Literature DB >> 33896973

Telomere length and 8-hydroxy-2-deoxyguanosine as markers for early prediction of Alzheimer disease.

Dalia H Abou-Elela1, Rawhia H El-Edel1, Amr S Shalaby2, Mariam A Fouaad3, Ahmed A Sonbol1.   

Abstract

BACKGROUND: Becoming shorter by each cell division, telomere length (TL) is regarded as a marker of cellular aging. Relative TL (T/S) depends on the quantitation of telomere hexamer repeat copy number normalized to autosomal single-copy gene copy number. TL is influenced by several factors, including oxidative stress (OS) and inflammation. This study aimed to investigate the possible role of TL and OS as markers for Alzheimer's disease (AD).
MATERIALS AND METHODS: One hundred and eighty participants were categorized into three groups. Group 1: Included 60 patients with AD. Group II: included 60 age-matched nondemented subjects. Group III (pregeriatric group): included 60 healthy controls with their ages ranging between 30 and 60 years. TL was determined by the quantitative Real time-PCR method, plasma levels of 8-OHdG by enzyme-linked immunosorbent assay, and total antioxidant capacity (TAC) by colorimetery.
RESULTS: In comparison to the other two groups, patients with AD showed shortened TL, increased plasma 8-OHdG concentration, and decreased TAC. The sensitivity of T/S ratio to predict AD was 86.67%, whereas the specificity was 96.67%. The sensitivity of 8-OHdG to predict AD was 96.67%, whereas the specificity was 86.67%.
CONCLUSION: AD is associated with shortened TL and increased OS as manifested by decreased TAC and increased serum 8-OHdG. T/S and 8-OHdG could be used as early predictors for AD. Copyright:
© 2020 Indian Journal of Psychiatry.

Entities:  

Keywords:  Alzheimer's disease; antioxidants; telomere length

Year:  2020        PMID: 33896973      PMCID: PMC8052885          DOI: 10.4103/psychiatry.IndianJPsychiatry_783_19

Source DB:  PubMed          Journal:  Indian J Psychiatry        ISSN: 0019-5545            Impact factor:   1.759


INTRODUCTION

Alzheimer's disease (AD) is a neurodegenerative disease that is considered the most common type of dementia.[1] Accumulation of amyloid-plaques and neurofibrillary tangles in the cerebral cortex finally results in neuronal damage, which affects parts of the brain responsible for memory and other cognitive processes. Patients suffer from memory loss, impaired decision-making ability, and the inability to take care of daily life activities.[2] Human telomeres are ribonucleoprotein structures consisting of a repetitive DNA sequence (TTAGGG) with a protein core called shelterin. Telomeres cap chromosomes' ends and are essential for the maintenance of genomic stability.[3] Telomere length (TL) shortens with each cell division, and when it reaches a critical length, cells stop division. It has been considered a marker of biological aging.[4] Studies investigating TL in AD have yielded contradictory results.[3] Oxidative stress (OS) has been involved early in the pathogenesis of dementia. It is an imbalance between the production of reactive oxygen species (ROS) and antioxidants, with excess ROS production.[3] Cerebral tissue is highly susceptible to ROS due to the high content of polyunsaturated fatty acids and the relatively low antioxidants levels to cope with the high metabolic activity of cerebral tissue. OS finally leads to the death of neuronal cells with more subsequent deficient antioxidant defenses.[5]8-OHdG is considered the most common marker of DNA oxidation produced by oxidation of DNA bases.[6] This study aims to identify the role of TL and of OS as diagnostic biomarkers for AD.

