Literature DB >> 33270708

Mitochondrial D-loop sequence variation and maternal lineage in the endangered Cleveland Bay horse.

Andy C Dell1,2, Mark C Curry1, Kelly M Yarnell3, Gareth R Starbuck3, Philippe B Wilson2,3.   

Abstract

Genetic diversity and maternal ancestry line relationships amongst a sample of 96 Cleveland Bay horses were investigated using a 479bp length of mitochondrial D-loop sequence. The analysis yielded at total of 11 haplotypes with 27 variable positions, all of which have been described in previous equine mitochondrial DNA d-loop studies. Four main haplotype clusters were present in the Cleveland Bay breed describing 89% of the total sample. This suggests that only four principal maternal ancestry lines exist in the present-day global Cleveland Bay population. Comparison of these sequences with other domestic horse haplotypes (Fig 2) shows a close association of the Cleveland Bay horse with Northern European (Clade C), Iberian (Clade A) and North African (Clade B) horse breeds. This indicates that the Cleveland Bay horse may not have evolved exclusively from the now extinct Chapman horse, as previous work as suggested. The Cleveland Bay horse remains one of only five domestic horse breeds classified as Critical on the Rare Breeds Survival Trust (UK) Watchlist and our results provide important information on the origins of this breed and represent a valuable tool for conservation purposes.

Entities:  

Year:  2020        PMID: 33270708      PMCID: PMC7714183          DOI: 10.1371/journal.pone.0243247

Source DB:  PubMed          Journal:  PLoS One        ISSN: 1932-6203            Impact factor:   3.240


Introduction

The Cleveland Bay is one of only five domestic horse breeds listed as critical (< 300 breeding females) in the Rare Breeds Survival Trust Watchlist, making it one of Britain’s oldest and most at-risk native horse breeds. The breed is thought to have been established in the seventeenth century from crosses between pack horse or “Chapman” mares, known to have been bred by monastic houses in the North-East of the UK, and newly imported hot-blooded Arabian, Barb or Mediterranean stallions, to produce an early example of what is now known as a warmblood [1]. Cleveland Bays flourished throughout the eighteenth-century achieving world renown as coaching and driving horses [2]. The Cleveland Bay Horse Society (CBHS) was formed in 1884 and the first stud book was produced with pedigrees dating back to 1732 [2]. The first stud book was officially closed in 1886 and the breed has maintained a closed stud book since that date. However, even by the time the CBHS was formed, the breed was in decline; subsequent losses in two World Wars, and increasing mechanisation in transport and on land meant that by the middle of the twentieth century the breed was very close to extinction, with only four pure bred stallions remaining. The efforts of a few dedicated breeders, including HM the Queen, brought the Cleveland Bay horse back from the brink of extinction [3]. Recent pedigree analysis shows that only one out of 11 founder stallion lines survive in the current population, and only 9 out of 17 dam lines, of which 3 are represented in the living population by only one or two animals each [1, 2]. The average level of inbreeding for the Cleveland Bay is estimated as 22.5%, substantially higher than for the majority of domestic horse breeds (6.55–12.55%) and the current effective population size is calculated at 32; substantially lower than the United Nations FAO critical threshold of 50. Indeed, we have recently outlined a comparative analysis of the population employing both pedigree evaluation and molecular methods, whilst formulating a pedagogically-based strategy for conservation assessments of such breeds going forward and allowing for our framework to be employed for the conservation of endangered breeds going forward [4]. Furthermore, this work develops on our previous assessment of pedigree records and indicates that the small size of the population and high levels of inbreeding constitute a powerful argument for establishing a robust understanding of the genetic diversity of the breed in order to secure its survival. The complete sequencing of the mitochondrial DNA (mtDNA) of the domestic horse was carried out by Xu and Árnason (1994). Since that time much has been done to uncover the origins of horse domestication as well as understanding matrilineal relationships within and between breeds. Despite the increasing number of domestic horse breeds being studied, mtDNA sequencing has not previously been conducted on a representative sample of the Cleveland Bay horse. In this study, we present the mtDNA D-loop sequencing of a sample of 96 Cleveland Bay horses and describe the haplotypes found in the breed. Phylogenetic analysis of the sequence data was carried out in order to establish maternal lineages within the breed and discern relationships with other domestic horse breeds.

Results

Haplotype and DNA polymorphism analysis

Sequence analysis of 421 base pairs across the 96 Cleveland Bay samples identified 11 different haplotypes with 27 variable positions (Table 1). Haplotype diversity (h) across the sample set was determined as 0.7973 whilst nucleotide diversity (π) was 0.1537. The average number of nucleotide differences (k) was 7.363. Of the 11 haplotypes identified, four were matched to known female ancestry lines, by comparison of sample identity with pedigree data from the studbook database. The relationship between haplotypes with documented ancestry lines is shown in the neighbour joining tree in Fig 1, and further detailed in Table 2.
Table 1

Variable nucleotides in a 497bp fragment of the mitochondrial DNA D-loop of the Cleveland Bay haplotypes compared with the reference sequence GenBank accession number X79547.

IDHaplotype (Achilli)Haplotype (Jansen)nFreq154941549515496155341553815542155841558515596155971560015601156021560315617156351564915650156591566615703157091572015721158061582615827
X79547A1A530.021TTACACCGAAGTCTTCAATGTCGCCAA
Hap_1MC1250.260.C..........T.C...C...ATT.G
Hap_2GA1270.281.C...T...G..T..T.G.AC.A....
Hap_3IB2130.135.C..G..A....T....G...TAT.G.
Hap_4MB210.219.C.....A..ACT.........ATT.G
Hap_5IB110.010.C..G...G...T....G...TAT.G.
Hap_6NC210.010.C.....A...CT.........ATT.G
Hap_7MC10.010.C.......G..T.C...C...ATT.G
Hap_8LD120.021CCGT........TC..G.....AT...
Hap_9L2D220.021CCGT...A....TC..G.....AT...
Hap_10IB10.010.C..G.TA....T....G...TAT.G.

* sites 15585 15597 & 15650 have been previously identified as mutation hotspots [11, 18].

Fig 1

Neighbour Joining tree of individual Cleveland Bay mtDNA contigs showing association of haplotype with previously described maternal ancestry lines (Emmerson 1984).

Bootstrap figures show confidence in the branches of the tree.

