Literature DB >> 33270659

Assessment of Vibrio parahaemolyticus levels in oysters (Crassostrea virginica) and seawater in Delaware Bay in relation to environmental conditions and the prevalence of molecular markers to identify pathogenic Vibrio parahaemolyticus strains.

Esam Almuhaideb1, Lathadevi K Chintapenta2, Amanda Abbott2, Salina Parveen3, Gulnihal Ozbay2.   

Abstract

This study identified Vibrio parahaemolyticus in oyster and seawater samples collected from Delaware Bay from June through October of 2016. Environmental parameters including water temperature, salinity, dissolved oxygen, pH, and chlorophyll a were measured per sampling event. Oysters homogenate and seawater samples were 10-fold serially diluted and directly plated on CHROMagarᵀᴹ Vibrio medium. Presumptive V. parahaemolyticus colonies were counted and at least 20% of these colonies were selected for molecular chracterization. V. parahaemolyticus isolates (n = 165) were screened for the presence of the species-specific thermolabile hemolysin (tlh) gene, the pathogenic thermostable direct hemolysin (tdh)/ thermostable related hemolysin (trh) genes, the regulatory transmembrane DNA-binding gene (toxR), and V. parahaemolyticus metalloprotease (vpm) gene using a conventional PCR. The highest mean levels of the presumptive V. parahaemolyticus were 9.63×103 CFU/g and 1.85×103 CFU/mL in the oyster and seawater samples, respectively, during the month of July. V. parahaemolyticus levels in oyster and seawater samples were significantly positively correlated with water temperature. Of the 165 isolates, 137 (83%), 110 (66.7%), and 108 (65%) were tlh+, vpm+, and toxR+, respectively. Among the V. parahaemolyticus (tlh+) isolates, 7 (5.1%) and 15 (10.9%) were tdh+ and trh+, respectively, and 24 (17.5%), only oyster isolates, were positive for both genes. Potential pathogenic strains that possessed tdh and/or trh were notably higher in oyster (39%) than seawater (15.6%) isolates. The occurrence of total V. parahaemolyticus (tlh+) was not necessarily proportional to the potential pathogenic V. parahaemolyticus. Co-occurrence of the five genetic markers were observed only among oyster isolates. The co-occurrence of the gene markers showed a relatedness potential of tdh occurrence with vpm. We believe exploring the role of V. parahaemolyticus metalloprotease and whether it is involved in the toxic activity of the thermostable direct hemolysin (TDH) protein can be of significance. The outcomes of this study will provide some foundation for future studies regarding pathogenic Vibrio dynamics in relation to environmental quality.

Entities:  

Year:  2020        PMID: 33270659      PMCID: PMC7714158          DOI: 10.1371/journal.pone.0242229

Source DB:  PubMed          Journal:  PLoS One        ISSN: 1932-6203            Impact factor:   3.240


Introduction

Vibrio parahaemolyticus is a gram-negative, halophilic, pathogenic bacterium that negatively impact aquatic ecosystems and human health [1-3]. They are curved rods, motile with a single polar flagellum and belong to the family Vibrionaceae. It is an endemic pathogen in the marine environment that was first identified as a cause of food-borne illness in Japan in 1950 [4, 5]. V. parahaemolyticus is one of the key causes of gastroenteritis leading to diarrhea, headache, vomiting, and abdominal cramps following the consumption of contaminated food or water. In addition, this bacterium can cause septicemia and wound infections [3, 6]. In aquatic ecosystems, organisms like oysters which are filter-feeding mollusks, tend to accumulate different microorganisms from seawater during their filtration [7-9]. Therefore, they are able to accumulate V. parahaemolyticus 100-fold higher than the surrounding water [8, 9]. During the warmer months, V. parahaemolyticus occurrence in oysters can reach 100% [8]. While some V. parahaemolyticus strains are associated with marine animal diseases [10], most strains are investigated as a major concern to human health [11]. V. parahaemolyticus infections are associated with the consumption of seafood, particularly raw or undercooked oysters, and accounted for 59.5% of laboratory-confirmed Vibrionaceae in the United States [11]. In 2006, a total of 177 V. parahaemolyticus infections were reported from New York, Oregon, and Washington states, and the laboratory-confirmed cases were over three-fold higher than the average number in all US states during the same period of 2002–2004 [12]. An outbreak of V. parahaemolyticus involving three people was reported in Maryland, August 2012 [13]. A multistate outbreak of 16 gastrointestinal illnesses linked to oysters were reported in 2019, and four of them were associated with V. parahaemolyticus [14]. The estimated annual mean cost of foodborne illnesses associated with V. parahaemolyticus was over US $40 million [15]. V. parahaemolyticus strains possess tlh species specific gene, which codes for thermolabile hemolysin (TLH) [16, 17]. The virulence of most clinical V. parahaemolyticus isolates are associated with the expression of tdh (thermostable direct hemolysin (TDH)) and/or trh (TDH-related hemolysin-(TRH)) genes [18-20]. Both tdh/trh genes are associated with β hemolysis on Wagatsuma blood agar, which is known as the Kanagawa phenomenon, and both have been used as accepted genetic markers for the detection of pathogenic V. parahaemolyticus in seafood [21-23]. Although, TDH/TRH proteins are the main pathogenic factors in V. parahaemolyticus [24], research also shows that many of the clinical isolates possess neither tdh nor trh genes indicating the potential presence of other virulence-related factors [25, 26]. V. parahaemolyticus harbors a V. parahaemolyticus metalloprotease (vpm) gene that expresses extracellular zinc metalloprotease and shows sufficient proteolytic activity towards type I collagen [27, 28]. V. parahaemolyticus metalloprotease can also degrade host tissue and may promote pathogen invasion [2]. On the other hand, metalloprotease has been investigated and found to be significant as a virulence factor among Vibrio spp. [28]. Metalloprotease was reported to have an important role on the extracellular cleavage and activation process of the V. cholerae enterotoxic hemolysin into mature hemolysin [29-32]. Therefore, exploring the prevalence and co-occurrence of vpm and tdh/trh genes in environmental strains of V. parahaemolyticus can be of significance. The transmembrane DNA-binding protein, ToxR, is a regulatory protein in V. parahaemolyticus that is encoded by toxR gene. The ToxR protein is strongly associated with the upregulation of the gene encoding the virulence toxin TDH [33]. Genome sequencing of pathogenic V. parahaemolyticus revealed another virulence factor called type III secretion systems (T3SS), T3SS1and T3SS2, by which bacterial proteins (effectors) are injected directly into host cells [34]. An infant rabbit model infected with V. parahaemolyticus revealed that T3SS2 is essential for intestinal colonization [35]. In addition, T3SS2 is also considered as a prime virulence factor of V. parahaemolyticus enterotoxicity [35-37]. It has been reported that ToxR has no role in the production of T3SS2 [38]; however, a later study identified an uncharacterized component of T3SS2 to be critically regulated by ToxR [39]. Furthermore, toxR gene is very important to the bile resistance in the intestine, and the toxR mutant strains have significantly lower minimal bactericidal concentration compared to the wild strains [40, 41]. In addition, toxR gene is required for stress tolerance and colonization of V. parahaemolyticus [40]. On the other hand, similar to the tlh gene, toxR can be a reliable gene for the detection of V. parahaemolyticus, and many studies have used it as V. parahaemolyticus species-specific gene marker [42-44]. Studies also indicate that tlh and toxR genes have a compatible and robust result in terms of reliability and specificity for molecular identification of V. parahaemolyticus [16, 45]. Findings and reports from previous literature highlight the important relationships among the tlh, trh, tdh, vpm and toxR genes in terms of pathogenicity and identification of environmental V. parahaemolyticus associated with human infections. Therefore, our study aimed to screen the above-mentioned genetic markers to further illustrate the prevalence and patterns of these genetic markers in environmental strains of V. parahaemolyticus. Delaware Bay is the prime oyster ground on the Atlantic coast providing ecological and commercial resources [46]. V. parahaemolyticus outbreaks are one of the leading causes for the closures of commercial shellfish industries on the east coast of the United States [47, 48]. This study was conducted to detect and determine total and potential pathogenic V. parahaemolyticus levels in oyster and seawater samples from Delaware Bay. Direct plating on CHROMagar Vibrio was used since it is a well-established method, allowing V. parahaemolyticus to be simultaneously isolated and differentiated from other Vibrio species, and it has a less inhibitory effect on V. parahaemolyticus growth than TCBS media [49-51]. This study also examined the correlation of V. parahaemolyticus levels in oyster and seawater samples in relation to the physico-chemical parameters. Along with the above-mentioned aims, we reported the co-occurrences of the five genetic markers (tlh, tdh, trh, toxR, and vpm) in the environmental strains of V. parahaemolyticus. To the best of our knowledge there are no published studies on the prevalence and co-occurrence of these genetic markers among V. parahaemolyticus in the Mid-Atlantic region. Furthermore, the regional variation in ecology of V. parahaemolyticus indicates the need of site-specific data, and this study provides a new set of data specific for the Delaware Bay region.

