carboxylate (8k)

Compound 8k was prepared from n class="Chemical">(E)-diethyl 2-(((4-(3-oxo-3-phenylprop-1-en-1-yl)phenyl)amino)methylene)malonate by means of GP-B; 2 h; ethanol; 100% as a yellow solid; 289 °C; IR ν 1604 (C=O), 1661 (C=O), 1708 (C=O), 2975 (NH) cm–1; 1H NMR (400 MHz DMSO-d6, δ) 1.28 (t, J = 7.0 Hz, 3H, CH3), 4.23 (q, J = 7.0 Hz, 2H, CH2), 7.19 (d, J = 8.0 Hz, 2H, benzene H), 7.38–7.45 (m, 4H, benzene H, and alkene H), 7.50 (d, J = 16.0 Hz, 1H, alkene H), 7.67 (d, J = 8.5 Hz, 1H, quinolinone H), 7.79 (d, J = 8.5 Hz, 1H, quinolinone H), 8.01 (s, 1H, quinolinone H), 8.53 (s, 1H, quinolinone H), 11.19 (br s, 1H, NH). Anal. calcd for C21H17NO4: C, 72.61; H, 4.93; N, 4.03%. Found: C, 72.67; H, 4.92; N, 4.04%.

Ethyl 6-(Benzyloxy)-4-oxo-1,4-dihydroquinoline-3-carboxylate (8l)

Synthesis, analytical, and spectroscopic data are reported in the literature.[49]

Ethyl 6-((2,3-Dichlorobenzyl)oxy)-4-oxo-1,4-dihydroquinoline-3-carboxylate (8m)

Compound 8m was prepared from diethyl 2-(((4-((2,3-dichlorobenzyl)oxy)phenyl)amino)methylene)malonate by means of GP-B; 2 h; toluene; 92% as a brown solid; 198 °C; n class="Gene">IR ν 1609 (C=O), 1714 (C=O), 2978 (NH) cm–1; 1H NMR (400 MHz DMSO-d6) δ 1.30 (t, J = 7.0 Hz, 3H, CH3), 4.22 (t, 2H, J = 7.0 Hz, CH2) 5.32 (s, 2H, CH2), 7.43–7.47 (m, 2H, benzene H, and quinolinone H), 7.60–7.65 (m, 3H, benzene H, and quinolinone H), 7.72 (s, 1H, quinolone H), 8.88 (s, 1H, quinolinone H), 12.34 (br s, 1H, NH). Anal. calcd for C19H15Cl2NO4: C, 58.18; H, 3.85; Cl, 18.08; N, 3.57%. Found: C, 58.20; H, 3.84; Cl, 18.06; N, 3.56%.

Ethyl 6-((3,4-Dichlorobenzyl)oxy)-4-oxo-1,4-dihydroquinoline-3-carboxylate (8n)

Compound 8n was prepared from diethyl 2-(((4-((3,4-dichlorobenzyl)oxy)phenyl)amino)methylene)malonate by means of GP-B; 3 h; toluene; 96% as a brown solid; 210 °C; n class="Gene">IR ν 1608 (C=O), 1714 (C=O), 2989 (NH) cm–1; 1H NMR (400 MHz DMSO-d6, δ) 1.39 (t, J = 7.0 Hz, 3H, CH3), 4.46 (t, J = 7.0 Hz, 2H, CH2) 5.27 (s, 2H, CH2), 7.43–7.47 (m, 2H, benzene H, and quinolinone H), 7.60–7.65 (m, 3H, benzene H, and quinolinone H), 7.76 (s, 1H, quinolone H), 8.71 (s, 1H, quinolinone H), 9.22 (br s, 1H, NH). Anal. calcd for C19H15Cl2NO4: C, 58.18; H, 3.85; Cl, 18.08; N, 3.57%. Found: C, 58.32; H, 3.86; Cl, 18.11; N, 3.58%.

