LPCAT1-TERT fusions are uniquely recurrent in epithelioid trophoblastic tumors and positively regulate cell growth.

Gestational trophoblastic disease (GTD) is a heterogeneous group of lesions arising from placental tissue. Epithelioid trophoblastic tumor (ETT), derived from chorionic-type trophoblast, is the rarest form of GTD with only approximately 130 cases described in the literature. Due to its morphologic mimicry of epithelioid smooth muscle tumors and carcinoma, ETT can be misdiagnosed. To date, molecular characterization of ETTs is lacking. Furthermore, ETT is difficult to treat when disease spreads beyond the uterus. Here using RNA-Seq analysis in a cohort of ETTs and other gestational trophoblastic lesions we describe the discovery of LPCAT1-TERT fusion transcripts that occur in ETTs and coincide with underlying genomic deletions. Through cell-growth assays we demonstrate that LPCAT1-TERT fusion proteins can positively modulate cell proliferation and therefore may represent future treatment targets. Furthermore, we demonstrate that TERT upregulation appears to be a characteristic of ETTs, even in the absence of LPCAT1-TERT fusions, and that it appears linked to copy number gains of chromosome 5. No evidence of TERT upregulation was identified in other trophoblastic lesions tested, including placental site trophoblastic tumors and placental site nodules, which are thought to be the benign chorionic-type trophoblast counterpart to ETT. These findings indicate that LPCAT1-TERT fusions and copy-number driven TERT activation may represent novel markers for ETT, with the potential to improve the diagnosis, treatment, and outcome for women with this rare form of GTD.

Introduction

Gestational trophoblastic disease (GTD) is a heterogeneous group of lesions that includes both neoplastic and non-neoplastic entities. As defined by the 2014 WHO Classification of Tumors of Female Reproductive Organs [1], choriocarcinoma, placental site trophoblastic tumor (PSTT) and epithelioid trophoblastic tumor (ETT) encompass the neoplasms [2], whereas exaggerated implantation/placental site and placental site nodule (PSN) are non-neoplastic counterparts. Complete, partial and invasive hydatidiform moles represent abnormally developed non-neoplastic trophoblastic proliferations that carry potential for neoplastic transformation [3].

ETT, the rarest form of GTD [4, 5], is composed of chorionic-type intermediate trophoblast that has potential for metastasis. Although PSN is also composed of chorionic-type intermediate trophoblast, it is benign. While choriocarcinoma is more readily distinguishable, ETT, PSTT and PSN may present overlapping clinical and pathological features with associated diagnostic challenges [6]. ETT can be misdiagnosed [5, 7] as PSN, PSTT, clear cell carcinoma, or several other tumor types. Mixed histologies are also observed [6], and recently lesions possessing features between those of PSN and ETT have been classified as atypical PSNs [3]. Atypical PSNs are considered intermediate lesions in the spectrum of PSN and ETT. Furthermore, it has been proposed that ETT and PSTT might evolve from a previous PSN [8-10].

While the clinical course of ETT is difficult to predict, the risk of metastasis at the time of diagnosis is 25% [11], and the overall mortality rate is estimated to be as high as 24% [12]. Incorrectly diagnosing ETT is undesirable since hysterectomy can be curative for uterine-confined disease. ETT often shows a poor response to chemotherapy [3], which is generally reserved for metastatic disease, or disease presenting greater than four years following an antecedent pregnancy [3, 11]. This relative chemotherapy resistance dictates that ETT accounts disproportionately for GTD-related mortality, creating a need for novel therapeutic modalities to improve outcomes of women with advanced disease [11].

Here, we describe the application of RNA-Seq-based fusion transcript detection in GTD. Through profiling nine cases of GTD comprising ETT, PSTT and PSN, we identify and experimentally confirm the presence of LPCAT1-TERT fusion transcripts that appear to uniquely reoccur in ETT and are caused by genomic deletions. TERT is a well-established oncogene, whose expression is inactivated in most normal tissues but detectable in the majority of tumors [13]. Conversely LPCAT1 is ubiquitously expressed in normal tissues and encodes a protein with acyltransferase [14] and acetyltransferase activities [15] with proposed roles in respiratory physiology [14] and regulation of lipid droplet size and quantity [16]. While not universally recognized as an oncogene, growing evidence links LPCAT1 overexpression to cancer progression, metastasis and recurrence in oral, kidney, breast, gastric, and lung cancers [17, 18].

We demonstrate that LPCAT1-TERT fusion proteins promote cell growth in surrogate non-transformed 293T cells and could therefore represent relatively early events in ETT pathogenesis. Further, we show that copy number gains of chromosome 5 accompany TERT upregulation in ETT. Together, our findings define novel and unique features that may participate in ETT pathogenesis and indicate the potential for novel diagnostic or therapeutic considerations.

Materials and methods

Ethics statement

The final study was reviewed and approved by the Mayo Clinic Institutional Review Board. One individual (case ETT-1) was originally enrolled as part of a prospective study and provided written consent. All other cases involved fully anonymized, archival samples, and the need for consent was waived by the Institutional Review Board at their respective institution.

Histopathology

All tissue specimens were subjected to standard macroscopic and histological examinations. Tissue sections were processed routinely for morphologic assessment: sections were fixed in neutral-buffered formalin, processed, embedded in paraffin, sectioned and stained with hematoxylin and eosin. GTDs were diagnosed by pathologists at participating centers prior to final confirmation utilizing independent review by two gynecologic pathologists (JKS and SEK), following WHO classification guidelines [1].

Sample extraction

Sections of formalin-fixed paraffin-embedded (FFPE) tissue were freshly cut for nucleic acid extraction. DNA and RNA were extracted from FFPE tissue sections using the AllPrep DNA/RNA FFPE Kit (Qiagen, Netherlands) according to the manufacturer’s protocol. DNA was eluted in 30–50 μl ATE Buffer and RNA was eluted in 20–30 μl RNase-free water. DNA and RNA concentrations were quantified using Qubit fluorometry (Invitrogen, Carlsbad, CA).

RNA sequencing

Sequencing libraries were prepared according to manufacturer’s instructions for either the TruSeq RNA Sample Prep Kit v2 or the TruSeq RNA Access Library Prep Kit (Illumina, San Diego, CA). Library concentration and size distribution were initially determined using an Agilent Bioanalyzer DNA 1000 chip (Santa Clara, CA), and Qubit fluorometry (Invitrogen, Carlsbad, CA) was performed to confirm concentration. Paired-end 101-basepair reads were sequenced on an Illumina HiSeq 2500 using the TruSeq Rapid SBS sequencing kit version 1 and HCS version 2.0.12.0 data collection software. A median of approximately 175 million reads was generated per sample.

RNA expression analysis

Reads were aligned to the human genome (hg19) and transcriptome using Tophat2 [19] running Bowtie (v1) [20]. Gene level read counts were generated using HtSeq [21] and BedTools [22] respectively. Normalization was performed using the median of ratios method implemented by DESeq2 (v1.26.0) [23].

Fusion detection and analysis

Candidate fusion events were detected using TopHat Fusion (TopHat release 2.1.0) [24] with all default filters disabled to maximize sensitivity. To control for common events and recurrent artifacts, we compared putative fusion candidates to a database generated using tumor and normal samples from our own institution, the Illumina Human BodyMap, The Cancer Genome Atlas Fusion Database [25], and the Genotype-Tissue Expression (GTEx) project (dbGaP accession phs000424.v7.p2) [26]. GTEx consisted of approximately 8200 RNA-Seq samples from 549 unique individuals and 52 tissue types following QC.

DNA copy number analysis

Chromosomal microarray (CMA) was performed on DNA extracted from FFPE tissue using the OncoScan CNV Plus assay (Thermo Fisher Scientific, Waltham, MA) in a clinical laboratory and according to the manufacturer’s protocol. CMA data were analyzed using ChAS software version 3.3 (Thermo Fisher Scientific, Waltham, MA) and interpreted by a board-certified clinical cytogeneticist.

