Mary-Claire Roghmann1,2, Alison D Lydecker2, Michelle Shardell2,3, Robert T DeBoy2, J Kristie Johnson2,4, LiCheng Zhao4, Lauren L Hittle3, Emmanuel F Mongodin3. 1. Geriatrics Research Education and Clinical Center, VA Maryland Health Care System, Baltimore, Maryland, United States of America. 2. Department of Epidemiology and Public Health, University of Maryland School of Medicine, Baltimore, Maryland, United States of America. 3. Department of Microbiology and Immunology and Institute for Genome Sciences, University of Maryland School of Medicine, Baltimore, Maryland, United States of America. 4. Department of Pathology, University of Maryland School of Medicine, Baltimore, Maryland, United States of America.
Abstract
OBJECTIVE: To characterize the microbial communities of the anterior nares (nose) and posterior pharynx (throat) of adults dwelling in the community and in nursing homes before and after treatment with intranasal mupirocin. METHODS: Staphylococcus aureus-colonized adults were recruited from the community (n = 25) and from nursing homes (n = 7). S. aureus colonization was confirmed using cultures. Participants had specimens taken from nose and throat for S. aureus quantitation using quantitative PCR for the nuc gene and bacterial profiling using 16S rRNA gene sequencing over 12 weeks. After two baseline study visits 4 weeks apart, participants received intranasal mupirocin for 5 days with 3 further visits over a 8 week follow-up period. RESULTS: We found a decrease in the absolute abundance of S. aureus in the nose for 8 weeks after mupirocin (1693 vs 141 fg/ul, p = 0.047). Mupirocin caused a statistically significant disruption in bacterial communities of the nose and throat after 1 week, which was no longer detected after 8 weeks. Bacterial community profiling demonstrated that there was a decrease in the relative abundance of S. aureus (8% vs 0.3%, p<0.01) 8 weeks after mupirocin and a transient decrease in the relative abundance of Staphylococcus epidermidis in the nose (21% vs 5%, p<0.01) 1 week after mupirocin. CONCLUSIONS: Decolonization with mupirocin leads to a sustained effect on absolute and relative abundance of S. aureus but not for other bacteria in the nose. This demonstrates that a short course of mupirocin selectively decreases S. aureus in the nose for up to 8 weeks.
OBJECTIVE: To characterize the microbial communities of the anterior nares (nose) and posterior pharynx (throat) of adults dwelling in the community and in nursing homes before and after treatment with intranasal mupirocin. METHODS: Staphylococcus aureus-colonized adults were recruited from the community (n = 25) and from nursing homes (n = 7). S. aureus colonization was confirmed using cultures. Participants had specimens taken from nose and throat for S. aureus quantitation using quantitative PCR for the nuc gene and bacterial profiling using 16S rRNA gene sequencing over 12 weeks. After two baseline study visits 4 weeks apart, participants received intranasal mupirocin for 5 days with 3 further visits over a 8 week follow-up period. RESULTS: We found a decrease in the absolute abundance of S. aureus in the nose for 8 weeks after mupirocin (1693 vs 141 fg/ul, p = 0.047). Mupirocin caused a statistically significant disruption in bacterial communities of the nose and throat after 1 week, which was no longer detected after 8 weeks. Bacterial community profiling demonstrated that there was a decrease in the relative abundance of S. aureus (8% vs 0.3%, p<0.01) 8 weeks after mupirocin and a transient decrease in the relative abundance of Staphylococcus epidermidis in the nose (21% vs 5%, p<0.01) 1 week after mupirocin. CONCLUSIONS: Decolonization with mupirocin leads to a sustained effect on absolute and relative abundance of S. aureus but not for other bacteria in the nose. This demonstrates that a short course of mupirocin selectively decreases S. aureus in the nose for up to 8 weeks.
“Decolonization” is a rapidly growing strategy to prevent Staphylococcus aureus infections. Its use is fueled by healthcare policy initiatives, such as public reporting of healthcare associated infections which are often caused by S. aureus [1, 2]. Decolonization involves the application of antimicrobial agents such as mupirocin to the skin or mucosal surfaces. Mupirocin has high level of activity against staphylococci, streptococci and certain Gram-negative bacteria (Haemophilus influenzae and Neisseria gonorrhoeae) [3]. Staphylococci are abundant in the anterior nares [4, 5]. Streptococci are abundant in the throat [4].Intranasal mupirocin, which is inadvertently swallowed, may alter the microbiota of the nose and throat. Given the role of the human microbiota as a barrier to infection, decolonization with mupirocin could have unintended negative consequences. For example, decolonization with intranasal mupirocin increases the risk of infections due to organisms other than S. aureus, including Gram-negative rods by 38% [6].To assess the effect of mupirocin on the bacterial communities of the nose and throat, we conducted an interventional decolonization study. We have previously reported the results of our culture analysis specifically looking at S. aureus and pathogenic Gram-negative rods [7]. Here we present the results of our genomic analysis which allows us to look at bacterial communities as opposed to specific bacteria. To our knowledge, there are no other reports of the changes in bacterial communities of the nose and throat with intranasal mupirocin. Our objective was to compare the bacterial communities of the nose and throat in community and nursing home dwelling S. aureus-colonized adults before and after treatment with intranasal mupirocin. We hypothesized that treatment with mupirocin would decrease the abundance of staphylococci and streptococci, and conversely increase the abundance of Enterobacteriaceae within individuals.
Material and methods
Ethics
The study was conducted in accordance with the Declaration of Helsinki and national and international standards. The study was approved by the University of Maryland, Baltimore IRB and the VA Research and Development Committee at the VA Maryland Health Care System. The community dwelling portion of the study was approved on October 21, 2011 and the nursing home dwelling portion of the study was approved on April 28, 2014. Written informed consent was obtained from all study participants.
Recruitment and study procedures
This was an interventional study in community and nursing home dwelling S. aureus-colonized adults. S. aureus colonization was confirmed with microbiological cultures. After two baseline study visits over 4 weeks, the nose and skin of participants were decolonized for 5 days with an 8 week follow-up period in which participants were seen at 1, 4 and 8 weeks after mupirocin. The two study visits prior to decolonization allowed each participant to serve as their own control. In order to be included, participants needed to be S. aureus colonized on at least one of the following body sites during at least one of the baseline visits: anterior nares, throat, subclavian skin, femoral skin or perirectal skin. This convenience sample was recruited prospectively for this study from local VA primary care clinics and VA nursing homes and screened to document their eligibility and health status. Study visits took place in the General Clinical Research Center of the University of Maryland School of Medicine, and the nursing home units of Perry Point VA Medical Center and the Loch Raven VA Medical Center. Participant recruitment and follow-up took place between September 18, 2012 and September 22, 2015. Eligible participants were adults without: cancer treatment, HIV infection, immunosuppressive medications, nasal steroids, antibiotic (including chlorhexidine or mupirocin) use or recent hospitalization within 3 months. The nursing homes did not use mupirocin ointment as a part of infection control efforts. Participants who received antibiotics or were hospitalized during follow up were excluded. Non-invasive samples from the nose and throat were collected by research staff for genomic testing at each study visit [7]. After visit 2, participants received a 5-day course of nasal mupirocin ointment. Mupirocin 2% nasal ointment was applied by participants or nursing home staff twice a day. Neither the participants nor the nursing home staff were blinded to the mupirocin. Community dwelling participants filled out a subject diary. Nursing home dwelling participants had their regimen provided by and documented by nursing staff. Community dwelling participants received $50 per study visit. Nursing home dwelling participants received $5 per study visit. The final sample size was chosen based on feasibility and cost. There were no known protocol deviations during the study. The two studies underlying this manuscript are registered in ClinicalTrials.gov under study numbers NCT04218799 and NCT04222699. These studies were not registered in ClinicalTrials.gov prior to the start of participant enrollment as it was not required by the funders. The authors confirm that all ongoing and related trials for these drugs are registered.