MATERIALS AND METHODS

This study was conducted in cooperation between the Departments of Clinical Pathology and Neuropsychiatry at the Faculty of Medicine, Menoufia University, and Department of Clinical Pathology at Shibin El-Kom Teaching Hospital. The study was carried out on 180 individuals from October 2017 to July 2018. They were categorized into the following groups. Group 1 (Patient group): This group included 60 previously diagnosed patients with AD. The diagnosis was based on the National Institute of Neurological and Communicative Disorders and Stroke and the AD and Related Disorders Association criteria.[7] They were selected from the geriatric clinic, Ain Shams University Hospital. Group II (age-matched control group): This group included 60 age- and gender-matched nondemented subjects. Group III (pregeriatric group): This group included 60 healthy subjects aged 30-years. Group II and Group III were selected from patients' relatives attending the outpatient clinics at Menoufia University Hospitals, and who volunteered to participate in this study. Exclusion criteria were a those having brain stroke, brain ischemia, previous severe head trauma, and severe hyperlipidemia. All participants were subjected to the following: Full medical history, family history, and physical examination, including a full neurological examination. Mini-Mental State Examination was used to exclude AD in Groups II and III and to determine the severity of AD in Group I.[8] Brain imaging; either computed tomography scans or brain magnetic resonance imaging was done for patients belonging to Group I. Sampling: From all of the participants, 6 ml blood samples were taken by sterile venipuncture after minimal venous stasis using the sterile disposable syringe, the blood samples were distributed on as follows: Three milliliter of blood were delivered to a vacutainer plain test tube, and serum was separated by centrifugation at 3000 rpm for 10 min and used for the analysis of fasting blood sugar, thyroid-stimulating hormone (TSH), lipid profile, total antioxidant and the remaining part stored at −20°C for 8-OHdG measurement. Three milliliters of blood were delivered to a vacutainer tube with ethylenediaminetetraacetic acid (EDTA). The EDTA samples were stored in the same vacutainer at −20°C to be used for DNA extraction and performance of the molecular technique. DNA was extracted from EDTA blood samples by using the QIAamp DNA Blood Mini Kit, as recommended by the manufacturer (QIAGEN, Hilden, Germany). Standards were prepared in amplification plates by serial dilutions four times with ten folds. Rotor-Gene Q (QIAGEN, Hilden, Germany) was used to detect the amplification products. Real-time PCR was used. On the same plate, we measured telomere hexamer repeat (THR) copy number in each sample and reference DNA diluted sample. Initial denaturation was done at 95°C for 15 min followed by 20 cycles of 95°C, 30 s; 54°C, 1 min; 72°C, 30 s. Another plate for both single-copy gene (SCG) 36B4 with the same design of the previous plate was done with initial denaturation step at 95°C for 15 min followed by 30 cycles of 95°C, 30 s then 58°C, 1 min finally 72°C, 30 s. The primers used in these amplifications are: Telomere Forward: CGGTTTGTTTGGGTTTGGGTTTGGG TTTGGGTTTGGGTT Telomere reverses: GGCTTGCCTTACCCTTACCCTTACCC TTACCCTTACCCT SCG Forward: CAGCAAGTGGGAAGGTGTAATCC SCG reverse: CCCATTCTATCATCAACGGGTACAA. Relative TL was measured by the quantization of THR copy number compared to the autosomal SCG copy number. Assuming that the number of copies of SCG cell − 1 is the same in all studied individuals, the ratio between THR/SCG is proportional to the TL.[9] The relative TL reflects the actual differences in TL in studied individuals.[10]

Ethics approval

This study was approved by Ethical Committee of Faculty of Medicine Menoufia University, and written consents were taken from all participants.

Statistical analysis

Statistical Program for the Social Science (SPSS) version 20 (Armonk, NY: IBM Corp) was used to analyze data. T-test and Mann–Whitney test were used to compare two means, while ANOVA test and Kruskal–Wallis test were used to compare more than two means, followed by post hoc tests to compare between each two groups. Chi-square test of significance, and the Fisher's exact test, were used to test relationships between categorical variables. ROC curve was used to detect the sensitivity and specificity of certain cutoff points of T/S, 80 HG and antioxidant to distinguish between AD patients and controls.