TERT promoter analysis

DNA mutation analysis was conducted within the TERT promoter region (hg19 chr5:1295170–1295296) for all samples. The TERT promoter region was amplified using gene specific primer sequences with Illumina adapter sequence on the 5’ end (F- AGTTCAGACGTGTGCTCTTCCGATCTCGTCCTGCCCCTTCACCT R- TCCCTACACGACGCTCTTCCGATCTAGCGCTGCCTGAAACTCG) and the KAPA Hi-Fi Hotstart ReadyMix master mix per manufacturer protocol. After Ampure XP purification, a 2nd round of PCR was performed to add a patient specific barcode and an Illumina specific adapter sequence. After final purification, samples were loaded onto an Illumina MiSeq instrument. Data were processed using a custom bioinformatics pipeline and any TERT promoter mutations with 5% or greater mutant allele frequency were reported.

Fusion expression validation in primary ETT

LPCAT1-TERT fusion expression was validated by RT-qPCR as follows: RNA was extracted from FFPE ETT or adjacent normal tissue sections using the RNA FFPE Kit (Qiagen, Netherlands) according to the manufacturer’s protocol. Two micrograms of RNA were used to generate cDNA using High-Capacity cDNA Reverse Transcription Kit (Applied Biosystems). Then, the cDNA was amplified by real-time PCR. Samples were prepared with PerfeCTa SYBR Green FastMix (Quanta BioSciences Inc) and the following primer sets: LPCAT1-TERT sense: 5’-CGCCTCACTCGTCCTACTTC-3’, antisense 5’-TTGCAACTTGCTCCAGACAC-3 and 18S, sense 5’-AACCCGTTGAACCCCATTCGTGAT-3’, antisense 5’-AGTCAAGTTCGACCGTCTTCTCAG-3’. Furthermore, 5 μl of the cDNA was amplified by regular PCR using the LPCAT1-TERT primers already described, and TAKARA Kit according to the manufacturer’s protocol. The PCR products were resolved in a 2% agarose gel and the 278 bp bands were extracted by Gel/PCR DNA Fragment Extraction Kit (MicSci) and Sanger sequenced to confirm the fusion’s presence in tumor tissue and absence from adjacent normal tissue.

Western blotting

293T cells were selected as a surrogate model and grown in RPMI with 10% fetal bovine serum (FBS). Constructs (pcDNA and pcDNA-LPCAT1-TERT-Flag) were reverse-transfected using FuGene (Promega) following the manufacturer’s protocol. 30,000 cells were seeded in a 6cm plate. The ratio of FuGene reagent to DNA was 3:1. Cells were harvested 48hrs later. Anti-Flag antibody (Sigma, mouse, 1:1000) was used to determine the expression level of transfected constructs, and anti-tubulin antibody (Sigma, T5026, mouse, 1:3000) was used as a control. Further details on fusion construct generation are included in the S1 Methods.

Cell culture conditions and cell growth assay

The HEK293G were obtained from American Type Culture Collection (ATCC) (Manassas, VA). DMEM was used for the cultures under standard incubation conditions of 37C and 5% CO2 were used in all experiments. Purchased media was enriched with 10% fetal bovine serum. Transfection was performed as described above except that 5,000 cells were seeded per well on 96-well plates, and 5 replicates were made in each condition. On reverse transfection, medium with 10% FBS was used, and at 72 hours post-transfection, 1% of resazurin solution at 0.1μg/μl (Sigma-Aldrich) was added in each well. Plates were incubated at 37°C for 4 hours and the fluorescent signal was measured at 560Ex/590Em wavelength, in a FL X800 Microplate Reader (BIO-TEK Instruments Inc).

Cellular localization

Coverslips (25mm circle) were placed in 6 well plates and plated with HEK293 cells at a 100,000 cells per well. Cells were transfected with 2ug of DNA using X-tremeGENETM HP (Roche cat. 06366546001). At 48 hours post transfection cells were rinsed with PBS and fixed with 4% formaldehyde for 15 minutes, rinsed again with PBS, and permeabilized for 10 minutes using 0.1% Triton X-100 in PBS. Cells were then blocked for 30 minutes in 1% BSA, 22.52mg glycine in PBST (0.1% Tween 20). Blocking solution was removed and cells were incubated overnight at 4°C in rabbit Anti-Flag (Sigma-Aldrich, cat. F7425) at a 1:200 dilution in PBST with 1% BSA. Cells were rinsed with PBS and secondary antibody, goat anti-rabbit Alexa-488 (Invitrogen, cat. A11008), was added at 1:500 dilution in PBST with 1% BSA and incubated at room temperature in the dark for 1 hour. Coverslips were rinsed with PBS then mounted using ProLongTM Gold Antifade with DAPI and allowed to set overnight. Images were obtained using Zeiss LSM 800 confocal microscope and processed using ImageJ software.

Results

LPCAT1-TERT fusion transcripts occur in epithelioid trophoblastic tumors

Nine cases of GTD with sample qualities yielding sufficient DNA and RNA to enable testing were identified from internal and external treating centers. Samples were collected for three ETTs, four PSNs (one atypical) and two PSTTs (Table 1). ETT-2 originated at Maternity Hospital Kuwait. ETT-1 and PSTT-2 originated at Mayo Clinic while all other successfully profiled samples were acquired through Mayo Clinic’s consultation practice. Available clinicopathologic data were limited due to the fact that the majority of cases were clinical consults. Four further ETTs from Johns Hopkins University School of Medicine produced DNA and RNA yields insufficient to proceed with analysis and were excluded from the study. Representative histologic images are provided in Fig 1.

Table 1

Clinicopathologic details.

Case	Age at Diagnosis (years)	Diagnosis	Site	Specimen Received	Tumor Size (cm)	Additional Treatment and Follow-up
ETT-1	47	ETT	Uterine corpus and cervix (primary) and liver (metastasis)	Hysterectomy, BSO (primary), liver resection (metastasis)	UNK (primary), 8 (metastasis)	Completed 3 cycles of chemotherapy; developed multiple metastases (liver, spleen, lungs, brain) 3 years later and died of disease
ETT-2	51	ETT	Uterine fundus	Hysterectomy, BSO	5	UNK
ETT-3	46	ETT	Endometrium	Endometrial biopsy	UNK	UNK
PSN-1	36	PSN	Endometrium	Endometrial polypectomy and curettage	UNK	UNK
PSN-2	26	PSN	Endometrium	Endometrial curettage	UNK	UNK
PSN-3	34	PSN	Endometrium	Hysterectomy, BSO	UNK	UNK
APSN-1	43	Atypical PSN	Uterus, NOS	Submucosal lesion excision	UNK	UNK
PSTT-1	41	PSTT	Uterus, NOS	Hysterectomy, BSO	3	UNK
PSTT-2	31	PSTT	Uterus, NOS, with adnexal soft tissue extension	Hysterectomy, BSO	6	Completed 5 cycles of chemotherapy; developed pulmonary metastases 2 years later and is undergoing immunotherapy

ETT = epithelioid trophoblastic tumor; PSN = placental site nodule; PSTT = placental site trophoblastic tumor; UNK = unknown; BSO = bilateral salpingo-oophorectomy; NOS = not otherwise specified

Fig 1

Representative histologic images.

Magnification 40x (A, C, E) and 200x (B, D, F). (A, B) Placental site nodule. Well-circumscribed nodular lesion composed of chorionic-type intermediate trophoblast with abundant clear to eosinophilic cytoplasm and round nuclei, embedded in a hyalinized matrix. (C) Epithelioid trophoblastic tumor. Large expansile nests and nodules, separated by eosinophilic hyaline-like material composed of chorionic-type intermediate trophoblast. The trophoblast have a moderate amount of clear to eosinophilic cytoplasm and relatively uniform round nuclei with small nucleoli and multiple mitotic figures (D). (E, F) Placental site trophoblastic tumor. Infiltration of myometrium by sheets of implantation site-type intermediate trophoblast composed of large cells with abundant eosinophilic to amphophilic cytoplasm with pleomorphic nuclei, some of which are seen in association with the wall of a blood vessel.

RNA-Seq and fusion transcript detection were performed on all samples in Table 1 with the exception of the atypical PSN case which was not available (NA) at the time of testing. RNA-Seq indicated the presence of LPCAT1-TERT fusion transcripts in two of three ETTs tested (Table 2). All other samples tested were negative for TERT fusions on the basis of RNA-Seq analysis. No control samples showed any evidence of LPCAT1-TERT fusion-supporting reads. LPCAT1 and TERT are colinear transcripts separated by an approximately 165kb genomic region that contains SLC6A3 and CLPTM1L on the reverse strand of chromosome 5. Both ETTs with putative LPCAT1-TERT fusions were predicted to produce multiple splice variants with one transcript in each case predicted to produce an intact protein product on the basis of a preserved reading frame (Figs 2 and 3).