Table 2

Relationship of 11 Cleveland Bay mtDNA haplotypes to known Cleveland Bay maternal ancestry lines (total sample = 96).

HaplotypenFreqAncestry Line
X7954732.1%Reference Sequence
CB Hap 12526.0%Lines 1 & 3
CB Hap 22728.1%Line 6
CB Hap 31313.5%Line 7
CB Hap 42121.9%Line 5
CB Hap 511.0%Line 2
CB Hap 611.0%Grading Register
CB Hap 711.0%Line 1 mutation
CB Hap 822.1%Non Cleveland?
CB Hap 922.1%Line 8 Grading Register
CB Hap 1011.0%Line 9 Grading Register

Neighbour Joining tree of individual Cleveland Bay mtDNA contigs showing association of haplotype with previously described maternal ancestry lines (Emmerson 1984).

Bootstrap figures show confidence in the branches of the tree. * sites 15585 15597 & 15650 have been previously identified as mutation hotspots [11, 18]. Two Cleveland Bay sequences we found to share the haplotype of the reference sequence (X79547). These animals (CB001 and CB003) are of Grading Registry origin and so are descended from animals that were brought into the studbook from outside the breed, being selected for reasons of pedigree or phenotype. It should be noted that these two animals are not registered in the purebred section of the Cleveland Bay studbook [2]. CB Haplotype 1 is shared by 25 individuals, representing 26% of the animals sequenced. This haplotype is shared by members of both Female Ancestry Lines 1 and 3, indicating that they are of common maternal origin, although this predates the studbook records. CB Haplotype 2 is shared by 27 of the horses sequenced, representing 28% of the sample. This haplotype is unique to animals from Female Ancestry Line 6. CB Haplotype 3 is common to 13 horses, representing 13.5% of the sample. All of these animals have maternal origins in Female Ancestry Line 7. CB Haplotype 4 has 21 members, representing 21.9% of the sample. This haplotype is unique to members of Female Ancestry Line 5. These four Cleveland Bay haplotypes represent 89.5% of all of the animals sampled. CB Haplotype 5 is unique to one animal (CB018) who is the only representative of Female Ancestry Line 2. CB Haplotype 6 is found in one animal (CB002); this horse has an application for Grading Register status pending with the Cleveland Bay Horse Society and so is of unconfirmed pedigree or maternal origin. CB Haplotype 7 is unique to one animal (CB017) whose pedigree places her in Female Ancestry Line 1.CB Haplotype 8 is shared by two seemingly unrelated animals (CB026 and CB082). These horses trace back to Female Ancestry Lines 3 and 7 respectively. Logically they would be expected to be of haplotypes 1 and 3. A BLAST search on the GenBank nucleotide database, for similar sequences, shows that this haplotype equates to D1 [3], which is globally the most common of all domestic horse haplotypes. There are nine variable positions between this haplotype and the reference sequence, which is suggestive that the difference may not be down to sequencing errors. The reasons for these two seemingly unrelated animals appearing to share a non-Cleveland Bay haplotype warrants further investigation. CB Haplotype 9 is shared by two individuals (CB094 and CB095). These two animals trace back to Female Ancestry Line 8, which is a grading registry line of relatively recent origin. They are the only representatives of Line 8 in the sample. CB Haplotype 10 is unique to one animal (CB096). This horse is the only representative of the most recent female ancestry line–Curlew–identified in an earlier study [1]. Again the origins of this line trace back to the Grading Register, and to equine mtDNA Clade B [3].

Relationships with other breeds

The four main Cleveland Bay mtDNA haplotypes produced significant matching with other domestic horse breeds. Cleveland Bay Haplotype 1 (CB Hap1) gave 100% matches in both pairwise identity and identical sites with four Kerry Bog Pony sequences [5]. There were no complete matches for CB Hap 2. However, there was 99.8% matching with sequences from Irish Draught, Arab and Akhal-Teke horses [6]. CB Hap3 was a complete match for two Irish Draught sequences [5], as well as three from Orlov horses [5]. CB Hap4 showed 99.6% identity with three Irish Draught horse sequences and one from a Zhongdian horse [7]. Of the minor haplotypes, the reference sequence [8] and two Cleveland Bay grading register animals gave 100% matches in both pairwise identity and identical sites with three Irish Draught Horse sequences and with three Kerry Bog Pony sequences [5]. CB Hap5 was a 99.6% match to four Irish Draught horse sequences as well as one of Mongolian origin [9]. Again, no exact match was found for CB Hap6, but there was >99.4% matching with Kerry Bog Pony, Irish Draught, Mongolian, and Zhongdian horse sequences. CB Hap7 was best matched at 97% similarity with five Kerry Bog Pony sequences. There were 100% matches between CB Hap 8 and Ahkal-Teke Irish Draught and Chinese Guan Mountain horses. CB Hap9 showed identity of >99.8% with 5 Irish Draught Horse sequences, whilst there was >99.8% matching between CB Hap10, Irish Draught, Kerry Bog Pony, Polish Arabian and Orlov sequences [10]. The clustering of Cleveland Bay haplotypes with other equine breeds is tabulated in Table 3 whilst a median joining network of previously defines equine clades [11] illustrating how the Cleveland Bay haplotypes fits the established model is shown in Fig 2.
Table 3

Relationship between Cleveland Bay mtDNA haplotypes and other domestic horse breeds based on Blast searches against NCBI GenBank nucleotide database.

Clade nomenclature as defined by Jansen et al (2002).

CB HaplotypeFemale Ancestry LineCladeBreeds Clustered With
CB Hap 0 (Reference Sequence)Grading RegisterA5
CB Haplotype 1Lines 1 & 3C1Kerry Bog Pony
Exmoor
Icelandic
CB Haplotype 2Line 6A1Irish Draught
Arab
Akhal-Teke
Danish Horse
CB Haplotype 3Line 7B2Irish Draught
Orlov
Arab
Thoroughbred
CB Haplotype 4Line 5CIrish Draught
Zhongdian
Exmoor
Icelandic
CB Haplotype 5Line 2 / 7B1Irish Draught
Mongolian
CB Haplotype 6Grading RegisterC2Kerry Bog Pony
Irish Draught
Mongolian
CB Haplotye7Line 1CKerry Bog Pony
CB Haplotype 8-D1Akhal-Teke
Irish Draught
Guan Mountain Horse
CB Haplotype 9Line 8 (GR)D2Irish Draught
CB Haplotype 10Line 9 (GR)BIrish Draught
Kerry Bog Pony
Polish Arabian
Orlov
Fig 2

Median joining network showing relationship of Cleveland Bay haplotypes to previously defined equine clades (Jansen et al 2002).