Microbiological methods
Enriched samples in tryptic soy broth with 6.5% NaCl and CHROMagar Staph aureus (Becton Dickenson; Sparks, MD) was used for the detection of S. aureus using standard microbiological procedures. Methicillin resistance was determined by oxacillin screen agar and antibiotic susceptibilities were performed following CLSI guidelines [8].
Sample processing and DNA extraction
Total metagenomic DNA (mgDNA) was isolated as previously described [9, 10]. Negative extraction controls (PBS) were processed in parallel to each extraction to ensure no contaminating DNA was introduced during sample processing. All samples included in our analyses were negative for contaminating DNA.
Quantitative PCR methods
Quantitative real-time PCR for total bacterial load quantitation was determined using 16S rRNA following methods by Walker et al [11] and S. aureus quantitation was determined following methods of Redel et al [12]. Briefly, total nucleic acid from nasal and throat samples were amplified and DNA concentration was determined using the BIO-RAD CFX96 Real-Time System. Standard curves were performed with each run consisted of seven 10-fold dilutions from 4 ng/ul to 4 fg/ul of S. aureus USA300.
Microbiota profiling using 16S rRNA gene sequencing
Microbiota profiling was performed by sequencing, on Illumina HiSeq 2500 (Illumina, San Diego, CA) 2x300-bp PE, PCR amplicons of the V3-V4 hypervariable region of the 16S rRNA gene [13]. Previous studies have shown that this region is appropriate for species-level taxonomic assignments of the Staphylococcus genus [14-17]. Sample barcoding was performed using the dual-indexing strategy developed at the Institute for Genome Sciences [18], which allows sequencing of >1,500 samples in a single HiSeq 2500 run while providing high sequence coverage (~50,000 reads on average per sample) [13]. Briefly, PCR reactions were set-up using the 319F (ACTCCTACGGGAGGCAGCAG) and 806R (GGACTACHVGGGTWTCTAAT) 16S rRNA universal primers, each of which also included a linker sequence required for Illumina sequencing, and a 12-bp heterogeneity-spacer index sequence [18]. First step PCR amplifications were performed using Phusion High-Fidelity (Thermo Fisher, USA) and the following cycling parameters: 3 min at 95°C, followed by 30 cycles of 30 sec at 95°C, 30 sec at 58°C, and 1 min at 72°C, with a final step of 5 min at 72°C [19]. Step-two PCR amplifications were set-up using custom barcode primers unique for each sample and 1 ul of diluted (1:20 dilution) first step products as template, under the following cycling parameters: 30 sec at 95°C, followed by 10 cycles of 30 sec at 95°C, 30 sec at 58°C, 1 min at 72°C, with a final step of 5 min at 72°C. No-template negative controls were processed for each primer pair. The SequalPrep Normalization Plate kit (Life Technologies) was used for clean-up and normalization (25 ng of 16S PCR amplicon pooled for each sample) before sequencing.
Data processing and statistical analyses of microbiome data
Following sequencing, 16S rRNA reads were initially screened for low-quality bases and short read lengths [18]. Paired-end read pairs were then assembled using PANDAseq [20] and the resulting consensus sequences were de-multiplexed (i.e. assigned to their original sample), trimmed of barcodes and primers, and assessed for chimeras using UCHIME [21] in de novo mode implemented in QIIME (v. 1.9.1) [22]. Quality-trimmed sequences were then clustered de novo into operational taxonomic units at 97% similarity cutoff using QIIME, and taxonomic assignments were performed using the RDP classifier implemented in QIIME and the Greengenes (v. 13.8) database as a reference.The resulting taxonomic assignments were imported as a BIOM-formatted file into R (v. 3.3.2) using the RStudio (v. 1.0.44) integrated development environment (IDE), and processed/analyzed using the following R packages: Phyloseq (v. 1.19.1) [23], Vegan (v. 2.4–1) [24], and gpplot2 (v. 2.2.1) [25]. When appropriate, taxonomic assignments were normalized to account for uneven sampling depth with metagenomeSeq’s cumulative sum scaling (CSS; implemented in R) [24, 26], a normalization method that has been shown to be less biased than the standard approach (total sum normalization). The Good’s coverage index was calculated in R for each sample in order to ensure appropriate sequence coverage: samples with Good’s coverage < 0.9 were discarded from the analyses. In addition, ultra-low abundant and likely-to-be spurious Operational Taxonomic Units (OTUs, <0.005% relative abundance and present in <10% of samples) were removed from the OTU table prior to the analyses described below.Before normalization, within-sample comparisons using alpha-diversity measures were performed with the Observed estimator, as well as the Shannon diversity index, calculated using the Phyloseq R package. Because alpha-diversity metrics can be susceptible to uneven sampling depth between samples, alpha-diversity measures were compared after rarefaction to the minimum sampling depth of 2,000 sequences. The associations between participant dwelling and alpha diversity data were measured using the Wilcoxon rank sum test. Beta-diversity (between-sample) comparisons were performed from CSS-normalized data through principle coordinates analysis (PCoA) plots of weighted UniFrac distance performed through the Phyloseq R package and tested for significance using the ANalysis Of SIMilarity (ANOSIM: 999 permutations) algorithm implemented in the Vegan package in R. Beta-diversity analyses did not use rarefied data.Absolute abundance values of S. aureus, S. epidermidis, Enterobacteriaceae and Streptococcaceae were calculated by multiplying the normalized relative abundance values of each of these OTUs by the total bacterial counts assessed by 16SqPCR [5]. In this calculation, we did not take into consideration the number of 16S copies, as recent papers in the literature have suggested that 16S copies can only be accurately predicted for a limited fraction of known taxa, therefore potentially biasing calculations [27]. In addition and more importantly, variations in the number of 16S copies is generally small compared to variations in overall bacterial load [27]. Determination of statistically significant differences (adjusted p-value < 0.01) in OTU bacterial relative abundance between samples from different time points was performed using DESeq2 [28] implemented in R, which utilizes Benjamini-Hochberg multiple-inference correction. DESeq2 was used due to its high power in computing statistical significance of differentially-abundant features in high dimensional datasets derived from relatively small sample sizes. DESeq2 analyses did not use rarefied data.The associations between participant dwelling and baseline characteristics were measured using t-tests for continuous variables and Fisher’s exact tests for categorical variables. The associations between high and low S. aureus groups and abundance of S. aureus, S. epidermidis, Enterobacteriaceae in the nose over time were measured using the Wilcoxon rank sum test (Mann Whitney U test). The associations between abundance of Streptococcaceae in the throat over time within individuals were measured using the Wilcoxon signed ranks test. Unless otherwise specified, all statistical analyses were conducted with Stata 15 software (Stata Corporation, College Station, TX). As a sensitivity analysis, assessments over time were also analyzed using linear mixed models (LMM) with square-root transformations. For endpoints with excessive zeroes, zero-inflated gaussian linear mixed models were used. Analyses were performed with R statistical software version 3.6.3 using the nlme and NBZIMM packages.
Accession number
Sequence data generated in this study have been deposited to Genbank and are linked to BioProject PRJNA388722 in the NCBI BioProject database (https://www.ncbi.nlm.nih.gov/bioproject/).
Results
Study population
Twenty participants were S. aureus colonized at both baseline study visits and 12 participants were colonized at one baseline visit. Baseline characteristics of our participants are shown in Table 1. There was no difference in S. aureus colonization at the anterior nares or throat by dwelling. Nine community dwelling participants and 3 nursing home dwelling participants (38% of all study participants) were colonized MRSA at baseline. All S. aureus isolates were susceptible to mupirocin. The nose sample for two participants at one visit could not be used. The nose and throat samples for three participants at one visit were missing. All 32 participants were adherent in taking mupirocin. There were no adverse events that were related to mupirocin or study procedures. Baseline characteristics did not differ between participants who were lost to follow-up and those retained. Participant flow is shown in Fig 1.