Materials and methods

Study location and sampling

Field sampling collection was granted by the Department of Natural Resources and Environmental Control (DNREC) in 2016 of sampling year. Oysters and seawater samples were collected once a month from June to October 2016 from Bowers Beach (BB) [39°03'25.5"N 75°23'56.8"W] and Lewes, Broadkill (LW) [38°47'26.3"N 75°09'50.2"W] in the Delaware Bay. A third site, Slaughter Beach (SL) [38°56'50.1"N 75°18'52.4"W] was added to this study from August to October 2016 (Fig 1) to assess a wider range of the Delaware Bay area. Ten to twelve oysters from each site were harvested (one site per week) into Ziploc bags (SC Johnson & Sons, Racine, WI, USA), sub-divided into three groups for biological triplicates (A, B, and C), and placed in an insulated cooler with ice packs to maintain the temperature between 2–10°C [52]. One liter of seawater was collected from each site at the same time. Water quality parameters such as water temperature, salinity, turbidity, dissolved oxygen, pH, and chlorophyll a were recorded onsite using YSI 556 Handheld Multiparameter Instrument (YSI Incorporated, Yellow Springs, OH, USA) to assess the relationship between these parameters and the Colony Forming Units (CFUs) of Vibrio parahaemolyticus.
Fig 1

Study locations in Delaware Bay.

Processing of oyster and seawater samples

Ten to twelve oysters were collected from each site and divided into three groups to be analyzed in triplicates. For each replicate 3–4 oysters were cleaned upon arrival at the Aquatic Laboratory using a scrub brush and tap water before they were shucked with sterile knives. Oysters tissues and liquors from each replicate were placed into a sterilized blender jar (Waring Commercial, 7010S) and blended for 90 sec at high speed. Twenty-five grams of the blended tissue was diluted with 225 mL of 0.1% Peptone Water (PW; 1 g of peptone [BD, Bacto™ Peptone, 211677], 10 g of NaCl [Fisher scientific, S271], 1 liter of dH2O, pH 7.4 ± 0.2) and blended again for 60 sec at high speed to prepare the homogenate. This homogenate was labelled as the first (10−1) dilution. The oyster homogenate and seawater samples from each site were aseptically serial diluted in 0.1% PW to a final dilution of (10−6). Following the American Public Health Association Standard [53], one hundred microliters of each dilution [10– – 10–] of both seawater and oyster homogenate samples from each site were aseptically spread plated in duplicate on CHROMagar medium (CHROMagar™ Vibrio, VB912), and incubated for 24 h at 37°C.