Ethyl 6-(Naphthalen-1-ylmethoxy)-4-oxo-1,4-dihydroquinoline-3-carboxylate (8o)

Compound 8o was prepared from n class="Chemical">diethyl 2-(((4-(naphthalen-1-ylmethoxy)phenyl)amino)methylene)malonate by means of GP-B; 2 h; ethanol; 100% as a yellow solid; 191 °C; IR ν 1620 (C=O), 1730 (C=O), 2926 (NH) cm–1; 1H NMR (400 MHz DMSO-d6, δ) 1.17 (t, J = 7.0 Hz, 3H, CH3), 4.13 (q, J = 7.0 Hz, 2H, CH2), 5.58 (s, 2H, CH2), 6.91–6.93 (m, 2H, naphthalene H), 7.03–7.07 (m, 2H, naphthalene H), 7.41–7.60 (m, 3H, naphthalene H), 7.84–8.02 (m, 3H, quinolinone H), 8.42 (s, 1H, quinolinone H), 12.23 (br s, 1H, NH). Anal. calcd for C23H19NO4: C, 73.98; H, 5.13; N, 3.75%. Found: C, 74.10; H, 5.14; N, 3.74%.

Ethyl 6-(Naphthalen-2-ylmethoxy)-4-oxo-1,4-dihydroquinoline-3-carboxylate (8p)

Compound 8p was prepared from n class="Chemical">diethyl 2-(((4-(naphthalen-2-ylmethoxy)phenyl)amino)methylene)malonate by means of GP-B; 2 h; benzene; 95% as a brown solid; 222 °C; IR ν 1613 (C=O), 1720 (C=O), 2901 (NH) cm–1; 1H NMR (400 MHz DMSO-d6, δ) 1.30 (t, J = 7.0 Hz, 3H, CH3), 4.22 (t, J = 7.0 Hz, 2H, CH2) 5.39 (s, 2H, CH2), 7.60–7.63 (m, 2H, naphthalene H), 7.69–7.74 (m, 2H, naphthalene H), 7.77–8.05 (m, 6H, naphthalene H, and quinolinone H), 8.49 (s, 1H, quinolinone H), 12.30 (br s, 1H, NH). Anal. calcd for C23H19NO4: C, 73.98; H, 5.13; N, 3.75%. Found: C, 74.02; H, 5.14; N, 3.76%.

Ethyl 6-(Benzo[d][1,3]dioxol-5-ylmethoxy)-4-oxo-1,4-dihydroquinoline-3-carboxylate (8q)

Compound 8q was prepared from n class="Chemical">diethyl 2-(((4-(benzo[d][1,3]dioxol-5-ylmethoxy)phenyl)amino)methylene)malonate by means of GP-B; 2 h; 2-propanol; 100% as a brown solid; 188 °C; IR ν 1622 (C=O), 1721 (C=O), 2954 (NH) cm–1; 1H NMR (400 MHz DMSO-d6, δ) 1.29 (t, J = 7.0 Hz, 3H, CH3), 4.25 (q, J = 7.0 Hz, 2H, CH2), 5.09 (s, 2H, CH2), 5.66 (s, 2H, CH2), 6.02 (s, 2H, CH2), 6.88–6.97 (m, 2H, benzodioxolane H), 7.06 (s, 1H, benzodioxolane H), 7.20–7.25 (m, 2H, benzene H), 7.30–7.33 (m, 2H, benzene H), 7.39 (d, J = 8.5 Hz, 1H, quinolinone H), 7.60–7.62 (d, J = 8.5 Hz, 1H, quinolone H), 7.75 (s, 1H, quinolone H), 8.86 (s, 1H, quinolinone H), 12.30 (br s, 1H, NH). Anal. calcd for C20H17NO6: C, 65.39; H, 4.66; N, 3.81; O, 26.13%. Found: C, 65.43; H, 4.67; N, 3.82%.