Table 1
Baseline characteristics of participants with at least two study visits pre intervention and three study visits post intervention.
Characteristic
Community-based Participants (n = 25)
Nursing Home-based Participants (n = 7)
P value*
Age (years) (mean ± SD)
47 ± 18
71 ± 14
<0.01
Male, n (%)
15 (60)
7 (100)
0.07
Race, n (%)
0.04
American Indian or Alaskan Native
0 (0)
1 (14)
Asian
1 (4)
0 (0)
African American
15 (60)
1 (14)
White
9 (36)
5 (71)
Body Mass Index (mean ± SD)
26 ± 4
30 ± 4
0.05
Diabetes, n (%)
1 (4)
1 (14)
0.40
Currently smoke, n (%)
10 (40)
0 (0)
0.07
S. aureus colonization† sites, n (%)
Nose
14 (56)
5 (71)
0.67
Throat
19 (76)
4 (57)
0.37
Subclavian, femoral or perianal skin
14 (56)
2 (29)
0.39
* p-values from t-tests for continuous variables and Fisher’s exact tests for categorical variables
† As determined by culture
Fig 1
CONSORT diagram depicting participant flow through the study.
* p-values from t-tests for continuous variables and Fisher’s exact tests for categorical variables† As determined by culture
Absolute abundance of S. aureus and overall bacterial load assessed by qPCR
We found a statistically significant (p value = 0.011) sustained decrease in the absolute abundance of S. aureus in the nose for 8 weeks after mupirocin; the absolute abundance of S. aureus in the throat also decreased but not significantly (p value = 0.30) after mupirocin (mean S. aureus reduction: nose 1553 fg/μL, throat 993 fg/μL) (Fig 2). The overall decrease in the nose was driven by a subset of participants in the population with a high relative abundance of S. aureus in the nose defined by being in the upper quartile (S1 Fig). Because of this difference, we stratified by high vs. low relative abundance of S. aureus for nose samples in the remaining analyses. Eight participants had a high relative abundance of S. aureus, of which 3 (38%) were MRSA colonized on their nose swab at Week 0. Twenty-four participants had a low relative abundance of S. aureus, of which 5 (22%) were MRSA colonized on their nose swab at Week 0. There were no differences by dwelling (community vs. nursing home), sex (men vs. women) or methicillin resistance at study start (MRSA vs. MSSA).
Fig 2
Absolute abundance of Staphylococcus aureus as measured by qPCR over time by body site (fg/μL).
Data are presented as means ± SEMs. Statistical comparisons were made with the Week 0 time point within body site. Statistical significance was determined by zero-inflated Gaussian linear mixed models using a square root transformation. Asterisk, P<0.05.
Absolute abundance of Staphylococcus aureus as measured by qPCR over time by body site (fg/μL).
Data are presented as means ± SEMs. Statistical comparisons were made with the Week 0 time point within body site. Statistical significance was determined by zero-inflated Gaussian linear mixed models using a square root transformation. Asterisk, P<0.05.The total bacterial load did not decrease in either the nose or throat with mupirocin; however, after 8 weeks, there was an increase in total bacterial load in both nose and throat which was statistically significant (p value <0.01) in the throat (Fig 3). There were no differences by dwelling, sex, or methicillin resistance at study start.
Fig 3
Absolute abundance of overall bacterial load as measured by 16S rRNA qPCR over time by body site (fg/μL).
Data are presented as means ± SEMs. Statistical comparisons were made with the Week 0 time point within body site. Statistical significance was determined by a Gaussian linear mixed model for the nose and a zero-inflated Gaussian linear mixed model for the throat. Both models used a square root transformation. Asterisk, P<0.05.
Absolute abundance of overall bacterial load as measured by 16S rRNA qPCR over time by body site (fg/μL).
Data are presented as means ± SEMs. Statistical comparisons were made with the Week 0 time point within body site. Statistical significance was determined by a Gaussian linear mixed model for the nose and a zero-inflated Gaussian linear mixed model for the throat. Both models used a square root transformation. Asterisk, P<0.05.
16S rRNA gene sequencing dataset
Bacterial community profiling using 16S rRNA gene sequencing and analysis was performed on a final (Good’s coverage > 0.9) set of 312 samples. The final sequencing dataset contained a total of 20,427,872 16S rRNA gene sequences (65,473 sequences were obtained on average per sample, with a range of 2,015 to 407,309 sequences), representing 4,182 unique OTUs at a 97% similarity cut-off across all samples.
Alpha diversity
Alpha diversity, a method to quantitate intra-sample diversity, was calculated using the Phyloseq package in R and reported using the Observed (total number of OTUs, a measure of community richness) and Shannon diversity indices. Because differences in sequence coverage—even close to sequence saturation—can have a significant impact on alpha diversity measures, we calculated the Observed and Shannon indices on rarefied sequencing data (sampling depth: 2,000 sequences). There was an increase in observed OTU and Shannon diversity 1 week after mupirocin in those with a high relative abundance of S. aureus in their nose (observed OTU 78 vs 105, p = 0.03; Shannon 2.1 vs 2.6, p = 0.12) and no changes in the nose in those with a low relative abundance of S. aureus (observed OTU 93 vs 86, p = 0.26; Shannon 2.4 vs 2.2, p = 0.48) (Fig 4). There were no changes observed in the throat (S2 Fig).
Fig 4
Alpha diversity analyses of the nose samples over time at a sequencing depth of 2000 sequences per sample.
A. Observed Diversity Index, B. Shannon Diversity Index. Data are presented as means ± SEMs. Statistical comparisons were made between participants with high and low relative abundance of Staphylococcus aureus of the change from Week 0 to each time point. Statistical significance was determined by Gaussian linear mixed models. Asterisk, P<0.05.
Alpha diversity analyses of the nose samples over time at a sequencing depth of 2000 sequences per sample.
A. Observed Diversity Index, B. Shannon Diversity Index. Data are presented as means ± SEMs. Statistical comparisons were made between participants with high and low relative abundance of Staphylococcus aureus of the change from Week 0 to each time point. Statistical significance was determined by Gaussian linear mixed models. Asterisk, P<0.05.
Beta diversity
Comparison of inter-sample diversity over time was characterized using beta-diversity analyses based on the weighted UniFrac distance. We did not detect any statistically significant sustained disruption in overall bacterial communities of the nose and throat as measured by change in weighted UniFrac distance over time. Fig 5 compares the weighted UniFrac distance between specimens from individual participants before mupirocin (Week -4 and Week 0) to the weighted UniFrac distance between specimens from participants before and after mupirocin (e.g. Week 1 and Week 0). In the nose, there was a sustained increase in weighted UniFrac distance in participants with a high relative abundance of S. aureus in the nose; however, this and the other increases between Week 1 and Week 0 were not statistically significant (Fig 5). There were similar patterns when stratified by dwelling and sex (S3 Fig).
Fig 5
Unifrac distances comparing distances to week 0 communities by body site.
Data are presented as means ± SEMs. Statistical comparisons were made between the distance of Week -4 to Week 0, and the distance of Week 0 to other time points within body site. Statistical significance was determined by Gaussian linear mixed models with a square root transformation. All tests were non-significant at the p<0.05 level.
Unifrac distances comparing distances to week 0 communities by body site.