After [5].

Median joining network showing relationship of Cleveland Bay haplotypes to previously defined equine clades (Jansen et al 2002).

After [5].

Relationship between Cleveland Bay mtDNA haplotypes and other domestic horse breeds based on Blast searches against NCBI GenBank nucleotide database.

Clade nomenclature as defined by Jansen et al (2002).

Discussion

Haplotype analysis

Ninety six Cleveland Bay horses were sampled and sequenced in this study. The haplotypic diversity (h) calculated for the breed is significantly lower than that determined for the majority of other domestic equines (h = 0.7973) [12]. Haplotypic diversity is indeed higher in Avar horses (h = 0.93), Hungarian ancient horses (h = 0.989), modern Akhal Teke (h = 0.945), [13]; Hispano-Breton heavy horse (h = 0.975) and Pre horse (h = 0.878) [14]; Lusitano (h = 1.0), Asturcon (h = 0.80), Argentine Crillo (h = 1.0), and Barb (h = 0.933) [15]. Breeds with lower haplotypic diversity include Caballo de Corro (h = 0.733), Paso Fino (h = 0.60), Florida Cracker (h = 0.667) and Sulphur Mustang with the lowest reported (h = 0.333) [15]. Each of the breeds with reported h lower than that found in the Cleveland Bay has been derived from significantly smaller sample sets, with n = 6 in each case. Altogether 11 haplotypes were identified, 4 were found to explain 89% of samples, as well as 7 minor ones. All of the 11 haplotypes have been previously identified in domestic horses [12]. The four principal haplotypes are associated with the following Female Ancestry lines and founders. CB Hap1 corresponds to Line One/Three: Stainthorpe’s Star (foaled circa 1850 by Grand Turk 138). This mare predates Dais(y) 318 (the previously recorded founder of Line 3 [2]) by some 26 years. As both share the same mtDNA haplotype we can consider that both lines share a common female ancestor. This haplotype was found in 26% of the samples tested, and projection from pedigree records indicates that it is present in 33% of the reference population. CB Hap2 is associated with Line Six: Trimmer 269 (foaled 1880 by Wonderful 359) and carries the unique CB Hap 2. This haplotype was found in 28% of the samples tested and, by pedigree analysis, is present in 28.6% of the reference population. This haplotype matches the previously defined type A1 [11].The only other haplotype from the same Clade found in the samples tested was CB Hap 0; shared by two Grading Register animals and the Reference sample. This equated to Jansen’s type A5 [11]. CB Hap3 associates with female ancestry Line Two / Seven: Depper 39 (foaled 1855 by Ottenburgh 222). Whilst Line 2 is virtually extinct in direct descence within the reference population (n = 3), we demonstrate that a haplotype with significant similarity is shared with the more recent and more populated Line 7, with only one base difference at position 15597 between the haplotypes of these two ancestry lines. Whilst site 15597 is known to be a mutational hotspot [11], which could equally explain the haplotype difference; both of these haplotypes arise from cluster C, as defined by earlier work on equine mitochondrial haplotype sharing [3]. Line 7 was established by the breeding of Mr J Sunley of Gerrick House, in the 1930s, from the Grading Register mare Brilliant. This mare will have carried a haplotype which differs only in two mutations from the haplotype carried by Line 2 animals (CB Hap3). It likely that these lines have a common maternal origin, however it is difficult to deduce from the mutational differences whether the link is in recent or historic generations. Also of very similar haplotype is the recent Grading Register addition of Female Line 9 (Curlew). This has a single mutational difference with Female Line Two and belongs to the same mtDNA haplotype Clade B [11]. CB Hap3 was found in 13.5% of the samples tested and is present in 15.2% of the reference population. CB Hap4 = Line 5: Depper 42 (foaled 1880 by Barnaby 21) corresponds to the line described by Jansen’s Clade C origins [11]. 22% of the animals tested carry this haplotype, which is reflected in 20% of the reference population. Seven minor haplotypes were identified, each being seen in either single instances or no more than two other individuals. Study of the pedigree of the horses in which these were identified indicates that the majority occur in individuals of relatively recent introduction to the breed through the Grading Register, or have Grading Register pending status. Others appear to be closely related to one of the major haplotypes, with one, or at most two base pair differences. The estimated rate of mutation of the equine mitochondria DNA control region is 2–4 × 10−8 site-1 year-1 [16], equating to approximately one mutation per 100,000 years [17]. Several authors have identified mutational hotspots within the control region of equine mitochondrial DNA [11, 18]. Positions 15585, 15597 and 15650 are recognised as being subject to mutation at significantly greater rates than other sites [12]. Within our sample, two singleton haplotypes occur, which are unique in respect of mutations at these hotspots. CB Hap6 varies from CB Hap4 by a single mutation at 15585. Similarly, CB Hap7 varies from CB Hap1 by a single mutation, in this case at position 15597. In addition, if mutation at 15585 is ignored, then CB Haplotypes 8 and 9 appear identical. CB Hap 8 and 9 originate from Jansen’s Clade D [11]. Two animals demonstrate haplotype D1 and the remaining two haplotype D2. CB Hap 9 is associated to Female Ancestry Line 8, which corresponds to only 1% of the reference population. This ancestry line is of recent grading registry origin, tracing back to Church House Queenie GR60 by Kingmaker 1807. This suggests introgression of a female of non-Cleveland Bay origins into the breed. Whilst studbook records dating back to the late 18th century suggest that as many as 17 different female founders contributed to the breed, the present study has identified only eleven haplotypes. Within these 11 haplotypes, 4 are representative of 89% of the modern day, purebred Cleveland Bay population. Accepting that the seven minor haplotypes are linked to known mutational hotspots and hence can be considered minor mutations of one of the four principal haplotypes or to relatively recent introductions into the breed via the Grading Register, then it is conceivable that only four female founders contribute to the modern day population. However, it is difficult to reliably deduce the timescale of this founding event or events. Indeed, these four females will certainly predate the formation of the studbook and most likely represent four different mares involved in early domestication of the horse; Jansen et al (2002) determined that horse domestication could be reasonably explained by only 77 founding females.