Identification and isolation of V. parahaemolyticus

V. parahaemolyticus were identified as mauve colonies on the CHROMagar plates. Each plate with a countable range of 20 to 200 colonies was selected to calculate the number of colony forming units (CFU) of the presumptive V. parahaemolyticus [51]. Using a sterile loop, at least 20% of the mauve colonies from each plate were chosen and inoculated aseptically into a 1.5 mL microcentrifuge tube of Tryptone Soy Broth (TSB; Thermo Fisher Scientific Inc, OXOID, CM0129) supplemented with 1% NaCl, and incubated with shaking (175 rpm) overnight at 37°C (New Brunswick Scientific I 24 Incubator Shaker Series). Microcentrifuge tubes were then centrifuged at 15,000 rpm for 2 min (Eppendorf Centrifuge 5424), and the supernatant was discarded. Equal amounts (600 μL) of Alkaline Peptone Water (APW; 10 g of peptone, 10 g of NaCl, 1 liter of dH2O, pH 8.5 ± 0.2) and TSB + [24% glycerol, BP229, Fisher BioReagents™] were added and the pellet was resuspended and then frozen at -20°C for further molecular analysis. Samples were prepared for PCR by boiling for 10 min, and immediately chilled on ice (2 min) for cell lysis and DNA release.

Molecular analysis (PCR procedures and conditions)

Presumptive V. parahaemolyticus isolates were further typed for the genetic markers tlh, tdh, trh, toxR, and vpm using five sets of primers previously assessed [16, 54]. The PCR reaction mixture (10 μL) consisted of 1 μL of cell lysate as DNA template, 2 μL (1.5 mM MgCl2) of the reaction buffer (5X Green GoTaq® Reaction Buffer; PROMEGA, USA), 0.1 μL (0.5 U) of Taq polymerase (Taq; PROMEGA; USA), 0.4 μL (100 μM) of 2.5 mM deoxynucleotide mix, 0.2 μL (0.2 μM) of each forward and reverse primers (IDT; USA), and 6.1 μL of nuclease free water. The amplification conditions for tlh, tdh, trh, toxR, and vpm genes are shown in (Table 1), and PCR reactions were performed using S1000 thermal cycler (Bio-Rad). One μL of nuclease free water was used for the no template control and 1 μL of V. parahaemolyticus SPRC 10290 cell lysate was used as a positive control [55, 56]. Gel electrophoresis (FB-SB-1316; Electrophoresis System; Fisher Scientific; USA) was used to analyze the PCR amplicons in 1% agarose gels containing 0.5 μg/ml ethidium bromide [Fisher BioReagents]. The gels were overlaid with 1x Tris acetate-EDTA buffer and run at 130 V for 30–45 min. DNA bands were visualized using a gel documentation system (Syngene, G: BOX EF).
Table 1

PCR conditions and primers sequences used in this study.

GenePrimer sequencesCycling conditions
tlhF-tlh: ACTCAACACAAGAAGAGATCGACAACycles: 30
R-tlh: GATGAGCGGTTGATGTCCAA
tdhF-tdh: TCCCTTTTCCTGCCCCCDenaturation temp: 95°C/30 sec
R-tdh: CGCTGCCATTGTATAGTCTTTATCAnnealing temp: 60°C/45 sec
Extension temp: 68°C/1 min
trhF-trh: TTGCTTTCAGTTTGCTATTGGCT
R-trh: TGTTTACCGTCATATAGGCGCTT
toxRtoxR-4: GTCTTCTGACGCAATCGTTGCycles: 35
toxR-7: ATACGAGTGGTTGCTGTCATGDenaturation temp: 94°C/1 min
vpmvpm 1: CAGCTACCGAAACAGACGCTAAnnealing temp: 58°C/1 min
vpm 2: TCCTATCGAGGACTCTCTCAACExtension temp: 72°C/1 min

Data analysis

For statistical analysis, the CFU values of presumptive V. parahaemolyticus were log10 transformed to normalize the data, and the significance level (P-value) of 0.05 was used. Spearman’s rank correlation analysis was performed to measure the relationship between V. parahaemolyticus levels [log10 CFU/g (or mL)] and the parameters affecting water quality (temperature, salinity, dissolved oxygen (DO), pH, turbidity, and chlorophyll a). Independent samples t-test was used to determine whether V. parahaemolyticus levels [log10 CFU/g (or mL)] among the sample types (oyster and seawater) were significantly different. Statistical analysis was performed using IBM SPSS Statistic software (version 26).

Results and discussion

Physico-chemical water quality parameters

Physico-chemical water quality parameters (Table 2) showed that water temperatures ranged from 14.63°C (LW, October) to 28°C (BB, August). Salinity levels were in the range of 5.37 ppt (LW, October) to 32 ppt (SL, August). The lowest and highest ranges for dissolved oxygen (DO) (3.12 to 8.23 mg/L) were recorded during the months of August and October from BB and LW sites, respectively. The minimum pH value of 6.44 (LW) and maximum of 8.82 (BB) was observed during the month of October. In terms of turbidity and chlorophyll a, the minimum and maximum levels ranged from 19 to 55.35 NTU/FTU and 0.134 to 1.174 μg/L, respectively. Notably, at the LW site and during the month of October, water quality parameters displayed the lowest range of water temperature (14.63°C), minimum level of salinity (5.37 ppt), highest range of dissolved oxygen (8.23 mg/L), and minimum pH value of (6.44). The seasonal variation between temperature and dissolved oxygen previously reported in the Chesapeake Bay shows that the median temperature (°C) is inversely correlated with the dissolved oxygen median (mg/L) [57]. Another study from the same region has also reported the lowest dissolved oxygen level (5.3 mg/L), and the highest temperature (29.4°C) during the month of August [58]. This shows that temperature is inversely correlated with dissolved oxygen concentrations [59].
Table 2

Physico-chemical water quality parameters in relation to study sites and date of collection.

SiteDateTemp°CSalinity pptTurbidity NTU/FTUDissolved Oxygen mg/LChlorophyll a μg/LpH
BB06/21/201624.1820.029.06.31.28.18
07/19/201627.7427.019.03.90.77.88
08/02/201628.0025.043.53.10.87.88
09/13/201623.6726.045.14.01.18.04
10/17/201617.9125.855.18.10.28.82
LW06/07/201622.723.029.03.70.37.2
07/06/201622.9832.033.04.30.47.84
08/08/201626.4325.040.83.40.27.55
09/06/201621.3224.039.03.40.17.75
10/10/201614.635.4054.88.20.56.44
SL08/30/201626.7432.055.44.00.88.06
09/26/201620.8226.555.14.70.37.31
10/24/201614.6816.620.07.80.37.44

BB: Bowers Beach; LW: Lewes, Broadkill; SL: Slaughter Beach.