Data are presented as means ± SEMs. Statistical comparisons were made between the distance of Week -4 to Week 0, and the distance of Week 0 to other time points within body site. Statistical significance was determined by Gaussian linear mixed models with a square root transformation. All tests were non-significant at the p<0.05 level.A comparison of bacterial community structures between those with high vs. low relative abundance of S. aureus in the nose by body site showed that samples of participants with high relative abundance of S. aureus clustered with overlap to the participants with low relative abundance of S. aureus in the nose (Fig 6). Using the ANOSIM test of significance to compare all Week 0 and Week 1 clusters revealed significant differences in the nose (R = 0.1199 and p = 0.001) and throat (R = 0.07798 and p = 0.021). Significant differences were also observed for nose but not for throat when stratified by low relative abundance of S. aureus: nasal (R = 0.1218 and p = 0.004) and throat (R = 0.05613 and p = 0.051). No significant differences were observed when stratified by high relative abundance of S. aureus: nasal (R = 0.01897 and p = 0.348) and throat (R = 0.09375 and p = 0.133). However, reduced sample sizes caused by stratification might in part be responsible for these observations, masking the differences observed for all Week 0 and Week 1 samples. Comparison of all Week 0 and Week 8 clusters by site revealed no significant differences: nasal (R = 0.005484 and p = 0.337) and throat (R = - 0.01035 and p = 0.636). There were similar patterns when stratified by dwelling and sex (S4 Fig).
Fig 6
Principal coordinates (PCs) analysis of beta diversity metrics by body site, showing distances from unweighted Unifrac over time.
The ellipses represent 95% confidence intervals for clustered specimens from participants with high relative abundance of S. aureus in the nose vs patients with low relative abundance of S. aureus in the nose. ANOSIM Test of Significance comparing week 1 to week 0: Nose R = 0.1199 and p = 0.001; Throat R = 0.07798 and p = 0.021.
Principal coordinates (PCs) analysis of beta diversity metrics by body site, showing distances from unweighted Unifrac over time.
The ellipses represent 95% confidence intervals for clustered specimens from participants with high relative abundance of S. aureus in the nose vs patients with low relative abundance of S. aureus in the nose. ANOSIM Test of Significance comparing week 1 to week 0: Nose R = 0.1199 and p = 0.001; Throat R = 0.07798 and p = 0.021.
Microbiome composition by body site and study population
Bacterial community profiling demonstrated that there was a sustained decrease in the relative and absolute abundances of S. aureus and a transient decrease in the relative and absolute abundances of S. epidermidis in the nose. There were no changes in the relative or absolute abundance of Enterobacteriaceae. There was a transient decrease in the relative and absolute abundance of Streptococcaceae in the throat. S5 Fig profiles the 15 most abundant taxa in nose and throat. Fig 7 shows the relative abundance over time of S. aureus, S. epidermidis, Enterobacteriaceae and Streptococcaceae before and after mupirocin. S6 Fig shows the absolute abundance as estimated by multiplying the relative abundance by the absolute burden of 16S rRNA over time of S. aureus, S. epidermidis, Enterobacteriaceae and Streptococcaceae before and after mupirocin. In addition to the top 15 taxa, DESeq2 was used to detect differential abundance of less prevalent OTUs (S1 Table). Many of the same taxa decreased between Week 0 and 1, including OTUs of S. aureus, S. epidermidis, S. haemolyticus, unclassified Corynebacterium and Propionibacterium in the nose. At week 8, only OTUs of S. aureus and Haemophilus were differentially abundant in the nose. In the throat, comparing Week 0 and 1, DESeq2 identified decreases of S. epidermidis, unclassified Streptococci and Gemellaceae (formerly a Neisseria). At week 8, only an OTU of S. aureus was differentially abundant in the throat.
Fig 7
Relative abundance of staphylococci, streptococci, and Enterobacteriaceae over time.
Data are presented as means ± SEMs. Statistical comparisons were made between participants with high and low relative abundance of Staphylococcus aureus of the change from Week 0 to each time point within the nose (A, B, C) or of the change from Week 0 to each time point within the throat (D). Statistical significance was determined by Gaussian linear mixed models or zero-inflated Gaussian linear mixed models as appropriate. Square root transformations were performed as necessary. Asterisk, P<0.05.
Relative abundance of staphylococci, streptococci, and Enterobacteriaceae over time.
Data are presented as means ± SEMs. Statistical comparisons were made between participants with high and low relative abundance of Staphylococcus aureus of the change from Week 0 to each time point within the nose (A, B, C) or of the change from Week 0 to each time point within the throat (D). Statistical significance was determined by Gaussian linear mixed models or zero-inflated Gaussian linear mixed models as appropriate. Square root transformations were performed as necessary. Asterisk, P<0.05.
Discussion
After mupirocin, we found a statistically significant decrease in the absolute and relative abundance of the S. aureus in the nose for 8 weeks. There was an increase in absolute abundance of overall bacterial load in both nose and throat at 8 weeks. Mupirocin caused a statistically significant transient disruption in bacterial communities of the nose and throat as measured by weighted Unifrac distances, which was no longer detected after 8 weeks. Bacterial community profiling demonstrated that there was a sustained decrease in the relative abundance of S. aureus and a transient decrease in the relative abundance of S. epidermidis in the nose. There was a transient decrease in the relative abundance of unclassified Streptococcus in the throat. In addition, there were transient decreases in OTU at a lower abundance: other coagulase positive staphylococci, Propionibacterium, Corynebacterium, and Gemellaceae and sustained decrease in Haemophilus.The sustained decrease we observed of S. aureus in the nose following decolonization is consistent with culture based studies of mupirocin in community dwelling adults [29-31] and nursing home residents [32]. Of note, intranasal mupirocin did not increase colonization with Gram-negative pathogens in the nose or throat suggesting that any shift in infections from Gram-positive to Gram negative pathogen did not occur due to colonization shifts.After mupirocin, there was an increase in absolute abundance of total bacteria load as measured by 16S rRNA qPCR in both nose and throat at 8 weeks. This was an unexpected result; we repeated a sample of the specimens and replicated our results. Typically, antibiotics, which are often broad spectrum, will decrease the overall burden of bacterial DNA [33, 34]. For example, sinus aspirates from adults with acute exacerbations of chronic rhinosinusitis decreased by several logs after levofloxacin [34]. Hauser and colleagues report an increase in bacterial burden in the sinuses two weeks after endoscopic sinus surgery and amoxicillin-clavulanate which then decreased to a level similar to the time of surgery [35]. Mupirocin is a narrow spectrum antibiotic compared with most antibiotics. It is possible that a transient decrease in staphylococci or streptococci leads to changes in the bacterial community which promote growth.The changes seen with bacterial community profiling after mupirocin are consistent with what is known about the bacterial susceptibility to mupirocin. Mupirocin shows a high level of activity against staphylococci and streptococci and against certain Gram-negative bacteria; it is much less active against most Gram-negative bacilli and anaerobes [3]. We saw transient decreases in coagulase-negative staphylococci in the nose and streptococci in the throat. These relatively muted changes in response to mupirocin were also observed by Grice and colleagues in the skin microbiota of a mouse model [36]. In contrast to the transient changes in coagulase-negative staphylococci, we saw a sustained decrease in S. aureus in the nose. It is possible that the regrowth of coagulase-negative staphylococci in the nose lead to long term suppression of S. aureus as coagulase-negative staphylococci species have been identified as natural competitors of S. aureus [37-39].Mupirocin caused a statistically significant initial disruption in bacterial communities of the nose and throat as measured by change in weighted Unifrac distances which was not sustained after 8 weeks. The disruption in the nose of those participants with a high relative abundance of S. aureus, although not statistically significant, was maintained post-mupirocin treatment, in contrast to participants in the low S. aureus group where oscillations in bacterial community structure could be observed. This is expected since there was a sustained decrease in S. aureus relative abundance after mupirocin. There was also a transient increase in alpha diversity indices in this subset 1 week after mupirocin. The sub-population with a high relative abundance of S. aureus in the noses appears most affected by the use of mupirocin.Our study is limited by a small sample size particularly of nursing home residents. It is possible that studying a larger or more specific population, for example, adults with S. aureus as the dominant taxa in the bacterial community of the nose, might demonstrate sustained disruption of the microbiota after intranasal mupirocin. We are also limited by our follow-up of 8 weeks. We cannot comment on whether S. aureus re-enters the nasal microbiome after a longer time period. To our knowledge, this is the first report of the ecologic effect of a decolonization regimen in patient populations.Decolonization with mupirocin leads to a sustained effect on S. aureus absolute and relative abundance in the nose consistent with past clinical trials of mupirocin. It is intriguing that mupirocin’s long term effect is predominantly on S. aureus despite high susceptibility of other staphylococci and streptococci. Our study demonstrates that a short course of mupirocin selectively decreases S. aureus in the nose for up to 8 weeks sparing other bacteria. This selective antimicrobial action makes mupirocin an excellent option for short-term decolonization of S. aureus. In an era of increasing emphasis on the importance of choosing antibiotics with a narrow spectrum, our report serves as an example of the type of approach which needs to be examined for other antibiotics.(DOCX)Click here for additional data file.