Relationships with other horse breeds

Searches with the four principal Cleveland Bay haplotypes against those sequences held in the NCBI Genbank nucleotide database [19] reveal substantial haplotype sharing with the Irish Draught horse [6]. CB Haplotype 1, which is shared by Lines 1 and 3, is shown to be identical to that found in the Kerry Bog pony in Ireland. This is an old breed, closely related to the Exmoor and believed to have descended from the native pony. This supports the long held premise of these Cleveland Bay lines 1 and 3 having Chapman origins. The remaining three major haplotypes share identity with Irish Draught horse sequences [5]. The Cleveland Bay studbook is substantially older than that of the Irish Draught and it is probable that Cleveland Bay mares exerted some influence in the early breeding of working, riding and carriage horses in Ireland. Interestingly, no BLAST searches [20] found matches for any Cleveland Bay sequences with horses which could be described as being of Carting Blood, such as Shires, Clydesdales or the Suffolk Punch. The evidence from the the current work suggests that the carthorse has indeed played no part in the development of the Cleveland Bay breed. The distribution of the four main Cleveland Bay haplotypes across Clades A–C [11] is consistent with the association of these Clades with horses of Northern European, Iberian or North African origin. Clade C1 has previously been associated with Exmoor, Fjord, Icelandic and Scottish Highland Ponies [11]. This cluster is geographically restricted to central Europe, the British Isles and Scandinavia, including Iceland [21, 22]. Some horses of Iberian origin have previously been associated with Clade A [11], and this is consistent with the historical records for the Cleveland Bay breed [1]. Horses of Lusitano, Pre and Sorria origins have been shown to belong to Clade B [23] whilst cluster D1 is considered as representative of Iberian and North African Breeds [11]. Traditionally the Cleveland Bay horse is thought to have evolved (maternally) from the now extinct Chapman packhorse, which in turn is considered to have originated from the native British pony, and is supported by the evidence that members of female ancestry lines one, three and five belong to Clade C. There are BLAST associations with the Exmoor and Kerry Bog Ponies, both ancient breeds, suggesting evolution from ponies that were native to post-glacial Britain. Clades A and B have associations with horses of Iberian and North African origins, respectively. The historical evidence suggests that stallions from Spain and North Africa were imported to North East England and used on local mares. It is not unlikely that good quality mares were imported from these same origins, and that these were covered with early Cleveland Bay stallions. If this is indeed the case, then mares of Line 6 and 7, and by association the almost extinct Line 2, may not be of maternal Chapman descent, but originate from Iberian and Barb mares.

Note

The 96 contig sequences obtained in this study have been submitted to the NCBI GenBank database. The accession numbers are HQ848967 to HQ849062 inclusive.

Materials and methods

Population sampling

Mane hair samples were obtained from Cleveland Bay horses from Europe, North America and Australasia including the UK (78), France (5), USA (3), Canada (6), and Australia (4). Authorisation to import samples from outside of the European Union was obtained from the UK Department for Environment, Food and Rural Affairs (DEFRA) (Authorisation No. POAO/2010/238). A total of 125 hair samples were obtained, screened, by comparison with the studbook database to determine female ancestry, with a final selection of 96 samples chosen to optimally represent the living Cleveland Bay population. Sample selection was made to ensure that a) samples were tested from each of the most critically rare female ancestry lines; and b) the remaining samples should be in proportion to the occurrence of the relevant female ancestry line in the current Cleveland Bay population according to maternal founder analysis. The final distribution of ancestry lines across the 96 samples tested is presented in Table 4.
Table 4

Female ancestry line representation in 96 Cleveland Bay hair samples selected for mtDNA d-loop sequencing.

Female Ancestry LineFounder & Studbook NumberNumber of SamplesSample References% total
OneStainthorpe’s Star14CB004 –CB01714.58
TwoDepper 391CB0181.04
ThreeDaisy 31813CB019 –CB03113.54
FourMarvellous 720untraced0
FiveDepper 4220CB032 –CB05120.83
SixTrimmer 26828CB052 –CB07929.17
SevenBrilliant GR14CB080 –CB09314.58
EightChurch House Queenie GR602CB094 –CB0952.08
NineCurlew GR1CB0961.04
Grading RegisterVarious3CB001 –CB0033.13

Ethical statement

Sampling was limited to the collection of hairs pulled from the mane or tail by the horse owner or researcher. All animal work was conducted in accordance with and approval from the international and national governing bodies at the institutions in which samples were collected (The University of Lincoln Research Ethics Committee (UREC)) and in accordance with all relevant international guidelines and frameworks including the EU PREPARE framework: Smith, AJ, Clutton, RE, Lilley, E, Hansen KEAa, Brattelid, T. (2018): PREPARE: Guidelines for planning animal research and testing. Laboratory Animals, 52(2): 135–141. DOI: 10.1177/0023677217724823.

PCR amplification and sequencing

DNA extraction

DNA was extracted from hair follicles using a Quaigen DNeasy 96 Blood & Tissue Kit (QIAGEN, Manchester, UK), following the Purification of Total DNA from Animal Tissues DNeasy 96 Protocol [24].

PCR

Polymerase chain reactions (PCR) were carried out on an MJ Research DNA Engine Tetrad PTC-225 (Bio-Rad Laboratories, Watford, UK). Forward and reverse primers were designed according to previously published work [25] for the D-loop equine Reference Sequence X79547 [8]. Primer 1 –(1F)—CGCACATTACCCTGGTCTTG Primer 2 - (1R)–GAACCAGATGCCAGGTATAG PCR amplification of mtDNA was carried out in a 96 well microtitre plate, with each well containing 5μl Primer 1 (10nM), 5μl Primer 2 (10nM), and 10 μl Qiagen HotStarTaq Plus Master Mix (QUIAGEN, Manchester, UK) and 1μl template. The PCR reaction took place under the following thermal cycling sequence: The reaction mixture was heated to 95°C for 5 minutes followed by 30 cycles of 94°C for 40 seconds; 55°C for 45 seconds; 72°C for 45 seconds. Thermocycling concluded with extension at 72°C for 10 minutes following which the product was held at 12°C. Following the completion of the PCR reaction, all PCR products were cleaned using a Zymo Research ZR-96 DNA Clean & Concentrator™-5 (Zymo Research, Irvine, California, USA). Samples were eluted in 50μl of DNA free water.