Table 2

Junction exon combinations, genomic coordinates, reading frame status and supporting read counts for LPCAT1-TERT fusions identified in two epithelioid trophoblastic tumors by RNA-Seq.

Case	Coordinates (hg19)	Exon Numbers (LPCAT1-TERT)	Reading Frame Preserved?	Total # Supporting Reads
ETT-1	Chr5:1501576–1282739	Exon 2 –Exon 3	No	71
	Chr5:1501576–1294781	Exon 2 –Exon 2	No	69
	Chr5:1494815–1282739	Exon 3 –Exon 3	Yes	136
	Chr5:1494815–1294781	Exon 3 –Exon 2	No	380
	Chr5:1494811–1282739	Intron 3 –Exon 3	No	304
ETT-2	Chr5:1523825–1294781	Exon 1 –Exon 2	Yes	303
	Chr5:1523825–1282739	Exon 1 –Exon 3	No	227

Fig 2

LPCAT1-TERT fusion transcripts identified in two epithelioid trophoblastic tumors.

A) The genomic location of LPCAT1 and TERT on chromosome 5 are displayed. Both genes are colinear and are transcribed from the reverse genomic strand. LPCAT1 lies upstream of TERT with two intervening genes positioned between them. B) Alternative LPCAT1-TERT transcript isoforms identified in the two epithelioid trophoblastic tumor cases. Orientation has been flipped from (A) for readability. Solid lines denote exon combinations that retain reading frame and are likely to result in a translated protein product while dotted lines indicate abrogation of reading frame. Both ETT1 and ETT2 produce one transcript that is predicted to form a protein coding LPCAT1-TERT fusion transcript. Distinct exon combinations are observed between the two tumors.

Fig 3

Predicted preserved protein domains for the in-frame LPCAT1-TERT fusions in ETT-1 and ETT-2.

(A) Native LPCAT1 (upstream of TERT), and (B) TERT (downstream of LPCAT1) domains are illustrated in upper image, with the regions predicted to be lost in the fused products indicated by labeled brackets. Putative fusion proteins (C, D) are shown in the lower image. In each fusion, TERT lacks components (TEN domain and partial/whole RNA binding domain) believed critical for normal telomerase function. The LPCAT1 topological domain (TD) retained in ETT-1 and partially retained in ETT-2 is cytoplasmic in nature while the transmembrane domain retained in ETT-1 only is helical. A fragment of the larger (lumenal) LPCAT1 topological domain is retained in ETT-1 and lost in ETT-2. Regions are not drawn to scale.

LPCAT1-TERT fusions are rarely reported and non-recurrent in other cancers

LPCAT1-TERT fusions were confirmed absent from all internal and public normal and tumor tissue databases profiled (see Methods). Literature review identified only three previous reports of LPCAT1-TERT fusions, each identified in distinct neoplasms affecting neurological, liver, and lung tissue respectively [27-30] (Table 3).

Table 3

Previously reported LPCAT1-TERT fusions and presence in current cohort.

Reference	Fusion observed	Observed in current cohort?	Protein coding or non-coding	Tissue
[27] Manuscript body	LPCAT1 exon 11 upstream of TERT exon 2	No	Coding	Meningioma
[28] S5 Table	LPCAT1 exon 1 upstream of TERT exon 2	Yes (ETT-2)	Coding	Lung adenocarcinoma
[29] Conference abstract only	Unspecified LPCAT1-TERT fusion	Unknown	Coding	Hepatocellular carcinoma
[30] Database compiled from multiple sources.	LPCAT exon 1 upstream of TERT exon 3	Yes (ETT-2)	Non-coding	Lung adenocarcinoma

Copy-number changes underlie LPCAT1-TERT fusions and TERT upregulation in ETT

Whole genome DNA copy number array analysis was performed for all samples to determine the possibility of a genomic deletion affecting the region between the fused exons due to LPCAT1’s genomic positioning upstream of TERT. ETT-1 demonstrated three to four copy number gain of chromosome 5 but also showed reduced probe intensities consistent with low-level loss corresponding to 3’ LPCAT1, 5’ TERT, and all intervening genes. These findings were classified as supportive of an approximately 200kb genomic deletion. ETT-2 also appeared to have a three to four copy number gain of chromosome 5 as well as reduced probe intensities supportive of a two-copy genomic deletion underlying the formation of the LPCAT1-TERT fusion. Collectively these results support genomic deletions underlying the formation of the LPCAT1-TERT fusions and while the array-based copy number analysis lacks the resolution to determine precise genomic breakpoints, the formation of multiple splice forms of the fusion transcript and their joining at precise exon boundaries are indicative of intronic breakpoints. ETT-3 and all other samples were classified as negative for genomic deletions affecting LPCAT1 or TERT, however ETT-3 was classified as demonstrating single copy number gain of chromosome 5 including TERT and LPCAT1. PSN-3 could not be assessed due to sample quality issues. ETT-1 and ETT-2 each demonstrated copy number gain of chromosomes 2, 3, 9 and 20, with loss of chromosome 11. ETT-3 showed gain of chromosomes 5, 9 and 20 in common with the other two ETTs. All non-ETT cases were categorized as normal in terms of gross copy number (S1–S8 Figs).

TERT expression levels are elevated in ETT compared to other GTDs and normal tissue

LPCAT1 and TERT expression levels for all GTD cases are provided in Table 4. TERT gene expression levels were universally elevated in ETT when compared to other GTDs and normal tissues. The mean normalized count was 7219.28 in ETT, 24.167 in PSN, 8.332 in PSTT and 17.83 in PSTT plus PSN. LPCAT1 gene expression levels in our cohort appeared elevated in ETT-2 and ETT-3 but low in ETT-1 relative to the other GTDs. Previously reported TERT expression levels (S9 Fig) in normal uterine (n = 142) and ovarian tissue (n = 180) as recorded by the GTEx initiative [26] were negligible (median 0.0 TPM). TERT promoter analysis was conducted for all samples to determine if alternative, established mechanisms of TERT activation might be present in any other case of GTD. All samples tested negative for known activating or novel TERT promoter mutations.

Table 4

LPCAT and TERT expression levels (DESeq2 normalized counts) for all GTD cases.

Case	LPCAT Expression	TERT Expression
ETT1	6284.8	4523.2
ETT2	16478	16648
ETT3	15874	486.64
PSN1	2410.7	4.5032
PSN2	2173.8	62.397
PSN3	3465.5	5.5998
APSN1	NA	NA
PSTT1	2307.6	16.661
PSTT2	5697.2	0

LPCAT1-TERT fusion is an early event in metastatic ETT-1

The LPCAT1-TERT fusion event initially detected in case ETT-1 was identified in a liver metastasis that was resected three years after initial diagnosis and treatment of ETT (Table 1). Following detection of the fusion in the metastatic tumor, the primary tumor was tested for the presence of the in-frame fusion transcript. RT-qPCR and Sanger sequencing verified that the primary tumor sample carried an LPCAT1-TERT fusion identical to that originally identified in the metastatic tissue, while adjacent normal tissue showed no evidence of the fusion (Fig 4).

Fig 4

Confirmed expression of LCPAT1-TERT fusion transcript in ETT-1 primary tumor and absence from adjacent normal tissue.

A) Real-time PCR quantification of the fusion in normal and tumor tissues in adjacent normal and primary tumor tissue utilizing an 18S RNA control. B) Gel electrophoresis of the PCR product from the tumor tissue. C) Sanger sequencing result for the PCR product produces a chimeric LPCAT1-TERT transcript. The originally tested sample for case ETT-1 was a liver metastasis occurring at relapse 3 years post-surgery and treatment. Confirmation of the fusion transcript in the primary tumor indicates that LPCAT1-TERT formation was an early event in the disease pathogenesis.