Absolute abundance of Staphylococcus aureus as measured by qPCR over time in the nose of participants with a high vs. low relative abundance of S. aureus.
Data are presented as means ± SEMs. Statistical comparisons were made with the Week 0 time point within SA group. Statistical significance was determined by Wilcoxon signed ranks test. Asterisk, P<0.05.(TIF)Click here for additional data file.
Alpha diversity analyses of the throat samples over time at a sequencing depth of 2000 sequences per sample.
A. Observed Diversity Index, B. Shannon Diversity Index. Data are presented as means ± SEMs. Statistical comparisons were made with the Week 0 time point. Statistical significance was determined by Wilcoxon rank sum test (Mann Whitney U test). Asterisk, P<0.05.(TIF)Click here for additional data file.Unifrac distances comparing distances to week 0 communities by body site stratified by dwelling (A: nose, B: throat) and gender (C: nose, D: throat). Data are presented as means ± SEMs. Statistical comparisons were made between the distance of Week -4 to Week 0, and the distance of Week 0 to other time points within body site. Statistical significance was determined by Wilcoxon signed ranks test. Asterisk, P<0.05.(TIF)Click here for additional data file.Principal coordinates (PCs) analysis of beta diversity metrics by body site stratified by dwelling (A) and gender (B), showing distances from unweighted Unifrac over time. The ellipses represent 95% confidence intervals for clustered specimens from participants by gender and dwelling.(TIF)Click here for additional data file.
Distribution of the top 15 bacterial taxa at the lowest taxonomic classification for each body site over time stratified by the relative abundance of S. aureus in the nose.
Error bars show standard errors. A. Nose, B. Throat.(TIF)Click here for additional data file.
Absolute abundance of staphylococci, streptococci, and Enterobacteriaceae over time.
Data are presented as means ± SEMs. Statistical comparisons were made between participants with high and low relative abundance of Staphylococcus aureus of the change from Week 0 to each time point within the nose (A, B, C) or of the change from Week 0 to each time point within the throat (D). Statistical significance was determined by Wilcoxon rank sum test (Mann Whitney U test) (A, B, C) or the Wilcoxon signed ranks test (D). Asterisk, P<0.05.(TIF)Click here for additional data file.
Differentially abundant bacteria in the nose and throat over time using generalized linear models of abundance based on the negative binomial distribution [1].
(DOCX)Click here for additional data file.(PDF)Click here for additional data file.(PDF)Click here for additional data file.15 Apr 2020PONE-D-19-32171Effect of mupirocin for Staphylococcus aureus decolonization on the microbiome of the nose and throat in community and nursing home dwelling adultsPLOS ONEDear Dr. Roghmann,Thank you for submitting your manuscript to PLOS ONE. After careful consideration, we feel that it has merit but does not fully meet PLOS ONE’s publication criteria as it currently stands. Therefore, we invite you to submit a revised version of the manuscript that addresses the points raised during the review process.The manuscript has been assessed by two reviewers; their comments are available below.The reviewers have raised some concerns about the study which need attention in a revision. The reviewers request clarification on the definition of carriage employed and note that information should be provided on how DNA detection results correspond to culture results. The reviewers also raise concerns about the approach to the statistical analyses and recommend a re-analysis using different statistical methodology.Could you please revise the manuscript to carefully address the concerns raised by the reviewers?We would appreciate receiving your revised manuscript by May 29 2020 11:59PM. When you are ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file.If you would like to make changes to your financial disclosure, please include your updated statement in your cover letter.To enhance the reproducibility of your results, we recommend that if applicable you deposit your laboratory protocols in protocols.io, where a protocol can be assigned its own identifier (DOI) such that it can be cited independently in the future. For instructions see: http://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocolsPlease include the following items when submitting your revised manuscript:A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). This letter should be uploaded as separate file and labeled 'Response to Reviewers'.A marked-up copy of your manuscript that highlights changes made to the original version. This file should be uploaded as separate file and labeled 'Revised Manuscript with Track Changes'.An unmarked version of your revised paper without tracked changes. This file should be uploaded as separate file and labeled 'Manuscript'.Please note while forming your response, if your article is accepted, you may have the opportunity to make the peer review history publicly available. The record will include editor decision letters (with reviews) and your responses to reviewer comments. If eligible, we will contact you to opt in or out.We look forward to receiving your revised manuscript.Kind regards,Iratxe PueblaDeputy Editor-in-Chief, PLOS ONEJournal Requirements:When submitting your revision, we need you to address these additional requirements.1. Please ensure that your manuscript meets PLOS ONE's style requirements, including those for file naming. The PLOS ONE style templates can be found athttps://journals.plos.org/plosone/s/file?id=wjVg/PLOSOne_formatting_sample_main_body.pdf andhttps://journals.plos.org/plosone/s/file?id=ba62/PLOSOne_formatting_sample_title_authors_affiliations.pdf2. Thank you for submitting your clinical trial to PLOS ONE and for providing the name of the registry and the registration number. The information in the registry entry suggests that your trial was registered after patient recruitment began. PLOS ONE strongly encourages authors to register all trials before recruiting the first participant in a study.As per the journal’s editorial policy, please include in the Methods section of your paper:a) your reasons for your delay in registering this study (after enrolment of participants started);b) confirmation that all related trials are registered by stating: “The authors confirm that all ongoing and related trials for this drug/intervention are registered”.Please also ensure you report the date at which the ethics committee approved the study as well as the complete date range for patient recruitment and follow-up in the Methods section of your manuscript.3. We note that you have included the phrase “data not shown” in your manuscript. Unfortunately, this does not meet our data sharing requirements. PLOS does not permit references to inaccessible data. We require that authors provide all relevant data within the paper, Supporting Information files, or in an acceptable, public repository. Please add a citation to support this phrase or upload the data that corresponds with these findings to a stable repository (such as Figshare or Dryad) and provide and URLs, DOIs, or accession numbers that may be used to access these data. Or, if the data are not a core part of the research being presented in your study, we ask that you remove the phrase that refers to these data.[Note: HTML markup is below. Please do not edit.]Reviewers' comments:Reviewer's Responses to QuestionsComments to the Author1. Is the manuscript technically sound, and do the data support the conclusions?The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented.Reviewer #1: YesReviewer #2: No**********2. Has the statistical analysis been performed appropriately and rigorously?Reviewer #1: I Don't KnowReviewer #2: No**********3. Have the authors made all data underlying the findings in their manuscript fully available?The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified.Reviewer #1: YesReviewer #2: Yes**********4. Is the manuscript presented in an intelligible fashion and written in standard English?PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here.Reviewer #1: YesReviewer #2: Yes**********5. Review Comments to the AuthorPlease use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters)Reviewer #1: This paper presents the genomic analysis of an interventional before and after trial of decolonisation with mupirocin in adults from the community and nursing homes. This is a follow up report and the study was earlier reported with culture results, showing sustained decrease in S. aureus by culture, but no increase in GNR colonisation. Using quantification of total and S. aureus DNA, as well as microbiome analysis by 16s rDNA sequencing, the authors establish that a sustained effect on S. aureus abundance is specifically shown in a group of 33 adults for up to 8 weeks after topical mupirocin.The topic is an important one; unintended consequences of decolonisation must be weighed against the possible protective effects. Introduction provides a clear rationale and context for the study, and includes a tested hypothesis (that decrease in staphylococci and streptococci, with a reciprocal increase in the abundance of Enterobacteriaceae would be seen following decolonisation). There are some aspects of the methods I would like to see more clearly explained, but overall the data presented support their conclusions. I would suggest minor revisions to clarify these.Major comments- Colonisation was determined by two visits over 4 weeks. As there is evidence of frequent loss and gain events in S. aureus carriage (especially in younger people), I think some more detail on what definition of carriage was applied is needed. In particular, what number of sites over how many visits had to yield S. aureus to qualify as a carrier. The risk with using a single positive swab as evidence of carriage is that transient carriage is frequently observed, and the subsequent decrease in S. aureus carriage may reflect natural fluctuations, rather than the effect of topical antibiotics. This would explain the lack of sustained effect on other Gram positive organisms seen with mupirocin.