BB: Bowers Beach; LW: Lewes, Broadkill; SL: Slaughter Beach.

Concentration of V. parahaemolyticus in oyster and seawater samples

The highest mean levels of presumptive V. parahaemolyticus were 9.63×103 CFU/g in the oyster samples during the month of July from BB site. This was higher than V. parahaemolyticus (CFU) levels (6.0×102 CFU/g) detected by direct plating-colony hybridization procedure in Maryland Chesapeake Bay oysters [58]. According to the United States Food and Drug Administration (FDA) regulations and guidance, V. parahaemolyticus levels (Kanagawa positive or negative) in this study did not exceed the safety limits (≥ 1×104 CFU/g) [60]. Clearly, all presumptive V. parahaemolyticus (CFU) levels, agree well with the strong correlations between water temperature and V. parahaemolyticus densities that are reported in the literature [58, 61–63], indicating that V. parahaemolyticus levels increases with the rise of temperature and vice versa (Table 3). V. parahaemolyticus concentrations from seawater samples were notably lower than oyster samples (Table 3), demonstrating that oysters can concentrate the Vibrio species higher than 10-fold compared to the surrounding water [8, 9]. This results are in agreement with studies conducted on the Pacific, Atlantic and Gulf Coasts of the United States [58, 64, 65]. However, Independent samples t-test indicated that there was no statistically significant difference in mean V. parahaemolyticus log10 CFU/g (or ml) values between sample types (oyster–seawater), t(24) = 1.159, P = 0.258 (P > 0.05). Seawater samples from LW in July, with the highest range of salinity, had low CFU/mL counts compared to BB during the same month indicating that there are parameters other than temperature that may have affected the growth of V. parahaemolyticus [61]. During the month of October, V. parahaemolyticus levels were undetectable (<10 CFU/g (or mL)) in both oyster and seawater samples from LW and SL sites. However, V. parahaemolyticus concentrations in the oyster and seawater samples at site BB were 1.7×10 and 3.3×10 CFU/g or mL, respectively. Although V. parahaemolyticus in oysters and seawater was not detectable in some sampling events, the lowest detectable reading in oysters and seawater in this study was 1.7×10 CFU/g (or mL). Figs 2 and 3 demonstrate the log10 CFU/g (or mL) levels of V. parahaemolyticus in relation to collection time, study site, and water parameters (temperature and salinity) for oyster and seawater samples, respectively.
Table 3

Averages of V. parahaemolyticus CFU/g (or mL) in relation to sample type, study site, and collection time.

BB-OYBB-WLW-OYLW-WSL-OYSL-W
June20173336783-b- b
July963311001850167- b- b
Aug980617113311711720
Sep417<10a<10 a171733
Oct1733<10 a<10 a<10 a<10 a

OY: Oyster; W: Water; BB: Bowers Beach; LW: Lewes, Broadkill; SL: Slaughter Beach.

(Not detectable)

(No sample collection).

Fig 2

Average Vibrio parahaemolyticus levels (log10 CFU/g) in oyster samples in relation to collection time, study sites, and water parameters (temperature and salinity).

Bowers Beach (BB)—Lewes, Broadkill (LW)—Slaughter Beach (SL). * (Not detectable).

Fig 3

Average Vibrio parahaemolyticus levels (log10 CFU/mL) in seawater samples in relation to collection time, study sites, and water parameters (temperature and salinity).

Bowers Beach (BB)—Lewes, Broadkill (LW)—Slaughter Beach (SL). * (Not detectable).

Average Vibrio parahaemolyticus levels (log10 CFU/g) in oyster samples in relation to collection time, study sites, and water parameters (temperature and salinity).

Bowers Beach (BB)—Lewes, Broadkill (LW)—Slaughter Beach (SL). * (Not detectable).

Average Vibrio parahaemolyticus levels (log10 CFU/mL) in seawater samples in relation to collection time, study sites, and water parameters (temperature and salinity).

Bowers Beach (BB)—Lewes, Broadkill (LW)—Slaughter Beach (SL). * (Not detectable). OY: Oyster; W: Water; BB: Bowers Beach; LW: Lewes, Broadkill; SL: Slaughter Beach. (Not detectable) (No sample collection). Spearman’s rank correlation analysis showed that water temperature is positively and significantly (P < 0.05) correlated to the total V. parahaemolyticus (log10 CFU/g or mL) levels in oyster and seawater samples (Table 4), which is in agreement with previous studies [58, 61–63]. Salinity had no significant correlation with total V. parahaemolyticus (log10 CFU/g or mL) levels in oyster and seawater samples (Table 4). Several studies have reported conflicting results regarding the correlations between the abundance of V. parahaemolyticus and salinity. Some of these studies have found a correlation between salinity and abundance of V. parahaemolyticus [65-68], while others have not [58, 64, 69–72]. Thus, the insignificance of salinity on the abundance of V. parahaemolyticus identified in this study cannot be generalized. No significant correlation was found between dissolved oxygen and/or turbidity and the abundance of total V. parahaemolyticus (Table 4). This result is in contrast to what has been reported from studies conducted in the Chesapeake Bay [57, 58]. Both pH and chlorophyll a did not significantly correlate with total V. parahaemolyticus (log10 CFU/g or mL) levels (Table 4), and this is consistent with the previous studies from Mid-Atlantic region [57, 58, 64].
Table 4

Correlation between V. parahaemolyticus log10 CFU level and water parameters.

Water parametersSpearman’s correlation coefficient, r (OY/W)aOyster (Sig.)Seawater (Sig.)
Temp(.777/.639)b(.002)b(.019)b
Salinity(.416/.423)(.157)(.149)
Turbidity(-.393/-.306)(.184)(.309)
DO mg/l(-.368/-.528)(.216)(.064)
pH(.416/.142)(.158)(.644)
Chlorophyll a(.509/.033)(.076)(.914)

OY: oysters; W: seawater.

Correlation is significant at the 0.05 level. Sig. (2-tailed).

OY: oysters; W: seawater. Correlation is significant at the 0.05 level. Sig. (2-tailed).