RESULTS

The demographic and clinical data for each group showed no statistical differences between the studied groups regarding smoking, gender, and family history. Biochemical data showed significant differences between the studied groups regarding hypertension, diabetes mellitus, fasting blood sugar, TSH, and lipid profile [Table 1].
Table 1

Comparison between the different studied groups according to different parameters

Group I (n=60)Group II (n=60)Group III (n=60)Test of significancePSignificance between groups

I versus III versus IIIII versus III
Smoking18 (30)16 (26.7)8 (13.3)χ2=5.2170.074---
Age (years)64.3±6.564.5±5.737.4±4.7F=450.820*<0.001*0.980<0.001*<0.001*
Sex
 Male38 (63.3)40 (66.7)30 (50)χ2=3.8890.143---
 Female22 (36.7)20 (33.3)30 (50)
HTN22 (36.7)22 (36.7)0 (0)χ2=29.118*<0.001*---
DM26 (43.3)22 (36.7)0 (0)χ2=33.409*<0.001*---
Family history of AD8 (13.3)6 (10)4 (6.7)χ2=1.4810.477---
Glucose (mg/dl)100 (79-150)97.5 (79-160)91.5 (71-115)H=20.089*<0.001*0.237<0.001*0.002*
TSH (mIU/L)1.3 (0.4-3.5)1.4 (0.5-3.5)1.7 (0.5-4.8)H=9.322*0.009*0.6510.004*0.017*
Lipid profile
 Total cholesterol (mg/dl)191.8±30.8183.2±36.2167.9±19.3F=9.981*<0.001*0.250<0.001*0.015*
 TG (mg/dl)115 (64-310)100 (64-375)130 (95-158)H=15.609*<0.001*0.008*0.233<0.001*
 LDL (mg/dl)114.5±33.3109.5±30.688.7±10F=15.713*<0.001*0.563<0.001*<0.001*
 HDL (mg/dl)46.6±949±8.156.9±9.9F=21.652*<0.001*0.315<0.001*<0.001*
T/S2.1 (0.8-6.6)6.5 (4.4-10.9)7.6 (5.1-11.9)H=113.708*<0.001*<0.001*<0.001*0.017*
8-OHG (pg/ml)311.2±103.4153.5±20.878±17.6F=223.052*<0.001*<0.001*<0.001*<0.001*
Total antioxidant (m/ML)0.8 (0.5-2.9)1.5 (1.1-2.1)2 (1.7-2.6)H=110.750*<0.001*<0.001*<0.001*<0.001*

F – F for ANOVA test, pairwise comparison bet. Each 2 groups was done using post hoc test (Tukey); H – H for Kruskal–Wallis test; Pairwise comparison bet. Each 2 groups was done using post hoc test (Dunn’s for multiple comparisons test); P – P value for comparing between the different groups; *Statistically significant at P≤0.05; Group I – Alzheimer’s; Group II – Age-matched control group; Group III – Pregeriatric. HTN – Hypertension; DM – Diabetes mellitus; OHG – Oral hypoglycemic; HDL – High-density lipoprotein; LDL – Low-density lipoprotein; TG – Triglyceride

Comparison between the different studied groups according to different parameters F – F for ANOVA test, pairwise comparison bet. Each 2 groups was done using post hoc test (Tukey); H – H for Kruskal–Wallis test; Pairwise comparison bet. Each 2 groups was done using post hoc test (Dunn’s for multiple comparisons test); P – P value for comparing between the different groups; *Statistically significant at P≤0.05; Group I – Alzheimer’s; Group II – Age-matched control group; Group III – Pregeriatric. HTN – Hypertension; DM – Diabetes mellitus; OHG – Oral hypoglycemic; HDL – High-density lipoprotein; LDL – Low-density lipoprotein; TG – Triglyceride Group I showed a highly significant decrease in T/S ratio and total antioxidant in comparison to both Group II and III (P < 0.001). Furthermore, Group II showed a significant decrease regarding both variables in comparison to Group III. Meanwhile, there was a highly significant increase in Group I compared to Group II and III, and in Group II compared to Group III regarding 8-OHdG (P < 0.001) [Table 1]. Patients with severe AD showed a highly significant decrease in the T/S ratio and total antioxidant level and a highly significant increase in 8-OHdG in comparison to patients with mild AD [Table 2].
Table 2

Comparison between mild and severe according to different parameters in Alzheimer’s cases

AD degreeTest of significanceP

Mild (n=20)Severe (n=40)
Smoking2 (10)16 (40)χ2=5.714*0.017*
HTN6 (30)16 (40)χ2=0.5740.449
DM4 (20)22 (55)χ2=6.652*0.010*
Age (years)62.5±5.265.2±7t=1.5070.137
Sex
 Male6 (30)32 (80)χ2=14.354*<0.001*
 Female14 (70)8 (20)
Family history4 (20)4 (10)χ2==1.1540.422
T/S2.8 (1.6-6.6)1.9 (0.8-5.6)U=220.0*0.005*
8-OHG (pg/ml)209.5±37.7362±86.7t=9.477*<0.001*
Total antioxidant (m/ML)1.2 (0.8-1.8)0.7 (0.5-2.9)U=102.0*<0.001*