LPCAT1-TERT fusion protein positively modulates cell growth and localizes predominantly in the nucleus

To define the functionality of this in-frame fusion, 293T cells were selected as a surrogate cell-line and transfected with pcDNA control vector or pcDNA-LPCAT1-TERT-Flag, and cell viability was determined after 72 hours by the fluorimetric indicator dye resazurin. The pcDNA-LPCAT1-TERT-Flag cells showed a significant increase in viability compared to the pcDNA control measured by the metabolic capacity (Fig 5A). Expression of LPCAT1-TERT fusion protein was confirmed by Western Blot using 293T cells transfected with pcDNA control vector or pcDNA-LPCAT1-TERT-Flag and anti-flag antibody or anti-tubulin as control (Fig 5B). As expected, TERT and LPCAT1 were mostly localized in the nucleus and cytosol, respectfully. TERT-LPCAT1 fusion localization was mostly observed in nucleus with some localizing in the cytosol (S10 Fig).

Fig 5

LPCAT1-TERT fusions positively regulate cell growth.

A) Cell viability measured at 0 and 72 hours utilizing fluorimetric indicator dye resazurin. Increased metabolic capacity of pcDNA-LPCAT1-TERT-Flag cells demonstrate increased viability (sample size = 5). B) Western Blot confirms expression of LPCAT1-TERT fusion protein in 293T cells using 293T cells transfected with pcDNA control vector or pcDNA-LPCAT1-TERT-Flag and anti-flag antibody or anti-tubulin as control (PC = pcDNA control vector).

Discussion

We have described the first instance of reoccurring genomic events in ETT and demonstrated positive regulatory effects on cell growth in a surrogate cell-line. The discovery of an LPCAT1-TERT fusion transcript in ETT marks the first report of protein-coding LPCAT1-TERT fusion recurrence in any tumor type, with only four prior published reports of similar fusions occurring sporadically in other neoplasms [27-30]. Fusion events involving alternative gene partners fused with either LPCAT1 or TERT are also rare, evidenced by the presence of only three LPCAT1 and twenty-four TERT fusions in a public database of samples from The Cancer Genome Atlas [25], further underscoring the novelty of this discovery in a rarely observed neoplasm.

Exons 1–3 of LPCAT1 encode two topological domains (a full cytoplasmic domain and a partial lumenal domain) and one helical transmembrane domain. It is uncertain whether these bestow unique function on the fusion, beyond the increased transcriptional activity of the downstream TERT exons under promoter control of the ubiquitously expressed LPCAT1. However, the observance of some cytosolic localization of the fusion protein product may be the result of the retained cytoplasmic topological domain. The TERT protein normally possesses 4 domains believed critical for telomerase function, comprising the Ten domain, RNA-binding domain, reverse-transcriptase domain, and C-terminal domain [31]. The Ten domain is encoded by exon 1 while exons 2 and 3 encode the RNA binding domain. Thus, the protein-coding fusions detected in both ETT-1 and ETT-2 will exhibit ablation of the Ten domain, while ETT-1 will also partially lack the RNA-binding domain, indicating that the growth modulating functions likely occur independently of telomerase function. Ideally future studies could be expanded to include trophoblast-specific cell lines, in order to further clarify the precise biological role of LPCAT1-TERT fusions in trophoblastic tissue. For instance, a TRAP assay might be utilized in the presence and absence of LPCAT1-TERT to experimentally validate the absence of telomerase activity. Whether predisposing genomic factors underlie the genomic deletions that create LPCAT1-TERT fusions remains unknown and represents another avenue of future research.

Non-telomerase-based oncogenic functions of TERT are widely supported. While its oncogenicity is most commonly attributed to cellular immortalization through telomerase-driven telomere extension, multiple alternative mechanisms of action have been established [32, 33]. Perhaps most remarkably, one previous study demonstrated that alternatively spliced TERT transcripts affected by a ten-exon deletion retained the ability to stimulate cell proliferation through activation of Wnt signaling [34]. Irrespective of precise function, the fusing of LPCAT1 and TERT is expected to bring the fused TERT exons under the transcriptional control of the more ubiquitously utilized LPCAT1 promoter and is considered TERT activating. It is possible that the LPCAT1 overexpression in ETT-2 and ETT-3 might play a distinct role in pathogenesis, while wild-type TERT expression likely also plays a part since copy number gain and increased transcription were observed in all ETTs regardless of the fusion’s presence. However, the precise interplay of factors is difficult to unravel without further study.

TERT fusions have previously been suggested to represent a rare mechanism of TERT activation in cancer [18]. However, the most frequently reported means of TERT upregulation is promoter mutation in the form of activating single nucleotide variants [35]. No evidence of TERT promoter mutations was identified in any of the GTDs tested in our study. This fact, together with the elevated expression of TERT in ETT compared to a near-complete absence of expression in the other GTDs, suggests both that TERT activation may be unique to ETT versus the other tested forms of GTD, and that gene fusion may represent a common means of activation. Telomerase activity has previously been reported in choriocarcinoma and in hydatidiform moles where it has been associated with persistent or metastatic disease [36-40], but to our knowledge, no study has assessed its activity in ETT, PSN or PSTT, nor demonstrated underlying genomic alterations. It is possible that TERT upregulation might be an early event in ETT and that LPCAT1-TERT fusion might represent a later event capable of driving disease aggressiveness as has been observed for alternative TERT promoting events in tumor types [41] where an LPCAT1-TERT fusion has been reported [27]. Based on current evidence and limited clinical information, however, it is not possible to make specific conclusions about the sequential timing of LPCAT1-TERT fusions or their exact role in disease presentation or progression. Only partial information regarding disease presentation and prior pregnancy status were available. While case ETT-1 was known to have given normal birth to an only child 18 years prior to primary tumor diagnosis and had no clinically recorded history of molar pregnancy, clinical information available for ETT-2 made no mention of normal or molar pregnancies, and no prior information regarding ETT-3 was available. Furthermore, while case ETT-1 was known to suffer recurrence of disease, nothing is known of the other two cases as both were clinical consult cases which were unfortunately lost to clinical follow-up.

The chance recurrence of protein coding LPCAT1-TERT fusions in two of three tested ETTs is improbable—an assertion supported by the existence of no more than a single prior report of a similar fusion within approximately ten thousand Cancer Genome Atlas samples [30] and only three previous reports throughout the published literature [27-29]. Beyond recurrence, the early emergence of the fusion in the tested primary tumor and its demonstrated growth promoting effects support a potentially important role in the oncogenic processes of ETT. With further research, we believe it is likely that LPCAT1-TERT fusions will be identified in further ETTs. If this is indeed proven, then the likelihood of clinical utility will increase.

The discovery of copy number-driven TERT upregulation and LPCAT1-TERT fusions in ETT indicates potential diagnostic or prognostic relevance for a disease lacking unambiguous markers. While morphologic examination or immunohistochemical profiling often allow pathologists to accurately diagnose gestational trophoblastic neoplasms, screening of GTD samples for TERT expression or the presence of the LPCAT1-TERT fusions (either RNA or protein) may offer greater diagnostic certainty in differentiating ETT from histologically similar lesions, especially when immunohistochemical markers overlap. In this study, aneuploidy was a characteristic uniquely observed in ETT, with several shared whole chromosomal gains and losses amongst the three cases. This in itself may offer diagnostic or prognostic utility, however prior studies have been lacking and contradictory [42-44]. The LPCAT1-TERT fusion might provide prognostic indications if demonstrated to be restricted to aggressive or recurrent forms of the disease. Our findings in ETT also raise the prospect of novel treatment modalities. Increasingly TERT is being targeted by traditional and nascent antineoplastic approaches [45], and some or all of these might represent therapeutic possibilities, since the LPCAT1-TERT fusion has been shown to be growth promoting. While the unique nature of the fusion might render it untargetable with existing treatments, its protein coding nature raises the possibility of susceptibility to novel therapeutic agents. Novel neo-antigens produced by aberrant proteins in cancerous cells are increasingly being targeted by modern immunotherapy-based initiatives [46] and could offer an area of future research in fusion-expressing ETTs. However, the precise nature and extent of the effects of targeting the fusion in ETT cells remains to be explored.