Molecular identification and characterization of V. parahaemolyticus

A total of 165 presumptive V. parahaemolyticus isolates (mauve colored on CHROM agar) were further examined for the presence of the species-specific gene (tlh), and 137 (83%) were confirmed to be V. parahaemolyticus (Table 5). Previous investigation revealed that primers targeting the tlh, toxR, and vpm genes were (100%) specific for V. parahaemolyticus strains [16]. The lower occurrence of vpm (66.7%) and toxR (65.5%) genes compared to tlh (83%) gene in this study (Table 6 and Fig 4), suggests that tlh gene may occasionally produce false positive results, as a gene similar to tlh may occur in other Vibrio species specifically V. alginolyticus [7, 73]. Yet, regulatory authorities use tlh gene as a marker to assess the counts of V. parahaemolyticus and reinforce actions to control the outbreaks [74]. This study also showed that (11.7%) of the confirmed V. parahaemolyticus possessed only tlh gene (Fig 5). In contrast, toxR and/or vpm genes were only present in coexistence with tlh, tdh, and/or trh (Fig 5), suggest that toxR and vpm may be more sensitive in detecting V. parahaemolyticus. A high percentage of V. parahaemolyticus (tlh+) were observed among oysters (90.5%) compared to seawater (65.3%) samples (Table 5). At LW and SL sites, V. parahaemolyticus were not-detectable (ND) during the month of October (Table 5). About half of the confirmed V. parahaemolyticus colonies isolated from seawater (43.8%) possessed only the tlh gene indicating the necessity of other gene markers such as toxR and vpm for V. parahaemolyticus strains to survive the internal conditions and colonize oyster gut [2, 40].
Table 5

Occurrence of presumptive and confirmed (tlh+) V. parahaemolyticus isolates on CHROMagar.

SiteMonthTotal Presumptive Vp. (OY, W)Total Confirmed Vp. tlh+Confirmed Vp. Oyster tlh+Confirmed Vp. Water tlh+
BBJune16 (14, 2)15 (93.8%)13 (92.9%)2 (100%)
July36 (20, 16)34 (94.4%)20 (100%)14 (87.5%)
August22 (15, 7)18 (81.8%)14 (93.3%)4 (57.1%)
September7 (7, 0)7 (100%)7 (100%)0
October3 (2, 1)1 (33.3%)1 (50%)0
LWJune10 (10, 0)8 (80%)8 (80%)0
July40 (33, 7)36 (90%)31 (93.9%)5 (71.4%)
August16 (11, 5)11 (68.8%)7 (63.6%)4 (80%)
September1 (0, 1)000
OctoberNDNDNDND
SLAugust12 (3, 9)6 (50%)3 (100%)3 (33.3%)
September2 (1, 1)1 (50%)1 (100%)0
OctoberNDNDNDND
Total165 (116, 49)137 (83%)105 (90.5%)32 (65.3%)

ND: Not detectable; OY: Oyster; W: Water; BB: Bowers Beach; LW: Lewes, Broadkill; SL: Slaughter Beach.

Table 6

Prevalence of V. parahaemolyticus genetic markers.

SiteMonthtlh OY, Wtdh OY, Wtrh OY, Wtdh/trh OY, WtoxR OY, Wvpm OY, W
BBJune13, 21, 05, 12, 012, 011, 0
July20, 142, 23, 11, 014, 420, 7
August14, 40, 01, 00, 014, 112, 0
September7, ND0, ND0, ND0, ND6, ND6, ND
October1, 00, 00, 00, 01, 00, 0
LWJune8, 01, 00, 00, 08, 07, 0
July31, 51, 03, 121, 029, 331, 3
August7, 40, 00, 00, 07, 27, 2
SeptemberND, 0ND, 0ND, 0ND, 0ND, 0ND, 0
OctoberND, NDND, NDND, NDND, NDND, NDND, ND
SLAugust3, 30, 00, 00, 03, 32, 2
September1, 00, 00, 00, 01, 00, 0
OctoberND, NDND, NDND, NDND, NDND, NDND, ND
Total105, 325, 212, 324, 095, 1396, 14

ND: Not detectable; OY: Oyster; W: Water; BB: Bowers Beach; LW: Lewes, Broadkill; SL: Slaughter Beach.

Fig 4

Percent and number of isolates with detected tdh, trh, toxR, vpm and tlh genes in oysters and seawater.

Fig 5

Number of isolates with coexisting genes among total confirmed V. parahaemolyticus isolates.

ND: Not detectable; OY: Oyster; W: Water; BB: Bowers Beach; LW: Lewes, Broadkill; SL: Slaughter Beach. ND: Not detectable; OY: Oyster; W: Water; BB: Bowers Beach; LW: Lewes, Broadkill; SL: Slaughter Beach. Among V. parahaemolyticus (tlh+), 22.6% and 28.5% were positive for tdh and trh respectively (Table 6). This relatively low incidence of V. parahaemolyticus (tdh+/trh+) is in agreement with what has been reported in the literature for environmental isolates [58, 75–77]. Isolates that possessed tdh, trh, or both tdh/trh genes account for 33.5% of V. parahaemolyticus (tlh+) and were notably higher in oyster (39%) than seawater (15.6%) (Table 6). More than half (61%) of V. parahaemolyticus (tdh+/trh+) isolated from oysters were detected at LW site in July (Table 6). The occurrence of tdh and/or trh positive V. parahaemolyticus was not observed among the study sites during September and October (Table 6). This observation highlights the importance of understanding the dynamics and seasonal variations of pathogenic V. parahaemolyticus in Delaware Bay. The high frequency of the trh gene (n = 39) compared to the tdh gene (n = 31) agrees well with its occurrence in Gulf Coast and Chesapeake Bay oysters [58], and in South Carolina [51]. The co-occurrence of both tdh/trh genes was observed in 17.5% and 52% of total and potential pathogenic V. parahaemolyticus, respectively, and they were only among oyster isolates (Table 6). This is in contrast with a study in the Mid-Atlantic [78], in which V. parahaemolyticus with both tdh/trh genes were observed more frequently among the water isolates. V. parahaemolyticus (tlh+) as illustrated in Table 6 were not proportional to the potential pathogenic V. parahaemolyticus, and this agrees well with the previous studies [51, 78]. The occurrence of the five genetic markers showed similar patterns among oyster and seawater isolates (Fig 4). The co-occurrence of the five genetic markers among oyster isolates tested were dominated (43.9%) by tlh, toxR and vpm pattern followed by the coexistence of all five genetic markers (18.9%) (Fig 6). On the other hand, co-occurrence of tlh, toxR, and vpm were the second prevalent pattern among seawater isolates (Fig 7). Interestingly and similar to the simultaneous occurrences of tdh/trh, the coexistence of the five genetic markers were observed only among oyster isolates (Figs 6 and 7), and most of them (19/22) were detected in the LW site where the historical average salinity is close to 26 ppt compared to the BB site with a historical average salinity close to 20 ppt [79]. Variation of gene occurrence patterns among the examined isolates suggest the variation of V. parahaemolyticus clones that inhabit Delaware Bay. This study also revealed the relatedness potential of tdh occurrence with vpm, as Figs 5, 6, and 7 demonstrated that whenever tdh was present, vpm was also present but not vice versa. This indicates the importance of understanding the role of V. parahaemolyticus metalloprotease and whether it is involved in the toxic activity of the thermostable direct hemolysin (TDH) protein as is the case with V. cholerae enterotoxic hemolysin [29-32].
Fig 6