Sequencing

Sequencing of PCR products was carried out using Big Dye™ Terminator Cycle Sequencing Kit v 3.1 (Applied Biosystems Inc., Foster City, California, USA). The sequencing reaction comprised 3μl sequencing primer (forward or reverse) (3.2nM), 3μl sequencing template (purified PCR product) and 4μl Big Dye terminator v 3.1 (Applied Biosystems Inc., Foster City, California, USA). Thermocycling conditions: 95°C for 5 minutes followed by 25 cycles of 96°C for 10 seconds, 50°C for 5 seconds, 60°C for 3 minutes with a final extension at 72°C for 10 minutes, subsequently maintained at 12°C prior to sequencing. All products of the sequencing PCR were cleaned via passage through individual Sephadex clean up columns (Sigma-Aldrich, Gillingham, UK), to remove any unincorporated dye terminator products and diluted with 10μl of DNA free water. Sequences were generated on an Applied Biosystems Inc. 3730xl 96 capillary DNA analyser (Applied Biosystems Inc., Foster City, California, USA).

Data analyses

The forward and reverse AB1 sequence files for each sample were assembled into contigs using the software Geneious v 4.8 [26]. All 96 contigs were then aligned using the equine mtDNA d-loop reference sequence (GenBank accession number X79547 [8]), with the Geneious v 4.8 software [26]. Haplotype and DNA polymorphism analyses was conducted using DNAsp [27]. To consider haplotype sharing with other equine breeds, Basic Local Alignment Search Tool (BLAST) queries with each of the haplotypes identified in this study were conducted against the GenBank nucleotide database using Geneious [26]. In order to further, understand genetic relationships between Cleveland Bay horses and other domestic equines, the 11 haplotypes identified were compared with the sequence motifs and clades described by Jansen et al (2002) (Table 3). 13 Oct 2020 PONE-D-20-24140 Mitochondrial D-loop sequence variation and maternal lineage in the endangered Cleveland Bay horse PLOS ONE Dear Dr. Wilson, Thank you for submitting your manuscript to PLOS ONE. After careful consideration, we feel that it has merit but does not fully meet PLOS ONE’s publication criteria as it currently stands. Therefore, we invite you to submit a revised version of the manuscript that addresses the points raised during the review process. Both reviewers found it to be sound and well written. Some of the material is very horse and breed specific and this was the reason for differing opinions between the reviewers. I do have to agree with reviewer two that it would have been better to have combined your two papers on this study to provide one very robust manuscript. Please look at the nomenclature suggestion provided by reviewer one and provide a revised manuscript. Please submit your revised manuscript by Nov 27 2020 11:59PM. If you will need more time than this to complete your revisions, please reply to this message or contact the journal office at plosone@plos.org. When you're ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file. Please include the following items when submitting your revised manuscript: A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). You should upload this letter as a separate file labeled 'Response to Reviewers'. A marked-up copy of your manuscript that highlights changes made to the original version. You should upload this as a separate file labeled 'Revised Manuscript with Track Changes'. An unmarked version of your revised paper without tracked changes. You should upload this as a separate file labeled 'Manuscript'. If you would like to make changes to your financial disclosure, please include your updated statement in your cover letter. Guidelines for resubmitting your figure files are available below the reviewer comments at the end of this letter. If applicable, we recommend that you deposit your laboratory protocols in protocols.io to enhance the reproducibility of your results. Protocols.io assigns your protocol its own identifier (DOI) so that it can be cited independently in the future. For instructions see: http://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocols We look forward to receiving your revised manuscript. Kind regards, Chris Rogers Academic Editor PLOS ONE Additional Editor Comments: Thank you for your submission. Both reviewers found it to be sound and well written. Some of the material is very horse and breed specific and this was the reason for differing opinions between the reviewers. I do have to agree with reviewer two that it would have been better to have combined your two papers on this study to provide one very robust manuscript. Please look at the nomenclature suggestion provided by reviewer one and provide a revised manuscript. Journal Requirements: When submitting your revision, we need you to address these additional requirements. 1. Please ensure that your manuscript meets PLOS ONE's style requirements, including those for file naming. The PLOS ONE style templates can be found at https://journals.plos.org/plosone/s/file?id=wjVg/PLOSOne_formatting_sample_main_body.pdf and https://journals.plos.org/plosone/s/file?id=ba62/PLOSOne_formatting_sample_title_authors_affiliations.pdf 2. Thank you for stating the following in the Acknowledgments Section of your manuscript: "University of Lincoln and The Rare Breeds Survival Trust" We note that you have provided funding information that is not currently declared in your Funding Statement. However, funding information should not appear in the Acknowledgments section or other areas of your manuscript. We will only publish funding information present in the Funding Statement section of the online submission form. Please remove any funding-related text from the manuscript and let us know how you would like to update your Funding Statement. Currently, your Funding Statement reads as follows: "No" Please include your amended statements within your cover letter; we will change the online submission form on your behalf. 3.  Thank you for stating the following in your Competing Interests section: "No" Please complete your Competing Interests on the online submission form to state any Competing Interests. If you have no competing interests, please state "The authors have declared that no competing interests exist.", as detailed online in our guide for authors at http://journals.plos.org/plosone/s/submit-now This information should be included in your cover letter; we will change the online submission form on your behalf. Please know it is PLOS ONE policy for corresponding authors to declare, on behalf of all authors, all potential competing interests for the purposes of transparency. PLOS defines a competing interest as anything that interferes with, or could reasonably be perceived as interfering with, the full and objective presentation, peer review, editorial decision-making, or publication of research or non-research articles submitted to one of the journals. Competing interests can be financial or non-financial, professional, or personal. Competing interests can arise in relationship to an organization or another person. Please follow this link to our website for more details on competing interests: http://journals.plos.org/plosone/s/competing-interests 4. Your ethics statement should only appear in the Methods section of your manuscript. If your ethics statement is written in any section besides the Methods, please move it to the Methods section and delete it from any other section. Please ensure that your ethics statement is included in your manuscript, as the ethics statement entered into the online submission form will not be published alongside your manuscript. [Note: HTML markup is below. Please do not edit.] Reviewers' comments: Reviewer's Responses to Questions Comments to the Author 1. Is the manuscript technically sound, and do the data support the conclusions? The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented. Reviewer #1: Yes Reviewer #2: Yes ********** 2. Has the statistical analysis been performed appropriately and rigorously? Reviewer #1: Yes Reviewer #2: Yes ********** 3. Have the authors made all data underlying the findings in their manuscript fully available? The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified. Reviewer #1: Yes Reviewer #2: Yes ********** 4. Is the manuscript presented in an intelligible fashion and written in standard English? PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here. Reviewer #1: Yes Reviewer #2: Yes ********** 5. Review Comments to the Author Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters) Reviewer #1: This paper presents analysis of mtDNA typing of the Cleveland Bay horse, one of the world's most endangered horse breeds. The paper is well written and appropriate methods are used. I have only a couple of comments. One, the mtDNA haplotype nomenclature of Jansen has largely been replaced by that of Achilli et al. 2012. Using Jansen is ok but Achilli should also be used concurrently. The diversity of mtDNA in the CB is consistent with the low nuclear DNA variation that has recently been reported and the high inbreeding level within the breed. It is interesting how well the maternal lines predicted by pedigree analysis are aligned with the mtDNA haplotypes. I also am somewhat surprised by how high the proportion of haplotypes representing horses from the British Isles