FE: Fisher’s exact; t: Student’s t-test; U: Mann-Whitney test. P – P value for comparing between mild and moderate. *Statistically significant at P≤0.05. AD – Alzheimer’s disease; HTN – Hypertension; DM – Diabetes mellitus; OHG – Oral hypoglycemic

Comparison between mild and severe according to different parameters in Alzheimer’s cases FE: Fisher’s exact; t: Student’s t-test; U: Mann-Whitney test. P – P value for comparing between mild and moderate. *Statistically significant at P≤0.05. AD – Alzheimer’s disease; HTN – Hypertension; DM – Diabetes mellitus; OHG – Oral hypoglycemic The sensitivity of T/S ratio to predict Alzheimer's patients versus Age-matched control was 86.67%, the specificity was 96.67%, the positive predictive value (PPV) was 96.3% and the negative predictive value (NPV) was 87.9% a cutoff point ≤4.41. The sensitivity of 8-OHdG to predict Alzheimer's patients versus age-matched control was 96.67%, the specificity was 86.67%, the PPV was 87.9% and the NPV was 96.3% a cutoff point >174. The sensitivity of antioxidant to predict Alzheimer's patients versus age-matched control was 73.33%, the specificity was 83.33%, and the PPV was 81.5% and the NPV was75.8% at a cutoff point ≤1.16 [Table 3].
Table 3

Agreement (sensitivity, specificity) for T/S, 80HG and antioxidant to predict Alzheimer’s patients versus age-matched controls

AUCP95% CICut offSensitivitySpecificityPPVNPV
T/S0.963<0.001*0.921-1.006≤4.4186.6796.6796.387.9
80HG0.971<0.001*0.936-1.006>17496.6786.6787.996.3
Antioxidant0.862<0.001*0.762-0.961≤1.1673.3383.3381.575.8

*Highly significant. AUC – Area under a curve; CI – Confidence intervals; PPV – Positive predictive value; NPV – Negative predictive value

Agreement (sensitivity, specificity) for T/S, 80HG and antioxidant to predict Alzheimer’s patients versus age-matched controls *Highly significant. AUC – Area under a curve; CI – Confidence intervals; PPV – Positive predictive value; NPV – Negative predictive value