Co-existence of genes among confirmed V. parahaemolyticus isolates from oysters.

Fig 7

Co-existence of genes among confirmed V. parahaemolyticus isolates from seawater.

Conclusion

This study assessed V. parahaemolyticus levels in oysters and seawater in the Delaware Bay in relation to environmental conditions and the prevalence of key genes. Among the physico-chemical parameters assessed in this study, water temperature was the only factor that significantly positively correlated with total V. parahaemolyticus level in oyster and seawater samples. Occurrence of total V. parahaemolyticus was not necessarily proportional to the occurrence of potentially pathogenic V. parahaemolyticus. The prevalence pattern of the key genes in V. parahaemolyticus isolates from seawater does not reflect the pattern of V. parahaemolyticus isolates from oysters. The low occurrence of V. parahaemolyticus isolates that possessed tdh, trh, toxR, and/or vpm genes in seawater samples compared to oysters confirmed the significance of the bioaccumulation process by oysters as a natural nursery for potential pathogenic V. parahaemolyticus. Although salinity in this study did not significantly correlate with the V. parahaemolyticus level, the historically higher average salinity at Lewes may explain the high frequency of strains from this site that possess all five genes. Utilizing V. parahaemolyticus metalloprotease gene (vpm) as species-specific gene may provide more accurate results when assessing the prevalence and abundance of pathogenic V. parahaemolyticus, and a better understanding of the proportional correlation between the total and potentially pathogenic V. parahaemolyticus. The variation among V. parahaemolyticus isolates that we have reported indicates the difference in growth rates among Delaware Bay oysters. Future studies may focus on conducting whole genome sequencing for the V. parahaemolyticus isolates to identify the coexistence of the virulence and virulence related genes reported in the literature and illustrate the genetic diversity among V. parahaemolyticus isolates inhabiting Delaware Bay. Future studies may also focus on the role of V. parahaemolyticus metalloprotease on the toxic activity of TDH. This study provided informative data on oyster-Vibrio natural contamination factors that can be applied to the risk management programs. The outcomes of this study provide some foundation for future studies regarding pathogenic Vibrio dynamics in relation to environmental quality.

PCR data for tlh, tdh, trh. toxR, and vpm genes.