is. Within breed ancestry representations are often quite diverse representing past intermixing of horses prior to breed formation. I also will say that the diversity shown does not indicate that the Chapman horse is not the direct link to all parts of the CB ancestry as there is no knowledge of the make-up of that horse. My one negative comment is not actually a criticism of the paper. This paper has a great deal of very specific information about the make-up of the individuals that comprise the breed. This has almost no meaning to most potential readers but is valuable information for the specialist. The great detail of the specific maternal lines and groups within the breed make certain sections of this paper very difficult to follow. In fact the paper presents little that is new except in reference to the breed. The paper might be more appropriate for a different journal although I don't have a specific recommendation for one. Reviewer #2: The current study aimed to establish maternal lineages within the Cleveland Bay Horse breed and detect relationships with other domestic horse breeds. The Cleveland Bay Horse is a very important breed and known to have low genetic diversity. The authors used typical methods for the data analysis of part of the D-loop. I think sequencing the full D-loop would be more informative especially with the high level of similarity seen among tested samples. Although the results and discussion were well written, the approach and results are lacking novelty, very specific to horses and not applicable for novel discoveries in other species. The overall outcomes of the current study might be interesting and useful for a narrow group of readers. More importantly, I wish the authors have included the finding of this study with their previous paper. The story could be then much informative by integrating the autosomal genetics findings in the light of the mtDNA sequencing instead of having them separated in two manuscripts. ********** 6. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files. If you choose “no”, your identity will remain anonymous but your review may still be made public. Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy. Reviewer #1: No Reviewer #2: No [NOTE: If reviewer comments were submitted as an attachment file, they will be attached to this email and accessible via the submission site. Please log into your account, locate the manuscript record, and check for the action link "View Attachments". If this link does not appear, there are no attachment files.] While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com/. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Registration is free. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email PLOS at figures@plos.org. Please note that Supporting Information files do not need this step. 30 Oct 2020 Reviewer #1: This paper presents analysis of mtDNA typing of the Cleveland Bay horse, one of the world's most endangered horse breeds. The paper is well written and appropriate methods are used. I have only a couple of comments. One, the mtDNA haplotype nomenclature of Jansen has largely been replaced by that of Achilli et al. 2012. Using Jansen is ok but Achilli should also be used concurrently. The nomenclature from Achilli has been incorporated within Table 2. The diversity of mtDNA in the CB is consistent with the low nuclear DNA variation that has recently been reported and the high inbreeding level within the breed. It is interesting how well the maternal lines predicted by pedigree analysis are aligned with the mtDNA haplotypes. I also am somewhat surprised by how high the proportion of haplotypes representing horses from the British Isles is. Within breed ancestry representations are often quite diverse representing past intermixing of horses prior to breed formation. I also will say that the diversity shown does not indicate that the Chapman horse is not the direct link to all parts of the CB ancestry as there is no knowledge of the make-up of that horse. My one negative comment is not actually a criticism of the paper. This paper has a great deal of very specific information about the make-up of the individuals that comprise the breed. This has almost no meaning to most potential readers but is valuable information for the specialist. The great detail of the specific maternal lines and groups within the breed make certain sections of this paper very difficult to follow. In fact the paper presents little that is new except in reference to the breed. The paper might be more appropriate for a different journal although I don't have a specific recommendation for one. Reviewer #2: The current study aimed to establish maternal lineages within the Cleveland Bay Horse breed and detect relationships with other domestic horse breeds. The Cleveland Bay Horse is a very important breed and known to have low genetic diversity. The authors used typical methods for the data analysis of part of the D-loop. I think sequencing the full D-loop would be more informative especially with the high level of similarity seen among tested samples. Although the results and discussion were well written, the approach and results are lacking novelty, very specific to horses and not applicable for novel discoveries in other species. The overall outcomes of the current study might be interesting and useful for a narrow group of readers. More importantly, I wish the authors have included the finding of this study with their previous paper. The story could be then much informative by integrating the autosomal genetics findings in the light of the mtDNA sequencing instead of having them separated in two manuscripts. We thank the reviewers for their comments, and their careful assessment of the manuscript. 10 Nov 2020 PONE-D-20-24140R1 Mitochondrial D-loop sequence variation and maternal lineage in the endangered Cleveland Bay horse PLOS ONE Dear Dr. Wilson, Thank you for submitting your manuscript to PLOS ONE. After careful consideration, we feel that it has merit but does not fully meet PLOS ONE’s publication criteria as it currently stands. Therefore, we invite you to submit a revised version of the manuscript that addresses the points raised during the review process. Please look at the revised manuscript in the results section. In the copy uploaded there are a number of occurrences of the following Error! Reference source not found Please submit your revised manuscript by Dec 25 2020 11:59PM. If you will need more time than this to complete your revisions, please reply to this message or contact the journal office at plosone@plos.org. When you're ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file. Please include the following items when submitting your revised manuscript: A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). You should upload this letter as a separate file labeled 'Response to Reviewers'. A marked-up copy of your manuscript that highlights changes made to the original version. You should upload this as a separate file labeled 'Revised Manuscript with Track Changes'. An unmarked version of your revised paper without tracked changes. You should upload this as a separate file labeled 'Manuscript'. If you would like to make changes to your financial disclosure, please include your updated statement in your cover letter. Guidelines for resubmitting your figure files are available below the reviewer comments at the end of this letter. If applicable, we recommend that you deposit your laboratory protocols in protocols.io to enhance the reproducibility of your results. Protocols.io assigns your protocol its own identifier (DOI) so that it can be cited independently in the future. For instructions see: http://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocols We look forward to receiving your revised manuscript. Kind regards, Chris Rogers Academic Editor PLOS ONE Additional Editor Comments (if provided): Please look at the revised manuscript in the results section. In the copy uploaded there are a number of occurrences of the following Error! Reference source not found Please correct and upload a new version. [Note: HTML markup is below. Please do not edit.] [NOTE: If reviewer comments were submitted as an attachment file, they will be attached to this email and accessible via the submission site. Please log into your account, locate the manuscript record, and check for the action link "View Attachments". If this link does not appear, there are no attachment files.] While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com/. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Registration is free. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email PLOS at figures@plos.org. Please note that Supporting Information files do not need this step. 10 Nov 2020 Dear Colleagues, Further to our recent submission, we have modified the main manuscript to refer to our first paper concerning the genetic analysis of the Cleveland Bay horse population through pedigree evaluations and molecular methods. Furthermore, we have reiterated the tutorial-based nature of our initial paper, which guides the reader through our framework and proposes its implementation in the decision-making process for conservation of endangered breeds and species. Whilst we recognise the points of the Editorial Office in terms of segmenting research projects, the authors would like to firmly stress that these pieces of work are not only standalone, but represent logical and careful developments of the narrative as part of the large project we continue to undertake in conserving the Cleveland Bay horse and the native equine breeds of the United Kingdom. Whilst we use these breeds as examples herein, our approaches are careful to be extendable not just to equines and livestock, but in wider conservation practices. Furthermore, according to the email dated 10th November 2020, we have amended the manuscript to remove the “Error! Reference source not found” therein. Updates to statements based on the requests from Editorial Office: 1) Thank you for updating your data availability statement. You note that your data are available within the Supporting Information files, but no such files have been included with your submission. At this time we ask that you please upload your minimal data set as a Supporting Information file, or to a public repository such as Figshare or Dryad. Please also ensure that when you upload your file you include separate captions for your supplementary files at the end of your manuscript. As soon as you confirm the location of the data underlying your findings, we will be able to proceed with the review of your submission. Authors: These data have been provided: 10.6084/m9.figshare.13154429. The statements have also been amended. 2) Your ethics statement should only appear in the Methods section of your manuscript. If your ethics statement is written in any section besides the Methods, please move it to the Methods section and delete it from any other section. Please ensure that your ethics statement is included in your manuscript, as the ethics statement entered into the online submission form will not be published alongside your manuscript. Authors: This has been moved. 3) It is important that you include a cover letter with your manuscript. Please ensure that this letter is addressed specifically to PLoS ONE. Please also include * why this manuscript is suitable for publication in PLoS ONE. * how does your paper provide a worthwhile addition to the scientific literature? * how does your paper relate to previously published work? * which types of scientists do you believe will be most interested in your study? Authors: This serves as the document. 4) Thank you for stating the following financial disclosure: NO At this time, please address the following queries: a) Please clarify the sources of funding (financial or material support) for your study. List the grants or organizations that supported your study, including funding received from your institution. b) State what role the funders took in the study. If the funders had no role in your study, please state: “The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.” c) If any authors received a salary from any of your funders, please state which authors and which funders. d) If you did not receive any funding for this study, please state: “The authors received no specific funding for this work.” Authors: The authors received no specific funding for this work. Please include your amended statements within your cover letter; we will change the online submission form on your behalf. 5) Thank you for stating the following in your Competing Interests section: "No" Please complete your Competing Interests on the online submission form to state any Competing Interests. If you have no competing interests, please state "The authors have declared that no competing interests exist.", as detailed online in our guide for authors at https://eur03.safelinks.protection.outlook.com/?url=http%3A%2F%2Fjournals.plos.org%2Fplosone%2Fs%2Fsubmit-now&data=04%7C01%7Cphilippe.wilson%40ntu.ac.uk%7Cb7c2ef235df54ce631fe08d87b5be85f%7C8acbc2c5c8ed42c78169ba438a0dbe2f%7C0%7C0%7C637394981962863769%7CUnknown%7CTWFpbGZsb3d8eyJWIjoiMC4wLjAwMDAiLCJQIjoiV2luMzIiLCJBTiI6Ik1haWwiLCJXVCI6Mn0%3D%7C1000&sdata=ex8IGrShDq%2B7e39fAIsGyALzEK6Z7TDaR0HTS5u2E4c%3D&reserved=0 This information should be included in your cover letter; we will change the online submission form on your behalf. Authors: The authors have declared that no competing interests exist Original letter: Herein, we consider the genetic diversity within the Cleveland Bay horse population, one of the oldest and most foundationally integral equine breeds. Indeed, until now, there was little convincing evidence concerning the loss of genetic variation within the breed, across the generations, leading to a status as endangered as that today. We therefore approach the problem of rigorously developing breed management plans for a critically endangered population such as the Cleveland Bay horse by first considering the genealogical and molecular data pertaining to the generational genetic history of the breed. The Cleveland Bay horse is a historic breed of horse native to the UK which has been widely used throughout the equine world for generations. However, since the move to mechanization, its uses on land, in the field became limited and the population threatened. Now critically endangered, the breed must be subject to strict management based on genetic factors in order to increase diversity therein and safeguard the Cleveland Bay for future generations. Herein, we demonstrate that only four original female lines are represented in the current population, and consider the evolution of the breed from the now-extinct Chapman Horse. We present the methodology as a powerful tool for conservation, both livestock and in applications to wild species in situ. Furthermore, we dispel previous assumptions regarding the lineage and ancestry of the modern Cleveland Bay population. Whilst being evidently pertinent to livestock and native breed conservation biology, our approach is inherently translatable to in situ conservation of species more globally. Indeed, our follow-up paper on this work, develops this study and describes 16 years of breed management programmes, and their effect on the genetic diversity within the population; work which could not have taken place without the robust and necessary first principles established within the present study. In addition to a robustly-researched and thoroughly described methodology, we present the logical development of the work and fundamental theory throughout in order for this work to be recognised as a valuable standalone resource for biological conservationists. We suggest the following colleagues as reviewers for this manuscript: Prof Stephen Hall: stHall@lincoln.ac.uk Prof Tim Morris: Tim.Morris@nottingham.ac.uk Dr Tim Bray: tbray@bristolzoo.org.uk We hope you will consider this manuscript with the attention it deserves, and look forward to receiving your feedback. With kind regards, Prof Philippe B. Wilson MChem(Hons) PhD PGCertHE MRSC FRSB FLS FHEA Submitted filename: R1ResponseToReviewersmtDNACBH.docx Click here for additional data file. 18 Nov 2020 Mitochondrial D-loop sequence variation and maternal lineage in the endangered Cleveland Bay horse PONE-D-20-24140R2 Dear Dr. Wilson, We’re pleased to inform you that your manuscript has been judged scientifically suitable for publication and will be formally accepted for publication once it meets all outstanding technical requirements. Within one week, you’ll receive an e-mail detailing the required amendments. When these have been addressed, you’ll receive a formal acceptance letter and your manuscript will be scheduled for publication. An invoice for payment will follow shortly after the formal acceptance. To ensure an efficient process, please log into Editorial Manager at http://www.editorialmanager.com/pone/, click the 'Update My Information' link at the top of the page, and double check that your user information is up-to-date. If you have any billing related questions, please contact our Author Billing department directly at authorbilling@plos.org. If your institution or institutions have a press office, please notify them about your upcoming paper to help maximize its impact. If they’ll be preparing press materials, please inform our press team as soon as possible -- no later than 48 hours after receiving the formal acceptance. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information, please contact onepress@plos.org. Kind regards, Chris Rogers Academic Editor PLOS ONE Additional Editor Comments (optional): Reviewers' comments: 20 Nov 2020 PONE-D-20-24140R2 Mitochondrial D-loop sequence variation and maternal lineage in the endangered Cleveland Bay horse Dear Dr. Wilson: I'm pleased to inform you that your manuscript has been deemed suitable for publication in PLOS ONE. Congratulations! Your manuscript is now with our production department. If your institution or institutions have a press office, please let them know about your upcoming paper now to help maximize its impact. If they'll be preparing press materials, please inform our press team within the next 48 hours. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information please contact onepress@plos.org. If we can help with anything else, please email us at plosone@plos.org. Thank you for submitting your work to PLOS ONE and supporting open access. Kind regards, PLOS ONE Editorial Office Staff on behalf of Dr. Chris Rogers Academic Editor PLOS ONE
  17 in total