- The remaineder of inclusion and exclusion criteria are well presented. The exclusion criteria are sensible and not overly restrictive. Intervention was 5 days of bd nasal mupirocin, administered by subjects or the staff for NH patients, which appears reliable even if not directly observed by study staff. A convenience sampling strategy and sample size were employed.- The Microbiological methods are clearly stated- Genomics included appropriate negative controls in each extraction- The metagenomics methods were reasonably clear to me (though I am not a metagenomics expert), and consideration has been given to the issues of bias introduction by PCR amplification, and includes consideration of a pre-specified, biologically based hypothesis.- It is not clear to me why while S. aureus, S. epidermidis and Enterobacteriacae in nose and throat were examined, Streptococcaeceae were not examined in the nose. While naturally more abundant in the throat, these can certainly from part of the nasal microbiome (https://openres.ersjournals.com/content/4/4/00066-2018) . The exclusion should be explained.Results- Baseline characteristics are clearly presented, a flow diagram of recruitment and analysis is presented. It is notable that nearly half the community participants did not have S. aureus cultured from nose prior to treatment. I would like to see details of how S. aureus DNA detection correspond with culture results. The patients have been stratified by relative abundance of DNA (relative to this small cohort), but if culture detection is a better explanation than this parameter, this should be presented.- Relative abundance of S. aureus DNA was decreased following mupirocin in nose but not throat; note that the nasal abundance is only just statistically significant by a nominal alpha (eg 0.05); I would suggest some quantitative presentation of the results to allow reader to determine if they think this decrease is quantitatively significant.- Other interesting results include:An increase in total increase in bacterial load in the throat at 8 weeks (more than 3-fold, and statistically significant) after mupirocin;An increase in diversity indices at 1 week in the nose, only, and only for high SA abundanceNo significant sustained disruption of the communities as measured by uniFrac distance- Differences in bacterial community structures at week 0 and 1 that were not sustained over time. It is notable these differences were significant in the group as a whole, and in the low abundance stratum, but not the high abundance stratum. This is rather the opposite of what I might expect given that indices of diversity within samples were only significant in the high S. aureus group. While the authors comment this may be due to smaller group sizes, they do not explore other interpretations, and I would like to see comment on how these findings can be integrated, or whether one or both findings may be chance observations.Discussion- Overall, the discussion presents a balanced synthesis of the results and is clearly written.- Absolute and relative abundance of S. aureus declines in the nose after mupirocin- The unexpected finding of increased bacterial abundance after mupirocin is explored and possible explanations proposed; appropriately the authors retain some uncertainty about the weight of this finding.- In Line 337-338 the authors state “There was a sustained, although not statistically significant, disruption in the nose of those participants with a high relative abundance of S. aureus”. Looking at 5A, and the overlapping confidence intervals of the UniFrac distance, and the larger (but still not significant) disruption seen in the low abundance group, this data does not strongly support this statement, and I suggest some moderation of the findings here.Minor comments- The abbreviation OTU (first used line 148) is not defined in the manuscriptReviewer #2: Thirty-two adults with staphylococcus aureas colonization were included in the study. Nose and throat specimens were collected for quantitative PCR and bacterial profiling over a 12-week period. All participants received intranasal mupirocin treatment. The conclusions are unclear.Major revision:Statistical methods: A mixed linear model testing for changes over time would be superior to testing for differences by repeatedly applying Wilcoxon rank sum tests. The model offers flexibility for testing several factors simultaneously. Additionally, the model can adjust for variables that were significantly different between nursing home patients and community patients as indicated in Table 1.Minor revision:Table 1: Indicate the statistical testing methods used to calculate the p-values.**********6. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.If you choose “no”, your identity will remain anonymous but your review may still be made public.Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.Reviewer #1: NoReviewer #2: No[NOTE: If reviewer comments were submitted as an attachment file, they will be attached to this email and accessible via the submission site. Please log into your account, locate the manuscript record, and check for the action link "View Attachments". If this link does not appear, there are no attachment files to be viewed.]While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com/. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Registration is free. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email us at figures@plos.org. Please note that Supporting Information files do not need this step.12 Oct 2020When submitting your revision, we need you to address these additional requirements.1. Please ensure that your manuscript meets PLOS ONE's style requirements, including those for file naming. The PLOS ONE style templates can be found athttps://journals.plos.org/plosone/s/file?id=wjVg/PLOSOne_formatting_sample_main_body.pdf andhttps://journals.plos.org/plosone/s/file?id=ba62/PLOSOne_formatting_sample_title_authors_affiliations.pdfThank you for the reminder about PLOS ONE’s style requirements. These formatting changes have been made.2. Thank you for submitting your clinical trial to PLOS ONE and for providing the name of the registry and the registration number. The information in the registry entry suggests that your trial was registered after patient recruitment began. PLOS ONE strongly encourages authors to register all trials before recruiting the first participant in a study.As per the journal’s editorial policy, please include in the Methods section of your paper:a) your reasons for your delay in registering this study (after enrolment of participants started);b) confirmation that all related trials are registered by stating: “The authors confirm that all ongoing and related trials for this drug/intervention are registered”.Please also ensure you report the date at which the ethics committee approved the study as well as the complete date range for patient recruitment and follow-up in the Methods section of your manuscript.Please see lines 100-102 for our reason for delay in registering the studies and confirmation that all related trials are registered. The dates of ethics committee approval have been added in lines 71-72. The complete date range for patient recruitment and follow-up is found on lines 85-86.3. We note that you have included the phrase “data not shown” in your manuscript. Unfortunately, this does not meet our data sharing requirements. PLOS does not permit references to inaccessible data. We require that authors provide all relevant data within the paper, Supporting Information files, or in an acceptable, public repository. Please add a citation to support this phrase or upload the data that corresponds with these findings to a stable repository (such as Figshare or Dryad) and provide and URLs, DOIs, or accession numbers that may be used to access these data. Or, if the data are not a core part of the research being presented in your study, we ask that you remove the phrase that refers to these data.Thank you for bringing this to our attention. We have removed the phrase as all the data is publicly available in Genbank.5. Review Comments to the AuthorReviewer #1: This paper presents the genomic analysis of an interventional before and after trial of decolonisation with mupirocin in adults from the community and nursing homes. This is a follow up report and the study was earlier reported with culture results, showing sustained decrease in S. aureus by culture, but no increase in GNR colonisation. Using