While this manuscript was being finalized, a separate study applying RNA-Seq to ten cases of GTD was published [47]. While this new study reported a pathogenic PIK3CA mutation in one case of ETT, and inferred activation of the PIK3CA pathway based on transcriptome-wide differential expression analysis, no recurrent genomic events were reported in four ETTs or six other cases of GTD, despite fusion transcript analysis being performed. What the findings of that study indicate in unison with our own remains uncertain. No PIK3CA mutations were identified by inspection of raw RNA data for the three ETT cases included in our study, and transcriptome-wide differential expression analysis was not performed due to the difficulty in producing reliable global expression comparisons between heavily degraded samples with variable processing times and conditions. Fusion transcript detection is often hindered by fusion calling algorithms’ default filter settings as we have previously described [48]. Indeed, the LPCAT1-TERT fusion described in this study was initially removed by TopHat Fusion’s default filtering settings and was only discovered by manual analysis of filtered results, necessitating the custom approach described in our Methods. Unfortunately, the data of Cho et al. are not publicly available to enable our reanalysis.

Both sample availability and quality pose significant obstacles to research of GTDs and in particular ETTs. This study increases the published number of ETTs by two, since case ETT-2 was previously published as a case report [49]. The total number of ETTs described in the literature likely now approaches only 140 cases since their first description in 1998, and the number of samples in our study matches or exceeds that of previous molecular studies involving GTD [42–44, 47], indicative of their rarity. In total, we sourced seven cases of ETT, but unfortunately four were degraded to the extent that neither sequencing nor copy number analysis were possible. While testing was possible for the remaining three cases, samples were exhausted by the molecular profiling described, meaning that further molecular characterization of these samples is not possible, despite further study being of potential value. While disease rarity cannot be overcome, the issues of sample quality and quantity can theoretically be addressed. Procurement of fresh-frozen rather than FFPE samples, for example, offers a means of circumventing such issues. However, it is logistically difficult due to established clinical practices.

In conclusion, we have identified LPCAT1-TERT fusion transcripts and copy number-driven TERT upregulation as characteristics of ETTs that appear to be absent from PSNs and PSTTs. These findings have potential diagnostic, prognostic and therapeutic relevance, the extent of which we hope will be elucidated through further studies. Sample quality and rarity pose challenges to expanded testing, however awareness of the findings described here should enable rapid and targeted testing of new ETT candidates and add valuable knowledge to our clinical and biological characterization of ETTs, and GTD in general.

Chromosomal microarray performed on DNA extracted from FFPE tissue using the OncoScan CNV Plus assay for ETT-1.

ETT-1 demonstrated gain of chromosome 5 but also showed reduced probe intensities consistent with low-level loss corresponding to 3`LPCAT1, 5`TERT, and all intervening genes.

(PPTX)

Click here for additional data file.

Chromosomal microarray performed on DNA extracted from FFPE tissue using the OncoScan CNV Plus assay for ETT-2.

ETT-2 appeared to have gain of chromosome 5 as well as reduced probe intensities supportive of a two-copy genomic deletion underlying the LPCAT1-TERT fusion.

(PPTX)

Click here for additional data file.

Chromosomal microarray performed on DNA extracted from FFPE tissue using the OncoScan CNV Plus assay for ETT-3.

ETT-3 was classified as negative for genomic deletions affecting LPCAT1 or TERT, but demonstrated copy number gain of chromosome 5.

(PPTX)

Click here for additional data file.

Chromosomal microarray performed on DNA extracted from FFPE tissue using the OncoScan CNV Plus assay for PSN-1.

PSN-1 was classified as negative for copy number alterations and genomic deletions affecting LPCAT1 or TERT.

(PPTX)

Click here for additional data file.

Chromosomal microarray performed on DNA extracted from FFPE tissue using the OncoScan CNV Plus assay for PSN-2.

PSN-2 was classified as negative for copy number alterations and genomic deletions affecting LPCAT1 or TERT.

(PPTX)

Click here for additional data file.

Chromosomal microarray performed on DNA extracted from FFPE tissue using the OncoScan CNV Plus assay for PSN-3.

PSN-3 could not be assessed due to sample quality issues.

(PPTX)

Click here for additional data file.

Chromosomal microarray performed on DNA extracted from FFPE tissue using the OncoScan CNV Plus assay for PSTT-1.

PSTT-1 was classified as negative for copy number alterations and genomic deletions affecting LPCAT1 or TERT.

(PPTX)

Click here for additional data file.

Chromosomal microarray performed on DNA extracted from FFPE tissue using the OncoScan CNV Plus assay for PSTT-2.

PSTT-2 was classified as negative for copy number alterations and genomic deletions affecting LPCAT1 or TERT.

(PPTX)

Click here for additional data file.

Expression of TERT in normal tissues in GTEx Release 8.

Ovarian and Uterine tissues are marked with a red asterisk (Median TPM of 0.0).

(PPTX)

Click here for additional data file.

Representative localization Immunohistochemistry images of HEK293 cells expressing empty vector, TERT, LPCAT1, TERT-LPCAT1-fusion with a C-term 3xFlag. Anti-Flag (green), DAPI (blue).

TERT-LPCAT1 fusion is observed to localize mainly in the nucleus with some cytosolic localization (sample size = 2).

(PPTX)

Click here for additional data file.

(PDF)

Click here for additional data file.

(DOCX)

Click here for additional data file.

10 Feb 2021

PONE-D-20-36897

LPCAT1-TERT Fusions Are Uniquely Recurrent in Epithelioid Trophoblastic Tumors and Positively Regulate Cell Growth

PLOS ONE

Dear Dr. Oliver,

Thank you for submitting your manuscript to PLOS ONE. I am very sorry for the delay in reaching a decision on your manuscript entitled “LPCAT1-TERT Fusions Are Uniquely Recurrent in Epithelioid Trophoblastic Tumors and Positively Regulate Cell Growth" due in part to difficulty in securing reviewers with appropriate expertise to comment upon all aspects of your work in a reasonable time. We have now received reports from 3 reviewers and, after careful consideration, we have decided to invite a minor revision of the manuscript.

After careful consideration, we feel that it has merit but does not fully meet PLOS ONE’s publication criteria as it currently stands. Therefore, we invite you to submit a revised version of the manuscript that addresses the points raised during the review process.

Please submit your revised manuscript by Mar 27 2021 11:59PM. If you will need more time than this to complete your revisions, please reply to this message or contact the journal office at plosone@plos.org. When you're ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file.

Please include the following items when submitting your revised manuscript:

A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). You should upload this letter as a separate file labeled 'Response to Reviewers'.

A marked-up copy of your manuscript that highlights changes made to the original version. You should upload this as a separate file labeled 'Revised Manuscript with Track Changes'.

An unmarked version of your revised paper without tracked changes. You should upload this as a separate file labeled 'Manuscript'.

If you would like to make changes to your financial disclosure, please include your updated statement in your cover letter. Guidelines for resubmitting your figure files are available below the reviewer comments at the end of this letter.

If applicable, we recommend that you deposit your laboratory protocols in protocols.io to enhance the reproducibility of your results. Protocols.io assigns your protocol its own identifier (DOI) so that it can be cited independently in the future. For instructions see: http://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocols

We look forward to receiving your revised manuscript.

Kind regards,

Bruno Bernardes de Jesus

Academic Editor

PLOS ONE

Journal Requirements:

When submitting your revision, we need you to address these additional requirements.

1. Please ensure that your manuscript meets PLOS ONE's style requirements, including those for file naming. The PLOS ONE style templates can be found at

https://journals.plos.org/plosone/s/file?id=wjVg/PLOSOne_formatting_sample_main_body.pdf and

https://journals.plos.org/plosone/s/file?id=ba62/PLOSOne_formatting_sample_title_authors_affiliations.pdf

2.Please provide additional details regarding participant consent. In the ethics statement in the Methods and online submission information, please ensure that you have specified (1) whether consent was informed and (2) what type you obtained (for instance, written or verbal, and if verbal, how it was documented and witnessed). If your study included minors, state whether you obtained consent from parents or guardians. If the need for consent was waived by the ethics committee, please include this information.

If you are reporting a retrospective study of medical records or archived samples, please ensure that you have discussed whether all data were fully anonymized before you accessed them and/or whether the IRB or ethics committee waived the requirement for informed consent. If patients provided informed written consent to have data from their medical records used in research, please include this information.

3.Thank you for including the following ethics statement on the submission details page:

'The study was reviewed and approved by the Mayo Clinic Institutional Review Board.'