(XLSX) Click here for additional data file. 31 Jul 2020 PONE-D-20-19028 Analysis of Molecular Markers in the Environmental Strains of Vibrio Parahaemolyticus Isolated from the Oyster (Crassostrea virginica) and Water Samples of Delaware Bay PLOS ONE Dear Dr. Ozbay, Thank you for submitting your manuscript to PLOS ONE. After careful consideration, we feel that it has merit but does not fully meet PLOS ONE’s publication criteria as it currently stands. Therefore, we invite you to submit a revised version of the manuscript that addresses the points raised during the review process. Please submit your revised manuscript by Sep 14 2020 11:59PM. If you will need more time than this to complete your revisions, please reply to this message or contact the journal office at plosone@plos.org. When you're ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file. Please include the following items when submitting your revised manuscript: A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). You should upload this letter as a separate file labeled 'Response to Reviewers'. A marked-up copy of your manuscript that highlights changes made to the original version. You should upload this as a separate file labeled 'Revised Manuscript with Track Changes'. An unmarked version of your revised paper without tracked changes. You should upload this as a separate file labeled 'Manuscript'. If you would like to make changes to your financial disclosure, please include your updated statement in your cover letter. Guidelines for resubmitting your figure files are available below the reviewer comments at the end of this letter. If applicable, we recommend that you deposit your laboratory protocols in protocols.io to enhance the reproducibility of your results. Protocols.io assigns your protocol its own identifier (DOI) so that it can be cited independently in the future. For instructions see: http://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocols We look forward to receiving your revised manuscript. Kind regards, José A. Fernández Robledo, Ph.D. Academic Editor PLOS ONE Journal Requirements: When submitting your revision, we need you to address these additional requirements. 1. Please ensure that your manuscript meets PLOS ONE's style requirements, including those for file naming. The PLOS ONE style templates can be found at https://journals.plos.org/plosone/s/file?id=wjVg/PLOSOne_formatting_sample_main_body.pdf and https://journals.plos.org/plosone/s/file?id=ba62/PLOSOne_formatting_sample_title_authors_affiliations.pdf 2. In your Methods section, please provide additional location information of the study sites, including geographic coordinates for the data set if available. 3. In your Data Availability statement, you have not specified where the minimal data set underlying the results described in your manuscript can be found. PLOS defines a study's minimal data set as the underlying data used to reach the conclusions drawn in the manuscript and any additional data required to replicate the reported study findings in their entirety. All PLOS journals require that the minimal data set be made fully available. For more information about our data policy, please see http://journals.plos.org/plosone/s/data-availability. Upon re-submitting your revised manuscript, please upload your study’s minimal underlying data set as either Supporting Information files or to a stable, public repository and include the relevant URLs, DOIs, or accession numbers within your revised cover letter. For a list of acceptable repositories, please see http://journals.plos.org/plosone/s/data-availability#loc-recommended-repositories. Any potentially identifying patient information must be fully anonymized. Important: If there are ethical or legal restrictions to sharing your data publicly, please explain these restrictions in detail. Please see our guidelines for more information on what we consider unacceptable restrictions to publicly sharing data: http://journals.plos.org/plosone/s/data-availability#loc-unacceptable-data-access-restrictions. Note that it is not acceptable for the authors to be the sole named individuals responsible for ensuring data access. We will update your Data Availability statement to reflect the information you provide in your cover letter. 4. PLOS requires an ORCID iD for the corresponding author in Editorial Manager on papers submitted after December 6th, 2016. Please ensure that you have an ORCID iD and that it is validated in Editorial Manager. To do this, go to ‘Update my Information’ (in the upper left-hand corner of the main menu), and click on the Fetch/Validate link next to the ORCID field. This will take you to the ORCID site and allow you to create a new iD or authenticate a pre-existing iD in Editorial Manager. Please see the following video for instructions on linking an ORCID iD to your Editorial Manager account: https://www.youtube.com/watch?v=_xcclfuvtxQ 5. We note that Figure 1 in your submission contain map images which may be copyrighted. All PLOS content is published under the Creative Commons Attribution License (CC BY 4.0), which means that the manuscript, images, and Supporting Information files will be freely available online, and any third party is permitted to access, download, copy, distribute, and use these materials in any way, even commercially, with proper attribution. For these reasons, we cannot publish previously copyrighted maps or satellite images created using proprietary data, such as Google software (Google Maps, Street View, and Earth). For more information, see our copyright guidelines: http://journals.plos.org/plosone/s/licenses-and-copyright. We require you to either (1) present written permission from the copyright holder to publish these figures specifically under the CC BY 4.0 license, or (2) remove the figures from your submission: 5.1.    You may seek permission from the original copyright holder of Figure 1 to publish the content specifically under the CC BY 4.0 license. We recommend that you contact the original copyright holder with the Content Permission Form (http://journals.plos.org/plosone/s/file?id=7c09/content-permission-form.pdf) and the following text: “I request permission for the open-access journal PLOS ONE to publish XXX under the Creative Commons Attribution License (CCAL) CC BY 4.0 (http://creativecommons.org/licenses/by/4.0/). Please be aware that this license allows unrestricted use and distribution, even commercially, by third parties. Please reply and provide explicit written permission to publish XXX under a CC BY license and complete the attached form.” Please upload the completed Content Permission Form or other proof of granted permissions as an "Other" file with your submission. In the figure caption of the copyrighted figure, please include the following text: “Reprinted from [ref] under a CC BY license, with permission from [name of publisher], original copyright [original copyright year].” 5.2.    If you are unable to obtain permission from the original copyright holder to publish these figures under the CC BY 4.0 license or if the copyright holder’s requirements are incompatible with the CC BY 4.0 license, please either i) remove the figure or ii) supply a replacement figure that complies with the CC BY 4.0 license. Please check copyright information on all replacement figures and update the figure caption with source information. If applicable, please specify in the figure caption text when a figure is similar but not identical to the original image and is therefore for illustrative purposes only. The following resources for replacing copyrighted map figures may be helpful: USGS National Map Viewer (public domain): http://viewer.nationalmap.gov/viewer/ The Gateway to Astronaut Photography of Earth (public domain): http://eol.jsc.nasa.gov/sseop/clickmap/ Maps at the CIA (public domain): https://www.cia.gov/library/publications/the-world-factbook/index.html and https://www.cia.gov/library/publications/cia-maps-publications/index.html NASA Earth Observatory (public domain): http://earthobservatory.nasa.gov/ Landsat: http://landsat.visibleearth.nasa.gov/ USGS EROS (Earth Resources Observatory and Science (EROS) Center) (public domain): http://eros.usgs.gov/# Natural Earth (public domain): http://www.naturalearthdata.com/ [Note: HTML markup is below. Please do not edit.] Reviewers' comments: Reviewer's Responses to Questions Comments to the Author 1. Is the manuscript technically sound, and do the data support the conclusions? The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented. Reviewer #1: Yes Reviewer #2: Yes ********** 2. Has the statistical analysis been performed appropriately and rigorously? Reviewer #1: Yes Reviewer #2: I Don't Know ********** 3. Have the authors made all data underlying the findings in their manuscript fully available? The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified. Reviewer #1: Yes Reviewer #2: Yes ********** 4. Is the manuscript presented in an intelligible fashion and written in standard English? PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here. Reviewer #1: Yes Reviewer #2: Yes ********** 5. Review Comments to the Author Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters) Reviewer #1: Dears authors: The manuscript entitled: "Analysis of Molecular Markers in the Environmental Strains of Vibrio Parahaemolyticus Strains Isolated obtained from the Oyster (Crassostrea virginica) and Water Samples of Delaware Bay", submitted by: Esam Almuhaideb, Lathadevi K. Chintapenta, Amanda Abbott, Salina Parveen Gulnihal Ozbay represents a topic of interest in his field of knowledge, it is well presented and the methodology in general was well conducted; however, before it can be considered for publication, I recommend attending to the following general recommendations: 1) The title requires improvement, it does not specifically reflect the topic it addresses. 