Ethyl 4-Oxo-6-(4-phenylbutoxy)-1,4-dihydroquinoline-3-carboxylate (8r)

Compound 8r was prepared from n class="Chemical">diethyl 2-(((4-(4-phenylbutoxy)phenyl)amino)methylene)malonate by means of GP-B; 3 h; benzene; 91% as a brown solid; 200 °C; IR ν 1614 (C=O), 1725 (C=O), 2965 (NH) cm–1; 1H NMR (400 MHz DMSO-d6, δ) 1.20 (q, J = 7.0 Hz, 3H, CH3), 1.59–1.63 (m, 2H, CH2), 1.74–1.78 (m, 2H, CH2) 2.66 (t, J = 7.0 Hz, 2H, CH2), 4.04 (t, J = 7.0 Hz, 2H, CH2), 4.24 (q, J = 7.0 Hz, 2H, CH2), 7.19–7.24 (m, 5H, benzene H), 7.47 (d, J = 8.5 Hz, 1H, quinolinone H), 7.51 (s, 1H, quinolinone H), 7.60 (d, J = 8.5 Hz, 1H, quinolinone H), 8.89 (s, 1H, quinolinone H), 12.01 (br s, 1H, NH). Anal. calcd for C22H23NO4: C, 72.31; H, 6.34; N, 3.83%. Found: C, 72.40; H, 6.35; N, 3.84%.

Ethyl 6-([1,1′-Biphenyl]-4-ylmethoxy)-4-oxo-1,4-dihydroquinoline-3-carboxylate (8s)

Compound 8s was prepared from diethyl 2-(((4-([1,1′-biphenyl]-4-ylmethoxy)phenyl)amino)methylene)malonate by means of GP-B; 2 h; benzene; 95% as a brown solid; 280 °C; n class="Gene">IR ν 1604 (C=O), 1710 (C=O), 2900 (NH) cm–1; 1H NMR (400 MHz DMSO-d6, δ) 1.19 (t, J = 7.0 Hz, 3H, CH3), 4.13 (q, J = 7.0 Hz, 2H, CH2), 5.15 (s, 2H, CH2), 7.28–7.60 (m, 12H, benzene H), 8.22 (s, 1H, quinolinone H), 11.62 (br s, 1H, NH). Anal. calcd for C25H21NO4: C, 75.17; H, 5.30; N, 3.51%. Found: C, 75.34; H, 5.31; N, 3.50%.

Ethyl 6-((4-(Benzyloxy)benzyl)oxy)-4-oxo-1,4-dihydroquinoline-3-carboxylate (8t)

Compound 8t was prepared from diethyl 2-(((4-((4-(benzyloxy)benzyl)oxy)phenyl)amino)methylene)malonate by means of GP-B; 3 h; toluene; 94% as a brown solid; 198 °C; n class="Gene">IR ν 1609 (C=O), 1718 (C=O), 2926 (NH) cm–1; 1H NMR (400 MHz DMSO-d6, δ) 1.19 (t, J = 7.0 Hz, 3H, CH3), 4.12 (q, J = 7.0 Hz, 2H, CH2), 5.03 (s, 2H, CH2), 5.10 (s, 2H, CH2); 6.91–6.95 (m, 2H, benzene H), 7.24–7.37 (m, 7H, benzene H), 7.48–7.50 (m, 2H, quinolinone H), 7.56 (s, 1H, quinolinone H), 8.40 (s, 1H, quinolinone H), 12.20 (br s, 1H, NH). Anal. calcd for C26H23NO5: C, 72.71; H, 5.40; N, 3.26%. Found: C, 72.87; H, 5.41; N, 3.25%.

Diethyl 2-(((4-Hydroxyphenyl)amino)methylene)malonate (9)

Synthesis, analytical, and spectroscopic data are reported in the literature.[50]

Diethyl 2-(((4-(3-(Dimethylamino)propoxy)phenyl)amino)methylene)malonate (10a)

Compound 10a was prepared from 2-(((4-hydroxyphenyl)amino)methylene)malonate by means of GP-A; 3-dimethylamino-1-propyl chloride; 2 h; n class="Chemical">ethyl acetate; ethanol; 62% as a brown solid; 134 °C; IR ν 1718 (C=O), 2926 (NH) cm–1; 1H NMR (400 MHz DMSO-d6, δ) 1.35–1.40 (m, 6H, CH3), 1.90–1.96 (m, 2H, CH2), 2.17 (s, 3H, CH3), 2.18 (s, 3H, CH3), 2.45 (t, J = 7.0 Hz, 2H, CH2), 4.17 (t, J = 7.0 Hz, 2H, CH2), 4.29–4.34 (m, 4H, CH2), 6.94 (d, J = 8.0 Hz, 2H, benzene H), 7.29 (d, J = 8.0 Hz, 2H, benzene H), 8.33 (s, 1H, alkene H), 10.70 (s, 1H, NH). Anal. calcd for C19H28N2O5: C, 62.62; H, 7.74; N, 7.69%. Found: C, 62.54; H, 7.73; N, 7.68%.