Please also include this information in the ethics statement in the Methods section of your manuscript.

4.PLOS ONE now requires that authors provide the original uncropped and unadjusted images underlying all blot or gel results reported in a submission’s figures or Supporting Information files. This policy and the journal’s other requirements for blot/gel reporting and figure preparation are described in detail at https://journals.plos.org/plosone/s/figures#loc-blot-and-gel-reporting-requirements and https://journals.plos.org/plosone/s/figures#loc-preparing-figures-from-image-files. When you submit your revised manuscript, please ensure that your figures adhere fully to these guidelines and provide the original underlying images for all blot or gel data reported in your submission. See the following link for instructions on providing the original image data: https://journals.plos.org/plosone/s/figures#loc-original-images-for-blots-and-gels.

In your cover letter, please note whether your blot/gel image data are in Supporting Information or posted at a public data repository, provide the repository URL if relevant, and provide specific details as to which raw blot/gel images, if any, are not available. Email us at plosone@plos.org if you have any questions.

5.Thank you for stating the following in the Acknowledgments Section of your manuscript:

"The Genotype-Tissue Expression (GTEx) Project was supported by the Common Fund of the Office of the Director of the National Institutes of Health, and by NCI, NHGRI, NHLBI, NIDA, NIMH, and NINDS."

We note that you have provided funding information that is not currently declared in your Funding Statement. However, funding information should not appear in the Acknowledgments section or other areas of your manuscript. We will only publish funding information present in the Funding Statement section of the online submission form.

Please remove any funding-related text from the manuscript and let us know how you would like to update your Funding Statement. Currently, your Funding Statement reads as follows:

"The author(s) received no specific funding for this work."

Please include your amended statements within your cover letter; we will change the online submission form on your behalf.

[Note: HTML markup is below. Please do not edit.]

Reviewers' comments:

Reviewer's Responses to Questions

Comments to the Author

1. Is the manuscript technically sound, and do the data support the conclusions?

The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented.

Reviewer #1: Partly

Reviewer #2: Yes

Reviewer #3: Yes

**********

2. Has the statistical analysis been performed appropriately and rigorously?

Reviewer #1: Yes

Reviewer #2: N/A

Reviewer #3: Yes

**********

3. Have the authors made all data underlying the findings in their manuscript fully available?

The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified.

Reviewer #1: No

Reviewer #2: Yes

Reviewer #3: Yes

**********

4. Is the manuscript presented in an intelligible fashion and written in standard English?

PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here.

Reviewer #1: Yes

Reviewer #2: Yes

Reviewer #3: Yes

**********

5. Review Comments to the Author

Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters)

Reviewer #1: Thank you for an interesting manuscript. I have a few major and minor points that I believe need to be addressed prior to publication. I would firstly kindly request the authors to publish all sequencing and microarray data on a public site such as Sequence Read Archive or European Nucleotide Archive with data release following successful publication of the manuscript. Please include the SRA/ENA identifier in the manuscript in a section dedicated to data availability.

My other point is around the "so what" of the article. The authors report two cases of LPCAT1-TERT fusions in a rare cancer type. While it is certainly interesting that a recurring alteration can be identified, the authors admit that no other group, even in the same tumour type, has identified this fusion. Therefore what would line of sight for, say, clinical development look like? Is there a population or are these two cases one-off? Please discuss in the article.

If one were to design compounds against the fusion protein, looking at Cansar https://cansarblack.icr.ac.uk/target/Q8NF37/synopsis/ligandability there doesn't seem to be any evidence for ligandability for LPCAT1. At the same time, the Cancer Dependency Map illustrates that LPCAT1 isn't essential in almost any cell line (https://dmc.depmap.org/portal/gene/LPCAT1?tab=overview) so as a target it might have few toxicity issues in normal tissues. Would the authors suggest targeting TERT instead? I didn't fully get it from the article but have you shown that knocking down or out the fusion protein is lethal for the cells, such that this is not just a passenger event?

Bullet point list of other points

- Regarding presence of this fusion in other data sets, see https://fusionhub.persistent.co.in/out/global/Individual/LPCAT1--TERT.html indicating one in a TCGA LUAD sample (out-of-frame)

- Are these fusions intronic at the DNA level? Whole genome or targeted DNA sequencing of the two genes including intronic tiling should reveal real breakpoints far better than RNA-seq and if this fusion indeed results from a deletion (or, say, tandem duplication).

- Table 4, while the effect size difference is quite considerable, RPKM mustn't be used to compare across samples. Use DESeq2 or similar on counts to normalise data prior to comparisons instead or discuss why DESeq2 cannot be used in this case.

- Figure 2 What does the fusion look like for domains that remain from both partners? Is LPCAT1 replacing some kind of a regulating mechanism of TERT? A genome browser such as https://lifescience.opensource.epam.com/ngb/index.html visualises fusion junctions and which domains remain. Please include the domains and discussion about their significance.

- "Unfortunately, the data of Cho et al. are not publicly available to enable our reanalysis, and attempts to contact the authors have been unsuccessful." Could you please remove the passive aggressive tone; please merely state that the data is not available for reanalysis.

- Using the unfiltered bioinformatics approach risks false positives. Did you apply the same unfiltered approach to unrelated samples to see a base level of false positives to rule out chance finding?

I hope you find these comments useful for your work.

Reviewer #2: Epithelioid trophoblastic tumor (ETT), a rare form of gestational trophoblastic disease (GTD), shows high risk of metastasis at the time of diagnosis and corresponding mortality. Through the profiling of nine cases of GTD comprising ETT, PSTT and PSN, Lysophosphatidylcholine acyltransferase (LPCAT1), LPCAT1-TERT fusion transcripts were identified that appear to uniquely reoccur in ETT and are caused by genomic deletions.

LPCAT1-TERT fusion expression was validated by RT-qPCR.

DNA mutation analysis of TERT promoter region was conducted for all samples.

Copy number gains of chromosome 5 were shown to accompany TERT upregulation in ETT, even in the absence of LPCAT1-TERT fusion.

1. As indicated by the authors, LPCAT1-TERT fusion and TERT promoter mutations have been previously found in rare instances in meningiomas by Juratli et al. (Oncotarget 8, 109228-109237, 2017), hepatocellular carcinoma by Haines et al. (Cancer Research abstract A33, 2016), and lung adenocarcinomas (CHIMERSEQ).

However, this is the first report on occurrence in ETT. Further interest is provided by its early occurrence in primary tumor and persistence in metastatic tissue.

2. LPCAT1-TERT fusion proteins were shown to promote cell growth, but the mechanism was indicated most likely unrelated to telomere extension. However, wild-type TERT expression was suggested to play a part since copy number gain and increased transcription were observed in all ETTs regardless of the fusion’s presence. TERTp mutations are among the most common recurrent alterations in human cancer. However, no evidence of TERT promoter mutations was identified in any of the GTDs tested.

Hence, further study is needed to solve this issue. However, this article provides relevant guidance.

Minor issue

This reviewer fully understands the ‘defensive nature’ of some of the comments by the authors in the Discussion, e.g. the lack of reply by colleagues working in the field. However, this is unnecessary in a final text. The limitations of the study (sample number, rarity of the disease, limited understanding of its patho-physiology) should be summarized as such in one paragraph.

Reviewer #3: The paper is very interesting, and the work quite well done. There are only a few minor aspects to address to facilitate readers comprehension of the text and one experiment proposed that would help understand the role of the LPCAT1-TERT construct.

[NOTE: If reviewer comments were submitted as an attachment file, they will be attached to this email and accessible via the submission site. Please log into your account, locate the manuscript record, and check for the action link "View Attachments". If this link does not appear, there are no attachment files.]

While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com/. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Registration is free. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email PLOS at figures@plos.org. Please note that Supporting Information files do not need this step.

Submitted filename: PONE-D-20-36897.docx

Click here for additional data file.

26 Mar 2021

Dear Editor and Reviewers,

We would like to express our gratitude to all involved for their thoughtful and diligent review of our manuscript entitled “LPCAT1-TERT Fusions Are Uniquely Recurrent in Epithelioid Trophoblastic Tumors and Positively Regulate Cell Growth”. We are grateful for your decision to accept the manuscript for publication in PLOS ONE pending minor revisions and clarifications. Below we address each of the several points raised specifically by the reviewers and editor. Note that provided line numbers refer to the version of the revised manuscript with tracked changes.