DISCUSSION

In the present study, there was no statistically significant difference among studied groups regarding gender. A finding confirmed by the results of both Lopez-Riquelme et al.[11] and Shafagoj et al.[12] We found no statistically significant difference among groups regarding the history of smoking (P = 0.271). This result was inconsistent with the result found by Montufar et al.[13] On the other hand Kimm et al.[14] found a significant risk of AD in smoker's men aged 65 years. There was no statistically significant difference among groups regarding the family history of AD (P = 0.906). Although Haussmann et al.[15] study showed that healthy older adults report greater memory impairment when they have a positive first-degree family history of AD, Loy et al.[16] found that a family history of AD was not necessary for an individual to develop the disease. History of hypertension (HTN) was found in 36.7% of the cases, which was statistically significantly higher than the other two groups (P < 0.001). Although Montufar et al.[13] found no statistically significant differences in HTN (P = 0.459) between patients with AD and controls, Kimm et al.[14] considered HTN a strong risk factor of AD either in the age of less than or more than 65 years (P < 0.05). Furthermore, Raina et al.[17] found a significant difference between patients and control regarding HTN. In this study, the levels of total cholesterol, LDL, and HDL were statistically significantly higher in both Group I and II in comparison to Group III (P < 0.001). Regarding TG, only Group I showed an increase in comparison to the other two groups. While Gonzalez et al.,[18] found a significant difference regarding low-density lipoprotein cholesterol between the AD group and control group but no difference regarding TG, Lepara, et al.[19] found a statistically significant increase in serum TG in AD patients compared to controls (P < 0.001). We found a highly significant decrease in Group I compared to Group II and III, and in Group II compared to Group III regarding TSH. A finding opposed by the results of both Tan et al.[20] and Chang et al.[21] but supported by van Osch et al.[22] who reported that AD patients had lower TSH levels than control subjects with a more than the two-fold increased risk of AD associated with lowered TSH levels. It was found that T3 negatively regulates the expression of the amyloid precursor protein gene, T4 modulates choline acetyltransferase activity, and transthyretin creates soluble β-amyloid complexes which lead to the formation of senile plaque Yaffe et al.[23] In the present study, the percentage of subjects with diabetes mellitus and the levels of fasting blood glucose were both higher in Group I and II in comparison to Group III. A result consistent with the work of both Yaffe et al.[23] and Zhao et al.[24] The association between AD and hyperglycemia may be due to the direct effect of insulin resistance on the brain, as Insulin could modulate the levels of B-amyloid protein aggregation, the main component of senile plaques Gasparini et al.[25] In this study, total antioxidant capacity (TAC) in AD patients was decreased compared to the age-matched group and presenile group (P < 0.001). Moslemnezhad et al.,[6] found that TAC levels significantly decreased in patients with AD in comparison to the control-matched group. Sekler et al.[26] assessed the plasma level of TAC in AD patients (mild, intermediate, and advanced disease) versus control groups. They found significantly lower TAC in AD patients (all stages) as compared to the control group. Furthermore, Aldred et al.[27] showed a significant decrease in TAC in severe AD in comparison to controls. In contrast to these results, Pulido et al.[28] had not found a significant difference in plasma TAC between the AD and control groups. In Pulido, et al.[28] study participants with APOE genotype 4/4; the group with a higher incidence in AD; showed lower plasma antioxidant capacity than other genotype groups. We found that plasma 8-OHdG concentrations in patients with AD were significantly higher when compared to both age-matched group and presenile group (P < 0.001). A finding consistent with Mecocci et al.[29] and Migliore et al.[30] results. Syslová et al.[31] showed that there was a significantly higher plasma 8-OHdG concentration and a significantly lower total antioxidant in AD versus healthy controls. Furthermore, Moslemnezhad et al.[6] showed a statistically significantly threefold increase in mitochondrial DNA 8-OHdG levels in patients in comparison to the controls. The present work clearly illustrated that the relative TL significantly shortened in patients with AD (Group I) in comparison to both control matched Group II (P < 0.001), and presenile Group III (P < 0.001), and also significantly shortened in Group II when compared to Group III. According to the results of Guan et al. and[32] Hewakapuge, et al.[33] the length of telomeres was found to significantly decrease with aging, which coincides with the differences found in this study between Group I and II on one side and Group III on the other side. However, aging process cannot explain the highly significant shortening of telomeres length in patients with AD in comparison to Group II or the significant shortening of telomeres length in patients with severe AD in comparison to patients with mild AD. The associations between shortened TL and each of smoking, obesity, HTN and diabetes mellitus have been reported by several studies.[343536] In the present study, no significant differences were found between Groups I and II regarding metabolic risk factors except for TG [Table 1]. However, the group of patients with severe AD included higher numbers of smokers and patients with DM in comparison to patients with mild AD group [Table 2]. TL has been considered as a possible epigenomic marker for different neuropsychiatric disorders, such as AD, vascular dementia, schizophrenia, bipolar disorder, and others. The direct mechanisms for telomere shortening in these disorders remain unknown.[28] In their meta-analysis, Forero et al.,[3] results showed consistent evidence of shorter telomeres in AD patients (P < 0.001). This meta-analysis did not include studies from African, South Eastern Asian, or Latin American countries. According to Brouilette et al.[37] conditions with OS have been found to accelerate telomere shortening. There is evidence that markers of OS are associated with telomere shortening.[38] In the present study, patients with AD in advanced stages had higher levels of OS and lower levels of antioxidants [Table 2]. Although the results of ROC analyses revealed that all 8-OHdG, T/S, and antioxidant levels can be considered as a possible marker to distinguish AD from healthy people, using both of 8-OHdG and T/S ensures a combination of high sensitivity and specificity up to 97%. This study had some limitations. The sample size was relatively small. There was a need for a group of healthy subjects whose age matched to AD group to exclude the impact of DM, HTN, and other illnesses on the parameters studied.