Diethyl 2-(((4-(Benzyloxy)phenyl)amino)methylene)malonate (10b)

Synthesis, analytical, and spectroscopic data are reported in the literature.[9]

Diethyl 2-(((4-((2,3-Dichlorobenzyl)oxy)phenyl)amino)methylene)malonate (10c)

Compound 10c was prepared from 2-(((4-hydroxyphenyl)amino)methylene)malonate by means of n class="Gene">GP-A; 2,3-dichlorobenzyl chloride; 2 h; n-hexane/ethyl acetate 70:30; ethanol; 67% as a white solid; 185 °C; IR ν 1718 (C=O), 2939 (NH) cm–1; 1H NMR (400 MHz DMSO-d6, δ) 1.23–1.32 (m, 6H, CH3), 4.14–4.26 (m, 4H, CH2), 5.09 (s, 2H, CH2), 6.91 (d, J = 8.0 Hz, 2H, benzene H), 7.02 (d, J = 8.0 Hz, 2H, benzene H), 7.8 (d, J = 8.0 Hz, 1H, benzene H), 7.36–7.40 (m, 2H, benzene H), 8.37 (s, 1H, alkene H), 10.92 (s, 1H, NH). Anal. calcd for C21H21Cl2NO5: C, 57.55; H, 4.83; Cl, 16.18; N, 3.20%. Found: C, 57.64; H, 4.82; Cl, 16.20; N, 3.21%.

Diethyl 2-(((4-((3,4-Dichlorobenzyl)oxy)phenyl)amino)methylene)malonate (10d)

Compound 10d was prepared from 2-(((4-hydroxyphenyl)amino)methylene)malonate by means of GP-A; 3,4-n class="Chemical">dichlorobenzyl chloride; 3 h; n-hexane/ethyl acetate 70:30; ethanol; 70% as a white solid; 177 °C; IR ν 1715 (C=O), 2939 (NH) cm–1; 1H NMR (400 MHz DMSO-d6, δ) 1.23–1.26 (m, 6H, CH3), 4.10–4.20 (m, 4H, CH2), 5.12 (s, 2H, CH2), 7.04 (d, J = 8.0 Hz, 2H, benzene H), 7.34 (d, J = 8.0 Hz, 2H, benzene H), 7.44 (d, J = 8.0 Hz, 1H, benzene H), 7.66 (d, J = 8.0 Hz, 1H, benzene H), 7.71 (s, 1H, benzene H), 8.32 (s, 1H, alkene H), 10.71 (s, 1H, NH). Anal. calcd for C21H21Cl2NO5: C, 57.55; H, 4.83; Cl, 16.18; N, 3.20%. Found: C, 57.62; H, 4.82; Cl, 16.19; N, 3.21%.

Diethyl 2-(((4-(Naphthalen-1-ylmethoxy)phenyl)amino)methylene)malonate (10e)

Compound 10e was prepared from 2-(((4-hydroxyphenyl)amino)methylene)malonate by means of GP-A; 1-(chloromethyl)naphthalene; 3 h; n class="Chemical">n-hexane/ethyl acetate 70:30; ethanol; 60% as a green solid; 124 °C; IR ν 1718 (C=O), 2926 (NH) cm–1; 1H NMR (400 MHz DMSO-d6, δ) 1.12–1.18 (m, 6H, CH3), 3.99–4.13 (m, 4H, CH2), 5.46 (s, 2H, CH2), 7.04 (d, J = 8.0 Hz, 2H, benzene H), 7.26 (d, J = 8.0 Hz, 2H, benzene H), 7.41–7.60 (m, 4H, naphthalene H), 7.84–8.02 (m, 3H, naphthalene H), 8.24 (d, J = 12.0 Hz, 1H, alkene), 10.63 (d, J = 12.0 Hz, 1H, NH). Anal. calcd for C25H25NO5: C, 71.58; H, 6.01; N, 3.34%. Found: C, 71.66; H, 6.02; N, 3.35%.