Editor’s comments:

1. Please ensure that your manuscript meets PLOS ONE's style requirements, including those for file naming.

We have reviewed the style requirements and have made changes as appropriate i.e.

- Corrected capitalization in manuscript title and section headers

- Corrected figure headers i.e. Fig 1 vs Figure 1

- Removed underscores from figure file names

- Removed funding information from Acknowledgements

- Corrected format of author affiliations

- Corrected format of corresponding author listing

2. Please provide additional details regarding participant consent.

Additional details have been provided within an ethics statement in the Methods section, and in the online submission.

3. Thank you for including the following ethics statement on the submission details page:

'The study was reviewed and approved by the Mayo Clinic Institutional Review Board.' Please also include this information in the ethics statement in the Methods section of your manuscript.

This has been completed, as explained above.

4. PLOS ONE now requires that authors provide the original uncropped and unadjusted images underlying all blot or gel results reported in a submission’s figures or Supporting Information files.

The original, uncropped and unadjusted images have been provided in file S1_raw_images.pdf and this has been detailed in the cover letter.

5. Please remove any funding-related text from the manuscript and let us know how you would like to update your Funding Statement. Currently, your Funding Statement reads as follows: "The author(s) received no specific funding for this work." Please include your amended statements within your cover letter; we will change the online submission form on your behalf.

We have provided a new funding statement for publication and have removed any reference to funding from the manuscript. “We wish to acknowledge Mayo Clinic Center for Individualized Medicine and the Department of Laboratory Medicine and Pathology for supporting this study. GTEx data used for the analyses described in this manuscript were obtained from dbGaP accession number phs000424.v7.p2. The Genotype-Tissue Expression (GTEx) Project was supported by the Common Fund of the Office of the Director of the National Institutes of Health, and by NCI, NHGRI, NHLBI, NIDA, NIMH, and NINDS.”

Reviewer 1:

1. I would firstly kindly request the authors to publish all sequencing and microarray data on a public site such as Sequence Read Archive or European Nucleotide Archive with data release following successful publication of the manuscript. Please include the SRA/ENA identifier in the manuscript in a section dedicated to data availability.

Copy number array data have been deposited in ArrayExpress with accession E-MTAB-10303 while sequencing data have been deposited under accession E-MTAB-10321. Data will be published upon successful publication of our manuscript. We have detailed this in the Additional Information section of the submission form, as required by PLOS One.

2. The authors report two cases of LPCAT1-TERT fusions in a rare cancer type. While it is certainly interesting that a recurring alteration can be identified, the authors admit that no other group, even in the same tumour type, has identified this fusion. Therefore what would line of sight for, say, clinical development look like? Is there a population or are these two cases one-off? Please discuss in the article.

We thank the reviewer for raising this very relevant issue. While the findings of this study alone are insufficient to conclude certain clinical benefits, the discovery of LPCAT1-TERT fusions in two out of three tested ETT samples, and its absence from other GTDs and other tumors in general is unlikely to occur by chance. If we consider that only one LPCAT1-TERT fusion is known to have been identified through multiple analyses of approximately 10,000 TCGA samples, as compared to 2 of 3 of our tested ETTs, the observed enrichment corresponds to an odds ratio of 5407 and a Fisher’s p-value of 5.992 x10-7. Given further samples and available testable material, we believe it is likely that similar fusions could be identified in further ETTs. It is also possible that retesting of the scarce, published ETT RNA-Seq could yield positive findings since fusion detection is highly sensitive to differing filtering strategies. If further LPCAT1-TERT fusions are indeed identified ETTs, the opportunity to further explore diagnostic or therapeutic options grows. Unfortunately, we are currently unable to prove these theories conclusively, but we hope our findings will empower future researchers to pursue them successfully. We have included new text to this effect in the Discussion at lines 377 onwards.

3. If one were to design compounds against the fusion protein, looking at Cansar there doesn't seem to be any evidence for ligandability for LPCAT1. At the same time, the Cancer Dependency Map illustrates that LPCAT1 isn't essential in almost any cell line so as a target it might have few toxicity issues in normal tissues. Would the authors suggest targeting TERT instead? I didn't fully get it from the article but have you shown that knocking down or out the fusion protein is lethal for the cells, such that this is not just a passenger event?

Thanks to the reviewer for raising well-considered points. Further research is required to determine if a knockdown of the fusion would negatively impact cell proliferation or be lethal to ETT cells, however multiple factors (recurrence, emergence in primary tumor and demonstrated growth-promoting effects) provide strong indication that the fusion is more than a passenger event (we have added language to this effect at line 377 onward) and targeting of the fusion from therapeutic standpoint would represent a viable research avenue in the event of further confirmation of the fusion’s recurrence and functional relevance. We raise the prospect of treatment options, largely pertaining to targeting of TERT or the fusion itself at line 393 onwards but further work will be required to explore the possibility of such approaches and we have added clarifying language to this effect at line 397 onward.

4. Regarding presence of this fusion in other data sets, see https://fusionhub.persistent.co.in/out/global/Individual/LPCAT1--TERT.html indicating one in a TCGA LUAD sample (out-of-frame)

We thank the reviewer for providing this example. We have confirmed the identification of a non-coding LPCAT1-TERT fusion in TCGA data and have included a suitable reference in Table 3 and made minor edits to the main text where required. We have furthermore updated Table 3 to include the tissue of origin and coding status of previously identified LPCAT1-TERT fusions. We hope that these edits address the reviewer’s comment adequately.

5. Are these fusions intronic at the DNA level? Whole genome or targeted DNA sequencing of the two genes including intronic tiling should reveal real breakpoints far better than RNA-seq and if this fusion indeed results from a deletion (or, say, tandem duplication).

We thank the reviewer for this question and commentary. The Oncoscan array-based copy number analysis included in the manuscript indicates that the cause of the fusion is indeed genomic deletion. Unfortunately, the array probe density is not sufficient to identify precise breakpoints however the fact that we see multiple splice variants of the RNA fusions is strongly indicative of intronic breakpoints and subsequent splicing. We have added language to the Results section of the manuscript (line 259 onward) to highlight this. While an alternative genomic methodology could offer the ability to identify breakpoints with higher resolution, this is currently not possible in the context of this study due to the exhaustion of genetic material.

6. Table 4, while the effect size difference is quite considerable, RPKM mustn't be used to compare across samples. Use DESeq2 or similar on counts to normalise data prior to comparisons instead or discuss why DESeq2 cannot be used in this case.

We thank the reviewer for their insight. We have subsequently removed RPKM-based expression from the manuscript and have recalculated expression levels for LPCAT1 and TERT utilizing DESeq2 and its median of ratios approach. We have added language in the Methods to describe this and have updated Table 4 and the Results section (line 272 onward) as well as adding an appropriate reference. We hope that these amendments address the reviewer’s concerns.

7. Figure 2 What does the fusion look like for domains that remain from both partners? Is LPCAT1 replacing some kind of a regulating mechanism of TERT? Please include the domains and discussion about their significance.

We thank the reviewer for highlighting an important aspect of the paper. The domains and promoter effects are included in the Discussion section (line 331 onward), and we have added to this as well as creating a new figure and legend specifically dedicated to the predicted domains involved in the fusion proteins (Fig 3). We opted for a custom-drawn figure to ensure we optimally represent each fusion based on what information is available in databases like as well as the published literature. We hope that these collectively address the reviewer’s concerns.

8. "Unfortunately, the data of Cho et al. are not publicly available to enable our reanalysis, and attempts to contact the authors have been unsuccessful." Could you please remove the passive aggressive tone; please merely state that the data is not available for reanalysis.

We have edited the text as suggested by the reviewer to ensure it is not interpreted as passive-aggressive in tone.

9. Using the unfiltered bioinformatics approach risks false positives. Did you apply the same unfiltered approach to unrelated samples to see a base level of false positives to rule out chance finding?

We thank the reviewer for outlining a very valid consideration. We routinely check against control data generated from tens of thousands of samples as outlined in the Methods. All control databases were negative for samples/reads supporting LPCAT1-TERT fusions. We have added text making this clear at line 209 of the Results.