1.  BLAT--the BLAST-like alignment tool.

Authors:  W James Kent
Journal:  Genome Res       Date:  2002-04       Impact factor: 9.043

2.  DnaSP v5: a software for comprehensive analysis of DNA polymorphism data.

Authors:  P Librado; J Rozas
Journal:  Bioinformatics       Date:  2009-04-03       Impact factor: 6.937

3.  Widespread origins of domestic horse lineages.

Authors:  C Vilà; J A Leonard; A Gotherstrom; S Marklund; K Sandberg; K Liden; R K Wayne; H Ellegren
Journal:  Science       Date:  2001-01-19       Impact factor: 47.728

4.  The Lusitano horse maternal lineage based on mitochondrial D-loop sequence variation.

Authors:  M S Lopes; D Mendonça; T Cymbron; M Valera; J da Costa-Ferreira; A da Câmara Machado
Journal:  Anim Genet       Date:  2005-06       Impact factor: 3.169

5.  Phylogenetic relationships of Cheju horses to other horse breeds as determined by mtDNA D-loop sequence polymorphism.

Authors:  K I Kim; Y H Yang; S S Lee; C Park; R Ma; J L Bouzat; H A Lewin
Journal:  Anim Genet       Date:  1999-04       Impact factor: 3.169

6.  Mitochondrial DNA and the origins of the domestic horse.

Authors:  Thomas Jansen; Peter Forster; Marsha A Levine; Hardy Oelke; Matthew Hurles; Colin Renfrew; Jurgen Weber; Klaus Olek
Journal:  Proc Natl Acad Sci U S A       Date:  2002-07-18       Impact factor: 11.205

7.  Mitochondrial sequence variation in ancient horses from the Carpathian Basin and possible modern relatives.

Authors:  K Priskin; K Szabó; G Tömöry; E Bogácsi-Szabó; B Csányi; R Eördögh; C S Downes; I Raskó
Journal:  Genetica       Date:  2009-09-30       Impact factor: 1.082

8.  Genome sequence, comparative analysis, and population genetics of the domestic horse.

Authors:  C M Wade; E Giulotto; S Sigurdsson; M Zoli; S Gnerre; F Imsland; T L Lear; D L Adelson; E Bailey; R R Bellone; H Blöcker; O Distl; R C Edgar; M Garber; T Leeb; E Mauceli; J N MacLeod; M C T Penedo; J M Raison; T Sharpe; J Vogel; L Andersson; D F Antczak; T Biagi; M M Binns; B P Chowdhary; S J Coleman; G Della Valle; S Fryc; G Guérin; T Hasegawa; E W Hill; J Jurka; A Kiialainen; G Lindgren; J Liu; E Magnani; J R Mickelson; J Murray; S G Nergadze; R Onofrio; S Pedroni; M F Piras; T Raudsepp; M Rocchi; K H Røed; O A Ryder; S Searle; L Skow; J E Swinburne; A C Syvänen; T Tozaki; S J Valberg; M Vaudin; J R White; M C Zody; E S Lander; K Lindblad-Toh
Journal:  Science       Date:  2009-11-06       Impact factor: 47.728

9.  High altitude adaptation and phylogenetic analysis of Tibetan horse based on the mitochondrial genome.

Authors:  Shuqing Xu; Jiangbai Luosang; Sang Hua; Jian He; Asan Ciren; Wei Wang; Xiaomei Tong; Yu Liang; Jian Wang; Xiaoguang Zheng
Journal:  J Genet Genomics       Date:  2007-08       Impact factor: 4.275

10.  A new view on dam lines in Polish Arabian horses based on mtDNA analysis.

Authors:  Iwona Głazewska; Anna Wysocka; Barbara Gralak; Jerzy Sell
Journal:  Genet Sel Evol       Date:  2007-09-27       Impact factor: 4.297

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.