Diethyl 2-(((4-(Naphthalen-2-ylmethoxy)phenyl)amino)methylene)malonate (10f)

Compound 10f was prepared from 2-(((4-hydroxyphenyl)amino)methylene)malonate by means of GP-A; 2-(chloromethyl)naphthalene; 3 h; n class="Chemical">n-hexane/ethyl acetate 70:30; ethanol; 80% as a white solid; 179 °C; IR ν 1712 (C=O), 2934 (NH) cm–1; 1H NMR (400 MHz DMSO-d6, δ) 1.21–1.27 (m, 6H, CH3), 4.10 (q, J = 7.0 Hz, 2H, CH2), 4.19 (q, J = 7.0 Hz, 2H, CH2), 5.28 (s, 2H, CH2), 7.09 (d, J = 8.0 Hz, 2H, benzene H), 7.33 (d, J = 8.0 Hz, 2H, benzene H), 7.52–7.59 (m, 3H, naphthalene H), 7.92–7.98 (m, 4H, naphthalene H), 8.35 (s, 1H, alkene H), 10.71 (s, 1H, NH). Anal. calcd for C25H25NO5: C, 71.58; H, 6.01; N, 3.34%. Found: C, 71.60; H, 6.02; N, 3.35%.

Diethyl 2-(((4-(Benzo[d][1,3]dioxol-5-ylmethoxy)phenyl)amino)methylene)malonate (10g)

Compound 10g was prepared from 2-(((4-hydroxyphenyl)amino)methylene)malonate by means of GP-A; 5-(bromomethyl)-1,3-benzodioxole; 2.5 h; n class="Chemical">n-hexane/ethyl acetate 70:30; ethanol; 75% as a white solid; 182 °C; IR ν 1745 (C=O), 2909 (NH) cm–1; 1H NMR (400 MHz DMSO-d6, δ) 1.22–1.28 (m, 6H, CH3), 4.13 (q, J = 7.0 Hz, 2H, CH2), 4.19, (q, J = 7.0 Hz, 2H, CH2), 4.99 (s, 2H, CH2), 6.02 (s, 2H, CH2), 6.77–6.90 (m, 2H, benzodioxolane H), 6.93–6.97 (m, 3H, benzodioxolane H, and benzene H), 7.31 (d, J = 8.0 Hz, 2H, benzene H), 8.32 (d, J = 12.0 Hz, 1H, alkene H), 10.70 (d, J = 12.0 Hz, 1H, NH). Anal. calcd for C22H23NO7: C, 63.92; H, 5.61; N, 3.39%. Found: C, 64.09; H, 5.60; N, 3.40%.

Diethyl 2-(((4-(4-Phenylbutoxy)phenyl)amino)methylene)malonate (10h)

Compound 10h was prepared from 2-(((4-hydroxyphenyl)amino)methylene)malonate by means of GP-A; 1-bromo-4-phenylbutane; 2 h; n class="Chemical">n-hexane/ethyl acetate 70:30; ethanol; 90% as a white solid; 165 °C; IR ν 1705 (C=O), 2934 (NH) cm–1; 1H NMR (400 MHz DMSO-d6, δ) 1.20–1.26 (m, 6H, CH3), 1.60–1.64 (m, 2H, CH2), 1.77–1.82 (m, 2H, CH2), 2.69 (t, J = 7.0 Hz, 2H, CH2), 4.09 (t, J = 7.0 Hz, 2H, CH2), 4.27 (q, J = 7.0 Hz, 2H, CH2), 6.93 (d, J = 8.0 Hz, 2H, benzene H), 7.19–7.24 (m, 7H, benzene H), 8.29 (s, 1H, alkene H), 10.65 (br s, 1H, NH). Anal. calcd for C24H29NO5: C, 70.05; H, 7.10; N, 3.40%. Found: C, 70.15; H, 7.11; N, 3.41%.