Reviewer 2:

1. This reviewer fully understands the ‘defensive nature’ of some of the comments by the authors in the Discussion, e.g. the lack of reply by colleagues working in the field. However, this is unnecessary in a final text. The limitations of the study (sample number, rarity of the disease, limited understanding of its patho-physiology) should be summarized as such in one paragraph.

We thank the reviewer for their insight and comments. We have subsequently amended the statement regarding the data of Cho et al to state “Unfortunately, the data of Cho et al. are not publicly available to enable our reanalysis”, which we hope fully addresses the related comments and suggestions provided by Reviewer 1 and Reviewer 2. The difficulties and limitations of the study are summarized in a single paragraph and we have edited the language in order to remove a defensive tone (line 416 onward).

Reviewer 3:

1. The fusion LPCAT1-TERT is a key part of the work. These genes and their main functions should be clarified in introduction. In fact, the paragraph written in discussion (lines 270 to line 275) could perfectly fit in the “Introduction section”.

We agree fully with this statement and have moved the described paragraph to the Introduction of the manuscript at line 72 onward. Further discussion of precise domains has also been included in the Discussion at lines 331 onward.

2. Figure 1 would be much easier to understand if authors would use color arrows (or other symbols) to indicate the factors described in the figure legend 1 (i.e. nodules, expansile nests, etc.) Also, include a bar with the magnification of the image.

Thanks to the reviewer for this suggestion. Figure 1 has now been updated to outline the magnified regions of the image, which are described in the figure legend. Magnification levels have been added to the figure legend.

3. Legend of Figure 4. write what “n” indicates.

We have edited the figure legend (Fig 4 is now Fig 5) and replaced “n” with “sample size”.

4. Line 284. “Furthermore, while assessment of telomere length in the presence or absence of LPCAT1-TERT has the potential to experimentally validate the absence of telomerase activity…”. In many tumors, telomerase is activated but tumor cells have short telomeres, which are just minimally maintained so cells can continue to divide. The best evidence for telomerase activity is TRAP assay, which could be developed in a cell line which does not have telomerase activity, after LPCAT1-TERT transfection.

We than the reviewer for their insight. We have edited the corresponding part of the Discussion at lines 334 onward to include mention of the TRAP assay and we hope that our edits will adequately address this comment.

5. Since authors have the LPCAT-TERT-Flag construct, it would be interesting to know the localization cellular localization of the fusion protein, even if it were done in the 293T cells.

We thank the reviewer for their suggestion. We have subsequently conducted new experimentation to show nuclear localization of the LPCAT1-TERT fusion protein. We have included a new supplementary figure (S10 Fig) with legends and corresponding language in the Methods (line 166), Results (line 305) sections and Discussion (line 334).

6. Authors find fusions between exons 1-3 of LPCAT1 and exons 1-2 of TERT gene. Is there any reason why these genomic regions are more prone to fusions than other regions?

We are unaware of any factor predisposing these locations to breakage or joining. This is perhaps not surprising, since while the events are recurrent, they are nonetheless extremely rare and this means they are unlikely to correspond to e.g. known fragile regions or topologically associated domains for example. We have included language to this effect in the Discussion at line 345 onward and hope that we have satisfactorily addressed the reviewer’s question.

7. Figure 2. The dotted line for ETT1 non-coding fusion is not easily distinguishable from the solid line. Perhaps authors could use another color to make it more visible.

Thanks to the reviewer for this observation. We have changed the colors of the solid and dotted lines for ETT-1 in Figure 2 to aid with differentiation. We hope that this addresses the reviewer’s concerns.

8. Please, write “NA stands for not available” underneath Table 3. Alternatively, make it clear in the text (line 172): “not available (NA)”.

Thanks to the reviewer for highlighting this issue. As suggested, we have added “not available (NA)” to the main text to aid with clarity.

9. Just for clarity, in Figure 4 authors could write in the legend that Cp stands for “Crossing point” or whatever it may mean.

Thanks to the reviewer for identifying this oversight. We have included needed clarity here by adding text to the figure legend (Fig 4 is now Fig 5) to indicate that PC indicates the pcDNA control vector.

Thanks once more to all who have dedicated their time and attention to the improvement of our manuscript. We hope that we have addressed these points to the satisfaction of the reviewers and reviewing editor. If further information or clarification is required, we will be happy to promptly respond.

Best Regards,

Gavin Oliver

Submitted filename: Response to Reviewers.docx

Click here for additional data file.

8 Apr 2021

LPCAT1-TERT Fusions Are Uniquely Recurrent in Epithelioid Trophoblastic Tumors and Positively Regulate Cell Growth

PONE-D-20-36897R1

Dear Dr. Oliver,

We’re pleased to inform you that your manuscript has been judged scientifically suitable for publication and will be formally accepted for publication once it meets all outstanding technical requirements.

Within one week, you’ll receive an e-mail detailing the required amendments. When these have been addressed, you’ll receive a formal acceptance letter and your manuscript will be scheduled for publication.

An invoice for payment will follow shortly after the formal acceptance. To ensure an efficient process, please log into Editorial Manager at http://www.editorialmanager.com/pone/, click the 'Update My Information' link at the top of the page, and double check that your user information is up-to-date. If you have any billing related questions, please contact our Author Billing department directly at authorbilling@plos.org.

If your institution or institutions have a press office, please notify them about your upcoming paper to help maximize its impact. If they’ll be preparing press materials, please inform our press team as soon as possible -- no later than 48 hours after receiving the formal acceptance. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information, please contact onepress@plos.org.

Kind regards,

Bruno Bernardes de Jesus

Academic Editor

PLOS ONE

Additional Editor Comments (optional):

Reviewers' comments:

Reviewer's Responses to Questions

Comments to the Author

1. If the authors have adequately addressed your comments raised in a previous round of review and you feel that this manuscript is now acceptable for publication, you may indicate that here to bypass the “Comments to the Author” section, enter your conflict of interest statement in the “Confidential to Editor” section, and submit your "Accept" recommendation.

Reviewer #1: All comments have been addressed

Reviewer #2: All comments have been addressed

Reviewer #3: All comments have been addressed

**********

2. Is the manuscript technically sound, and do the data support the conclusions?

The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented.

Reviewer #1: Yes

Reviewer #2: Yes

Reviewer #3: Yes

**********

3. Has the statistical analysis been performed appropriately and rigorously?

Reviewer #1: Yes

Reviewer #2: Yes

Reviewer #3: Yes

**********

4. Have the authors made all data underlying the findings in their manuscript fully available?

The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified.

Reviewer #1: Yes

Reviewer #2: Yes

Reviewer #3: Yes

**********

5. Is the manuscript presented in an intelligible fashion and written in standard English?

PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here.

Reviewer #1: Yes

Reviewer #2: Yes

Reviewer #3: Yes

**********

6. Review Comments to the Author

Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters)

Reviewer #1: (No Response)

Reviewer #2: I am pleased to see that all requests have been satisfactorily addressed. The best of luck for a high impact of your article on readers.

Reviewer #3: The authors have addressed all the issues raised by this reviewer. This reviewer is fully satisfied.

Just check line 306. There are two words repeated “in the in the nucleus”

**********

7. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.

If you choose “no”, your identity will remain anonymous but your review may still be made public.

Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.

Reviewer #1: Yes: Miika Ahdesmaki

Reviewer #2: Yes: Saverio Alberti

Reviewer #3: Yes: María Elisa Varela Sanz (E. Varela in publications)

14 May 2021

PONE-D-20-36897R1

LPCAT1-TERT fusions are uniquely recurrent in epithelioid trophoblastic tumors and positively regulate cell growth

Dear Dr. Oliver:

I'm pleased to inform you that your manuscript has been deemed suitable for publication in PLOS ONE. Congratulations! Your manuscript is now with our production department.

If your institution or institutions have a press office, please let them know about your upcoming paper now to help maximize its impact. If they'll be preparing press materials, please inform our press team within the next 48 hours. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information please contact onepress@plos.org.

If we can help with anything else, please email us at plosone@plos.org.

Thank you for submitting your work to PLOS ONE and supporting open access.

Kind regards,

PLOS ONE Editorial Office Staff

on behalf of

Dr. Bruno Bernardes de Jesus

Academic Editor

PLOS ONE