CONCLUSION

AD is associated with shortened TL and increased OS manifested by decreased TAC and increased serum 8-OHdG. T/S and 8-OHdG could be used as early predictors for AD.

Financial support and sponsorship

Nil.

Conflicts of interest

There are no conflicts of interest.
  37 in total

1.  Family History of Alzheimer's Disease and Subjective Memory Performance.

Authors:  Robert Haussmann; Steffi Ganske; Antonia Gruschwitz; Annett Werner; Antje Osterrath; Jan Lange; Maria Buthut; Katharina L Donix; Jennifer Linn; Markus Donix
Journal:  Am J Alzheimers Dis Other Demen       Date:  2018-05-07       Impact factor: 2.035

2.  Telomere length, risk of coronary heart disease, and statin treatment in the West of Scotland Primary Prevention Study: a nested case-control study.

Authors:  Scott W Brouilette; Jasbir S Moore; Alex D McMahon; John R Thompson; Ian Ford; James Shepherd; Chris J Packard; Nilesh J Samani
Journal:  Lancet       Date:  2007-01-13       Impact factor: 79.321

3.  Mid-life and late-life vascular risk factors and dementia in Korean men and women.

Authors:  H Kimm; P H Lee; Y J Shin; K S Park; J Jo; Y Lee; H C Kang; S H Jee
Journal:  Arch Gerontol Geriatr       Date:  2010-10-06       Impact factor: 3.250

4.  Thyroid function and the risk of Alzheimer disease: the Framingham Study.

Authors:  Zaldy S Tan; Alexa Beiser; Ramachandran S Vasan; Rhoda Au; Sanford Auerbach; Douglas P Kiel; Philip A Wolf; Sudha Seshadri
Journal:  Arch Intern Med       Date:  2008-07-28

5.  Clinical diagnosis of Alzheimer's disease: report of the NINCDS-ADRDA Work Group under the auspices of Department of Health and Human Services Task Force on Alzheimer's Disease.

Authors:  G McKhann; D Drachman; M Folstein; R Katzman; D Price; E M Stadlan
Journal:  Neurology       Date:  1984-07       Impact factor: 9.910

6.  Meta-analysis of Telomere Length in Alzheimer's Disease.

Authors:  Diego A Forero; Yeimy González-Giraldo; Catalina López-Quintero; Luis J Castro-Vega; George E Barreto; George Perry
Journal:  J Gerontol A Biol Sci Med Sci       Date:  2016-04-18       Impact factor: 6.053

Review 7.  Genetics of dementia.

Authors:  Clement T Loy; Peter R Schofield; Anne M Turner; John B J Kwok
Journal:  Lancet       Date:  2013-08-06       Impact factor: 79.321

8.  Alzheimer Disease: Perspectives from Epidemiology and Genetics.

Authors:  Jonathan L Haines
Journal:  J Law Med Ethics       Date:  2018-09       Impact factor: 1.718

9.  Altered plasma marker of oxidative DNA damage and total antioxidant capacity in patients with Alzheimer's disease.

Authors:  Ameneh Moslemnezhad; Soleiman Mahjoub; Mehdi Moghadasi
Journal:  Caspian J Intern Med       Date:  2016

10.  Association between the APOE ε4 Allele and Late-Onset Alzheimer's Disease in an Ecuadorian Mestizo Population.

Authors:  Stefany Montufar; Cristian Calero; Rodrigo Vinueza; Patricio Correa; Andrea Carrera-Gonzalez; Franklin Villegas; Germania Moreta; Rosario Paredes
Journal:  Int J Alzheimers Dis       Date:  2017-12-04
View more
  1 in total

1.  Sex-Specific Association of Serum Anti-Oxidative Capacity and Leukocyte Telomere Length.

Authors:  Eva Hassler; Gunter Almer; Gernot Reishofer; Gunther Marsche; Harald Mangge; Hannes Deutschmann; Markus Herrmann; Stefan Leber; Felix Gunzer; Wilfried Renner
Journal:  Antioxidants (Basel)       Date:  2021-11-28
  1 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.