Diethyl 2-(((4-([1,1′-Biphenyl]-4-ylmethoxy)phenyl)amino)methylene)malonate (10i)

Compound 10i was prepared from 2-(((4-hydroxyphenyl)amino)methylene)malonate by means of GP-A; 4-phenylbenzyl chloride; 2 h; n class="Chemical">n-hexane/ethyl acetate 70:30; ethanol; 69% as a white solid; 174 °C; IR ν 1710 (C=O), 2900 (NH) cm–1; 1H NMR (400 MHz DMSO-d6, δ) 1.13–1.17 (m, 6H, CH3), 4.03 (q, J = 7.0 Hz, 2H, CH2), 4.11 (q, J = 7.0 Hz, 2H, CH2), 5.07 (s, 2H, CH2), 6.98 (d, J = 8.0 Hz, 2H, benzene H), 7.23–7.30 (m, 3H, benzene H), 7.38 (t, J = 8.0 Hz, 1H, benzene H), 7.44–7.46 (m, 3H, benzene H), 7.58–7.61 (m, 4H, benzene H), 8.23 (d, J = 12.0 Hz, 1H, alkene H), 10.61 (d, J = 12.0 Hz, 1H, NH). Anal. calcd for C27H27NO5: C, 72.79; H, 6.11; N, 3.14%. Found: C, 72.65; H, 6.12; N, 3.13%.

Diethyl 2-(((4-((4-(Benzyloxy)benzyl)oxy)phenyl)amino)methylene)malonate (10j)

Compound 10j was prepared from 2-(((4-hydroxyphenyl)amino)methylene)malonate by means of GP-A; 4-(benzyloxy)benzyl chloride; 3h; n class="Chemical">n-hexane/ethyl acetate 70:30; ethanol; 90% as a pink solid; 178 °C; IR ν 1718 (C=O), 2926 (NH) cm–1; 1H NMR (400 MHz DMSO-d6, δ) 1.12–1.18 (m, 6H, CH3), 4.01 (q, J = 7.0 Hz, 2H, CH2), 4.10 (q, J = 7.0 Hz, 2H, CH2), 4.92 (s, 2H, CH2), 5.03 (s, 2H, CH2), 6.92–6.95 (m, 4H, benzene H), 7.21–7.37 (m, 9H, benzene H), 8.23(d, J = 12.0 Hz, 1H, alkene H), 10.61 (d, J = 7.0 Hz, 1H, NH). Anal. calcd for C21H23NO5: C, 68.28; H, 6.28; N, 3.79%. Found: C, 68.34; H, 6.29; N, 3.80%.

Molecular Modeling

The X-ray crystal structure of the HIV-1 n class="Gene">RNase H protein (PDB code 3QIP)[53] was downloaded from the Protein Data Bank.[59,60] The “Protein Preparation Wizard” tool of Maestro[61] was employed to prepare the protein structure for the subsequent docking calculations. Specifically, hydrogens atoms were added according to their appropriate protonation states (pH = 7.4) and minimized, bond orders and disulfide bonds were calculated, and every water molecule was removed except for two conserved water molecules that participate in the magnesium ion chelation. The derivatives 4c,d,o,t were virtually created through the Maestro 2D Sketcher tool. Then, with Ligprep, another utility present in the Schrödinger suite, also the ligands were prepared for the docking experiments, specifying that the ligands would participate in a chelation process. In particular, every hydrogen atom was added, and the appropriate tautomeric and ionization states were generated. Subsequently, the obtained ligands underwent a minimization with the OPLS3e force field.[62] Then, the ligands were docked using Glide, part of the Schrödinger suite,[54] which is a grid-based docking software that takes advantage of an energetic approach to find favorable interactions in the ligand–receptor complex. Multiple sets of fields are precalculated to render on a grid the structure of the receptor, along with its properties, to provide an accurate score of the ligand binding pose. For the grid generation, the grid box was placed at the mass center of the cocrystal ligand. This box provides a precise measure of the actual size of the search space. Nevertheless, ligands are allowed to leave the box boundaries in the course of grid minimization. The length of the outer box was fixed at 22 Å for the X, Y, and Z coordinates, while for the inner box, the default values of 10 Å were left. In the grid generation settings, it was specified that the ligand would preferentially chelate the magnesium ions. To dock compounds 4o and 4t, we employed Glide Induced Fit routine,[55] which allows one to predict possible conformational changes in the binding site residues induced by the ligand binding process. Thus, during the docking process, an increased Coulomb–vdW cutoff and a reduced van der Waals radii are employed, along with a temporary removal of some of the most flexible side chains, to finally yield a diverse ensemble of ligand poses. For each of the generated poses, the residues’ side chains in the ligand proximity are reoriented to accommodate the ligand. Then, the ligand and the nearby residues undergo a minimization process. Finally, each ligand pose is redocked into its own minimized macromolecule, with each complex ranked according to its GlideScore. To dock compounds 4c and 4d, the standard Glide protocol with a rigid treatment of the protein was employed. On the whole, standard settings were used. The best-scoring complexes in terms of GlideScore were selected. All of the figures were rendered with the UCSF Chimera package.[63]