quantification of total and S. aureus DNA, as well as microbiome analysis by 16s rDNA sequencing, the authors establish that a sustained effect on S. aureus abundance is specifically shown in a group of 33 adults for up to 8 weeks after topical mupirocin.The topic is an important one; unintended consequences of decolonisation must be weighed against the possible protective effects. Introduction provides a clear rationale and context for the study and includes a tested hypothesis (that decrease in staphylococci and streptococci, with a reciprocal increase in the abundance of Enterobacteriaceae would be seen following decolonisation). There are some aspects of the methods I would like to see more clearly explained, but overall the data presented support their conclusions. I would suggest minor revisions to clarify these.Major comments- Colonisation was determined by two visits over 4 weeks. As there is evidence of frequent loss and gain events in S. aureus carriage (especially in younger people), I think some more detail on what definition of carriage was applied is needed. In particular, what number of sites over how many visits had to yield S. aureus to qualify as a carrier. The risk with using a single positive swab as evidence of carriage is that transient carriage is frequently observed, and the subsequent decrease in S. aureus carriage may reflect natural fluctuations, rather than the effect of topical antibiotics. This would explain the lack of sustained effect on other Gram positive organisms seen with mupirocin.In order to be included, participants needed to be S. aureus colonized on at least one of the following body sites during at least one of the baseline visits: anterior nares, throat, subclavian skin, femoral skin or perirectal skin. Twenty participants were S. aureus colonized at both baseline study visits and 12 participants were colonized at one baseline visit. This has been added to the manuscript in lines 79-81 and 191-192. Our stratification by relative abundance of S. aureus is done to distinguish between transient and persistent carriage, since those with persistent carriage have a greater abundance of S. aureus (1). Since the distinction between transient and persistent carriers is not made clinically and people with either are decolonized with mupirocin, our eligibility criteria are clinically relevant.- The remainder of inclusion and exclusion criteria are well presented. The exclusion criteria are sensible and not overly restrictive. Intervention was 5 days of bd nasal mupirocin, administered by subjects or the staff for NH patients, which appears reliable even if not directly observed by study staff. A convenience sampling strategy and sample size were employed.- The Microbiological methods are clearly stated- Genomics included appropriate negative controls in each extraction- The metagenomics methods were reasonably clear to me (though I am not a metagenomics expert), and consideration has been given to the issues of bias introduction by PCR amplification, and includes consideration of a pre-specified, biologically based hypothesis.- It is not clear to me why while S. aureus, S. epidermidis and Enterobacteriacae in nose and throat were examined, Streptococcaeceae were not examined in the nose. While naturally more abundant in the throat, these can certainly from part of the nasal microbiome (https://openres.ersjournals.com/content/4/4/00066-2018) . The exclusion should be explained.This was a specimen from the anterior nares which is more like the skin than the nasopharynx and Streptococcaeceae are not abundant in the anterior nares. This dataset included the top 15 bacteria that were found in the nose. The median relative abundance in the nose for Streptococcaeceae is 1.0% across all visits (mean of 3.2%). This can also be seen on panel A of Figure S5. There was not sufficient abundance in the nose for us to include it in the analysis.Results- Baseline characteristics are clearly presented, a flow diagram of recruitment and analysis is presented. It is notable that nearly half the community participants did not have S. aureus cultured from nose prior to treatment. I would like to see details of how S. aureus DNA detection correspond with culture results. The patients have been stratified by relative abundance of DNA (relative to this small cohort), but if culture detection is a better explanation than this parameter, this should be presented.The objective of this study was not to compare DNA sequencing-based vs culture-based detection of S. aureus. These two approaches are fundamentally different and not easily comparable (cultivation involved broth enrichment whereas sequencing did not; cultivation detects metabolically-active bacteria that can grow in culture medium, whereas DNA-based sequencing can detect live, dormant or even dead bacterial cells, etc). The use of relative abundance was intended to distinguish between persistent vs intermittent or transient colonization. Thus we do not present this comparison.- Relative abundance of S. aureus DNA was decreased following mupirocin in nose but not throat; note that the nasal abundance is only just statistically significant by a nominal alpha (eg 0.05); I would suggest some quantitative presentation of the results to allow reader to determine if they think this decrease is quantitatively significant.Thank you for mentioning this. The mean reduction in absolute abundance of S. aureus from Week 0 to Week 8 was 1553 fg/µL in the nose and 993 fg/µL in the throat. This has been added to the manuscript in line 233.- Other interesting results include:An increase in total increase in bacterial load in the throat at 8 weeks (more than 3-fold, and statistically significant) after mupirocin;An increase in diversity indices at 1 week in the nose, only, and only for high SA abundanceNo significant sustained disruption of the communities as measured by uniFrac distance- Differences in bacterial community structures at week 0 and 1 that were not sustained over time. It is notable these differences were significant in the group as a whole, and in the low abundance stratum, but not the high abundance stratum. This is rather the opposite of what I might expect given that indices of diversity within samples were only significant in the high S. aureus group. While the authors comment this may be due to smaller group sizes, they do not explore other interpretations, and I would like to see comment on how these findings can be integrated, or whether one or both findings may be chance observations.We believe the reviewer refers to the Weighted UniFrac distances (“bacterial community structures”) from the beta-diversity analyses in Figs 5A/B and S4, and Observed and Shannon alpha-diversity indices (“indices of diversity within samples”) in Fig. 4A. These are 2 different and independent approaches aimed to characterize different features of complex bacterial communities. Our alpha-diversity analysis showed an increase in Observed species (measure of community richness) and Shannon index (measure of community diversity) in the high S. aureus group (but not in the low S. aureus group) between week 0 and 1. This is expected, given that when mupirocin is applied and clears S. aureus (and generally other Gram-positive bacteria), this provides an opportunity for other bacteria not affected by mupirocin to take over the environmental niche previously occupied by S. aureus. As S. aureus colonizes the anterior nares again after the mupirocin treatment is over, there is an overall decrease of bacterial diversity as S. aureus outcompetes other bacteria to become dominant again (Fig. 3).Beta diversity compares bacterial community structure between samples, which is not directly related to alpha-diversity, since it measures similarity (or dissimilarity) between pairs of samples. The metric we used in our analyses (weighted UniFrac) compares similarity between bacterial communities, while also taking into consideration the phylogenetic relatedness of bacterial community members in the pair of samples compared, as well as their relative abundance. Therefore, it is possible that the increase in the Observed species richness (alpha-diversity) between week 0 and 1 seen for the high S. aureus group might not yield differences in weighted UniFrac distances (beta diversity), if the increase in alpha-diversity is the result of – for example - novel bacterial members at low relative abundance and somewhat phylogenetically related to some of the bacteria in the samples. In such a scenario, we would not expect UniFrac distances to vary significantly between week 0 and 1, while such scenario would be likely to yield an increase in alpha-diversity metrics.Discussion- Overall, the discussion presents a balanced synthesis of the results and is clearly written.- Absolute and relative abundance of S. aureus declines in the nose after mupirocin- The unexpected finding of increased bacterial abundance after mupirocin is explored and possible explanations proposed; appropriately the authors retain some uncertainty about the weight of this finding.