Magnesium Complexation Study

Complexation studies with MgCl2 were carried out on compounds n class="Chemical">4o and 5o. The effects of the magnesium ion were evaluated by a spectrophotometric method, using a Perkin Elmer Lambda 40 UV–vis spectrophotometer and a Hellma quartz cuvette with a 1 cm optical path. Magnesium chloride (1 M solution) was purchased from Sigma-Aldrich (Milano, Italy) and was diluted with absolute ethanol to obtain stock solutions ranging from 4 10–5 to 0.2 M.

For the titration experiments, each studied compound was dissolved in 50–100 mL of absolute ethanol to the final concentration of 3.8 × 10–5 M for compound n class="Chemical">4o and 4.1 × 10–5 M for compound 5o. Each solution (3 mL) was placed in a cuvette, and the UV–vis spectrum was recorded between 230 and 370 or 600 nm using ethanol as the reference. Thereafter, small volumes (10–15 μL) of the appropriate MgCl2 ethanolic stock solution were added both in the sample and in the reference cuvettes and the UV–vis spectra were recorded; the Mg2+ concentration in the solutions was increased from 0 to 100–200-fold with respect to the studied compound, in about 20 consecutive increments. Each experiment was conducted in triplicate.

To determine the stoichiometric coefficients of the complexes, Job’s method[64] was used, which requires mixing, in appropriate proportions, equimolar solutions of n class="Chemical">metal ion and ligand, so that the final volume and the total moles present in the cuvette are equal for each measurement. The absorbance values were recorded at the wavelength where the higher difference in absorbance was observed in the UV–Vis titration experiments (320 nm for compound 4o and 246 nm for compound 5o). For each obtained absorbance value, the nominal absorbance values of equimolar solutions of the metal and ligand were subtracted, to obtain the ΔA due exclusively to the complex formation.

The resulting ΔA were reported in a graph as a function of the mole fraction of the ligand; the mole fraction X, which caused the maximum variation in absorbance, was determined by linear regression analysis and used to calculate the value of the coefficient n, which corresponds to the number of ligand molecules per cation, applying the following equation

Expression and Purification of Recombinant HIV-1 RTs

His-tagged p66/n class="Gene">p51 HIV-1 RT group M subtype B coded in a p6HRT-prot plasmid was expressed in the Escherichia coli strain M15.[65] Heterodimeric RTs were expressed essentially and purified as described.[66]

Expression and Purification of Recombinant HIV-1 IN

His-tagged NL4-3 IN was expressed from a pET15b plasmid in the E. coli BL21 pLys strain. Recombinant protein was purified as previously described[67] following a batch preparation on n class="Chemical">Ni-NTA beads (Qiagen, Paris, France).

Site-Directed Mutagenesis

Amino acid substitutions were introduced into the p66 n class="Species">HIV-1 RT subunit of a HIV-1 RT using a QuikChange mutagenesis kit, following the manufacturer’s instructions (Agilent Technologies Inc., Santa Clara, CA).

RNase H Polymerase-Independent Cleavage Assay

The HIV-1 RT-associated n class="Gene">RNase H activity was measured as described.[68] Briefly, the reaction was carried out in a black 96-well plate in a total volume of 100 μL. Serial dilutions of compounds were added to the reaction mix containing 50 mM Tris HCl pH 7.8, 6 mM MgCl2, 1 mM dithiothreitol (DTT), 80 mM KCl, 250 nM hybrid RNA/DNA (50-GTTTTCTTTTCCCCCCTGAC-30-Fluorescein, 50-CAAAAG AAAAGGGGGGACUG-30-Dabcyl). The reaction was started by the addition of 20 ng of HIV-1 wt RT, 20 ng of R448A RT, 20 ng of K451A RT, 40 ng of K540 RT, 60 ng of Q475A RT, 500 ng of N474A RT, 500 ng of Y501A RT, and 500 ng of W535A RT and incubated for 1 h at 37 °C. Products were quantified with a Perkin–Elmer Victor 3 multilabel counter plate reader at an excitation–emission wavelength of 490/528 nm. Experiments were performed in duplicate and replicated at least two times. Data were analyzed as described.[36] Mean ± standard deviation of IC50 values were determined, and p values were calculated between the IC50 value against the wt and IC50 value against the mutants by paired, two-tailed t tests using GraphPad Prism 6.01 software (GraphPad Software, Inc.; San Diego, CA). Figures were made with GraphPad Prism 6 version 6.01.

Polymerase Assay

The HIV-1 RT-associated RNA-dependent DNA polymerase activity was measured as described.[65] Briefly, the reaction was carried out in a black 96-well plate in a total volume of 25 μL. Serial dilutions of compounds were an class="Chemical">dded to the reaction mix containing 60 mM Tris HCl buffer pH 8.1, 8 mM MgCl2, 60 mM KCl, 13 mM DTT, 2.5 mM poly(A)-oligo(dT), and 100 mM dTTP. The reaction was started by the addition of 20 ng of HIV-1 wt RT and incubated for 30 min at 37 °C, followed by addition of 2 mL of 200 mM ethylenediamine tetraacetic acid (EDTA). Reaction products were detected by addition of 170 mL of revealing solution containing Picogreen in 10 mM Tris HCl pH 7.5, 1 mM EDTA, and measured with a multilabel counter plate reader Victor 3, equipped with filters 502/523 nm (excitation/emission wavelength).

IN Assay

The DNA substrate was generated by annealing an equimolar amount of 19T (GTGTGGAAAATCTCTAGCA) and 21B (ACTGCTAGAGATTTTCCACAC). Both oligonucleotides were purchased from Integrated DNA Technologies, Inc. (Con class="Gene">ralville, IA), and the gel was purified in-house. ST reactions were performed by adding molecules or an equivalent volume of 100% dimethyl sulfoxide (DMSO, used as the drug solvent) to a mixture of 20 nM duplex DNA substrate and 400 nM IN in 50 mM MOPS pH 7.2, 7.5 mM MgCl2, and 14 mM 2-mercaptoethanol. Mixtures were incubated at 37 °C for 2 h, and the reaction was quenched by addition of an equal volume of loading buffer [formamide containing 1% sodium dodecyl sulfate (SDS), 0.25% bromophenol blue, and xylene cyanol]. Reaction products were separated in 16% polyacrylamide denaturing sequencing gels. Dried gels were visualized using a FLA5000 (Fuji Photo Film, Tokyo, Japan). Densitometric analyses were performed using ImageQuant 5.1 software from GE Healthcare. Data analyses (linear regression, IC50 determination, and standard deviation) were performed using Prism 6.07 software from GraphPad (San Diego, CA).

Cell-Based Assays

HIV-1 replication was monitored using n class="CellLine">HeLa-CD4-LTR-β-gal reporter cells as previously described.[69] Briefly, β-galactosidase activity was monitored 24 h post infection using a replication-competent HIV produced in-house (H9-laï coculture) and a serial dilution of molecules or an equivalent volume of DMSO. In parallel, compounds’ toxicity was determined at 24 h in the same cell line using CellTiter 96 AQueous One Solution Cell Proliferation Assay (Promega, France).