- In Line 337-338 the authors state “There was a sustained, although not statistically significant, disruption in the nose of those participants with a high relative abundance of S. aureus”. Looking at 5A, and the overlapping confidence intervals of the UniFrac distance, and the larger (but still not significant) disruption seen in the low abundance group, this data does not strongly support this statement, and I suggest some moderation of the findings here.This statement was meant to reflect the fact that, in the high S. aureus group, UniFrac distances of the nose bacterial communities differed and remained somewhat constant post-mupirocin treatment compared to baseline, in comparison to the low S. aureus group where there seemed to be some “oscillations” in uniFrac distances post mupirocin treatment. We have edited this sentence (lines 349-353), which now reads: “The disruption in the nose of those participants with a high relative abundance of S. aureus, although not statistically significant, was maintained post-mupirocin treatment, in contrast to participants in the low S. aureus group where oscillations in bacterial community structure could be observed.Minor comments- The abbreviation OTU (first used line 148) is not defined in the manuscriptThank you for pointing this out. We have added text to define OTU where it is first used in the manuscript.Reviewer #2: Thirty-two adults with staphylococcus aureus colonization were included in the study. Nose and throat specimens were collected for quantitative PCR and bacterial profiling over a 12-week period. All participants received intranasal mupirocin treatment. The conclusions are unclear.Major revision:Statistical methods: A mixed linear model testing for changes over time would be superior to testing for differences by repeatedly applying Wilcoxon rank sum tests. The model offers flexibility for testing several factors simultaneously. Additionally, the model can adjust for variables that were significantly different between nursing home patients and community patients as indicated in Table 1.The reviewer makes an excellent suggestion to address the within-participant correlation using linear mixed models. We initially selected Wilcoxon tests to avoid making distributional assumptions; however, the reviewer correctly points out that these tests do not address the within-person correlation over the whole follow-up period. Since both methods have advantages and limitations, we opted to utilize both as a way to determine robustness of findings to modeling assumption. Since many variables were highly skewed and contained excessive zeroes, we used square-root transformations and using zero-inflated Gaussian linear mixed models when warranted. We considered leveraging the ability to adjust for covariates, but we did not for the following two reasons. First, source of participant (community vs. nursing home) was not the study variable in these analyses; rather participants were compared to themselves over time. However, we did observe some differences in patterns over time by S. aureus at visit 1, which led us to perform more complex modeling that accounted for time, and time-by-S. aureus interactions. Second, owing to the relatively small number of participants, we were concerned that additional adjustment (beyond the interaction terms) would lead to sparseness and conditions that would not satisfy the second-order Taylor expansion approximation to normality of the parameter-specific tests.Minor revision:Table 1: Indicate the statistical testing methods used to calculate the p-values.Thank you for noticing this. We have indicated the statistical testing methods used to calculate the p-values in Table 1 in the manuscript text (lines 178-179) and added a footnote to the table.References1. Nouwen JL, Ott A, Kluytmans-Vandenbergh MFQ, Boelens HAM, Hofman A, van Belkum A, et al. Predicting the Staphylococcus aureus nasal carrier state: derivation and validation of a “culture rule.” Clin Infect Dis. 2004 Sep 15;39(6):806–11.10 May 2021Effect of mupirocin for Staphylococcus aureus decolonization on the microbiome of the nose and throat in community and nursing home dwelling adultsPONE-D-19-32171R1Dear Dr. Roghmann,We’re pleased to inform you that your manuscript has been judged scientifically suitable for publication and will be formally accepted for publication once it meets all outstanding technical requirements.Within one week, you’ll receive an e-mail detailing the required amendments. When these have been addressed, you’ll receive a formal acceptance letter and your manuscript will be scheduled for publication.An invoice for payment will follow shortly after the formal acceptance. To ensure an efficient process, please log into Editorial Manager at http://www.editorialmanager.com/pone/, click the 'Update My Information' link at the top of the page, and double check that your user information is up-to-date. If you have any billing related questions, please contact our Author Billing department directly at authorbilling@plos.org.If your institution or institutions have a press office, please notify them about your upcoming paper to help maximize its impact. If they’ll be preparing press materials, please inform our press team as soon as possible -- no later than 48 hours after receiving the formal acceptance. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information, please contact onepress@plos.org.Kind regards,Giuseppe Vittorio De Socio, MD, PhDAcademic EditorPLOS ONEAdditional Editor Comments (optional):Reviewers' comments:Reviewer's Responses to QuestionsComments to the Author1. If the authors have adequately addressed your comments raised in a previous round of review and you feel that this manuscript is now acceptable for publication, you may indicate that here to bypass the “Comments to the Author” section, enter your conflict of interest statement in the “Confidential to Editor” section, and submit your "Accept" recommendation.Reviewer #1: All comments have been addressedReviewer #2: All comments have been addressed**********2. Is the manuscript technically sound, and do the data support the conclusions?The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented.Reviewer #1: YesReviewer #2: (No Response)**********3. Has the statistical analysis been performed appropriately and rigorously?Reviewer #1: YesReviewer #2: (No Response)**********4. Have the authors made all data underlying the findings in their manuscript fully available?The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified.Reviewer #1: YesReviewer #2: (No Response)**********5. Is the manuscript presented in an intelligible fashion and written in standard English?PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here.Reviewer #1: YesReviewer #2: (No Response)**********6. Review Comments to the AuthorPlease use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters)Reviewer #1: (No further comments to authors, previous comments addressed in response)__________________________Reviewer #2: (No Response)**********7. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.If you choose “no”, your identity will remain anonymous but your review may still be made public.Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.Reviewer #1: NoReviewer #2: No19 May 2021PONE-D-19-32171R1Effect of mupirocin for Staphylococcus aureus decolonization on the microbiome of the nose and throat in community and nursing home dwelling adultsDear Dr. Roghmann:I'm pleased to inform you that your manuscript has been deemed suitable for publication in PLOS ONE. Congratulations! Your manuscript is now with our production department.If your institution or institutions have a press office, please let them know about your upcoming paper now to help maximize its impact. If they'll be preparing press materials, please inform our press team within the next 48 hours. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information please contact onepress@plos.org.If we can help with anything else, please email us at plosone@plos.org.Thank you for submitting your work to PLOS ONE and supporting open access.Kind regards,PLOS ONE Editorial Office Staffon behalf ofDr. Giuseppe Vittorio De SocioAcademic EditorPLOS ONE
Authors: Leah J Hauser; Diana Ir; Todd T Kingdom; Charles E Robertson; Daniel N Frank; Vijay R Ramakrishnan Journal: Int Forum Allergy Rhinol Date: 2015-09-21 Impact factor: 3.858
Authors: Adam J SanMiguel; Jacquelyn S Meisel; Joseph Horwinski; Qi Zheng; Elizabeth A Grice Journal: Antimicrob Agents Chemother Date: 2017-08-24 Impact factor: 5.191
Authors: Stephen G Weber; Susan S Huang; Shannon Oriola; W Charles Huskins; Gary A Noskin; Kathleen Harriman; Russell N Olmsted; Marc Bonten; Tammy Lundstrom; Michael W Climo; Mary-Claire Roghmann; Cathryn L Murphy; Tobi B Karchmer Journal: Infect Control Hosp Epidemiol Date: 2007-02-07 Impact factor: 3.254
Authors: Andre P Masella; Andrea K Bartram; Jakub M Truszkowski; Daniel G Brown; Josh D Neufeld Journal: BMC Bioinformatics Date: 2012-02-14 Impact factor: 3.169
Authors: Alan W Walker; Jennifer C Martin; Paul Scott; Julian Parkhill; Harry J Flint; Karen P Scott Journal: Microbiome Date: 2015-06-22 Impact factor: 14.650
Authors: Johanna B Holm; Michael S Humphrys; Courtney K Robinson; Matthew L Settles; Sandra Ott; Li Fu; Hongqiu Yang; Pawel Gajer; Xin He; Elias McComb; Patti E Gravitt; Khalil G Ghanem; Rebecca M Brotman; Jacques Ravel Journal: mSystems Date: 2019-02-19 Impact factor: 6.496
Authors: Stephanie A Fritz; Todd N Wylie; Haley Gula; Patrick G Hogan; Mary G Boyle; Carol E Muenks; Melanie L Sullivan; Carey-Ann D Burnham; Kristine M Wylie Journal: Microbiol Spectr Date: 2022-04-06