2) The abstract does not mention all the methodology used. 3) in the introduction it should be emphasized that molecular markers are relevant to identify pathogenic strains of importance in human health. 4) In the methodology, justify why using the colony count with a presumptive microbiological method and not with a confirmatory method such as coupling the PCR to the most probable number (MPN). 5)En el primer párrafo de la conclusión: "This study assessed V. parahaemolyticus CFU/g (or mL) levels to evaluate the bacteriological conditions of seawater and oyster samples collected from Delaware Bay. V. parahaemolyticus levels in oyster samples were notably higher than seawater samples", se requiere justificar que los métodos de cuantificación son igualmente efectivos para los dos tipos de muestras, sobre todo en cuanto a la cantidad de muestra tomada y analizada. Likewise, attend to some specific recommendations indicated in the attached document. Reviewer #2: Analysis of Molecular Markers in the Environmental Strains of Vibrio parahaemolyticus Isolated from the Oyster (Crassostrea virginica) and Water Samples of Delaware Bay Esam Almuhaideb, Lathadevi K. Chintapenta, Amanda Abbott, Salina Parveen, Gulnihal Ozbay This study compared levels of Vibrio parahaemolyticus in seawater and oysters in Delaware Bay over 5 months, using culture-based plating as well as genetic markers. Relationships to physico-chemical data were explored using Spearman’s rank correlation analysis, and the co-existence of key genes were assessed. I believe the manuscript is suitable for publication, but have made some comments below. I have reattached the manuscript with corrections. Overall, the manuscript needs a grammar polish. Change sentences so that references are in parentheses and author names not repeated in the sentence Eg Line 83… Miyoshi et al. and Kim et al. [24, 25] have reported that V. parahaemolyticus harbors a V. parahaemolyticus metalloprotease (vpm) gene that expresses extracellular zinc metalloprotease and shows sufficient proteolytic activity towards type I collagen. Should be written as: V. parahaemolyticus harbors a V. parahaemolyticus metalloprotease (vpm) gene that expresses extracellular zinc metalloprotease and shows sufficient proteolytic activity towards type I collagen [24, 25] And Line 98.. According to Ritchie et al. [32], an infant rabbit model infected with V. parahaemolyticus revealed that T3SS2 is essential for intestinal colonization. Should be written as: An infant rabbit model infected with V. parahaemolyticus revealed that T3SS2 is essential for intestinal colonization [32]. Be consistent: U.S. (eg line 118) or USA (line 136) Line 153: peptone water (PW) – brand or composition? Line 166: Tryptone Soy Broth (TSB) - brand or composition? Line 170: Alkaline Peptone Water (APW) - brand or composition? Line 177: The PCR reaction mixture (10uL) – should be 10 μL Table 1 is not well laid out. I suggest the following columns: Gene Primer Sequences Cycling conditions Line 184: positive control – ATCC or some sort of identification number for V. parahaemolyticus? Line 201 and elsewhere: 14.63 °C should be 14.63°C (no space between temperature and °C) Line 202 and elsewhere: space between value and ppt Line 209: 8.23 mg/L not 8.23mg/L Fig 2 & Fig 3: It is not accurate to draw the temperature and salinity as lines as they are not a continuous series; either group by location and leave the temperature/salinity as lines, or use a symbol to represent those variables. Table 4: column headings should read: Column 1: Water Parameter Column 2: Spearman’s correlation coefficient, r Column 3: significance level (oyster) Column 4: significance level (seawater) Fig 4 legend should be: Percent and number of isolates with detected tdh, trh, toxR, vpm and tlh genes in oysters and seawater. Y-axis should be “Number of isolates” Fig 5 legend should be: Number of isolates with coexisting genes among total confirmed V. parahaemolyticus isolates. Y-axis should be “Number of isolates” Line 328: (n ₌ 39) & (n ₌ 31) should be (n=39) & (n=31)? Fig 6 legend should be: Co-existence of genes among confirmed V. parahaemolyticus isolates from oysters. Y-axis should be “Number of isolates” Fig 7 legend should be: Co-existence of genes among confirmed V. parahaemolyticus isolates from seawater. Y-axis should be “Number of isolates” Conclusion Line 357-358: Better first sentence needed eg This study assessed V. parahaemolyticus levels in oysters and seawater in Delaware Bay in relation to physico-chemical variables and the presence of key genes. Line 360 Occurrence of the virulent (should be virulence) genes (tdh and/or trh) in oyster samples were notably higher – higher than what? Need to mention the relationship of V. parahaemolyticus levels to physico-chemical parameters Line 371 “virulent” should be virulence Line 373 “inhibiting” should be inhabiting References Check scientific names need to be italicized I do not have expertise in statistical analyses so cannot comment on the appropriateness of the method used. ********** 6. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files. If you choose “no”, your identity will remain anonymous but your review may still be made public. Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy. Reviewer #1: Yes: Josefina León-Félix Reviewer #2: No [NOTE: If reviewer comments were submitted as an attachment file, they will be attached to this email and accessible via the submission site. Please log into your account, locate the manuscript record, and check for the action link "View Attachments". If this link does not appear, there are no attachment files.] While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com/. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Registration is free. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email PLOS at figures@plos.org. Please note that Supporting Information files do not need this step. Submitted filename: Esam et al manuscript 6-20-2020_revjlf.docx Click here for additional data file. Submitted filename: PONE-D-20-19028_reviewer_v1.pdf Click here for additional data file. 7 Oct 2020 Dear Dr. Joerg, We appreciate that our manuscript is given a chance for publication after revisions. We thank the reviewers for their thorough critique of our manuscript and we have made recommended changes and corrections per reviewers. All the edits and recommendations are incorporated in the manuscript and following section provides our response to those comments and edits: Reviewer 1 1. The title requires improvement, it does not specifically reflect the topic it addresses. Changed, please refer to the manuscript. 2. The abstract does not mention all the methodology used. All the key methods are included, please see the abstract in the manuscript. 3. In the introduction it should be emphasized that molecular markers are relevant to identify pathogenic strains of importance in human health. We have mentioned the association of the gene markers with clinical V. parahaemolyticus; however, more clarification was added, please see the manuscript lines 82-84, 116-118. 4. In the methodology, justify why using the colony count with a presumptive microbiological method and not with a confirmatory method such as coupling the PCR to the most probable number (MPN). 1. Direct plating on CHROMagar Vibrio was used since it is a well-established method, less tedious, and sufficient for the detection and isolation of V. parahaemolyticus for research purposes, please see the manuscript lines 125-127, and 171-173. 2. Moreover, in this study, we tested selected colonies (n=165) of the presumptive V. parahaemolyticus isolates for the presence of the species-specific thermolabile hemolysin (tlh) and other key genes of V. parahaemolyticus. 5. In the first paragraph of the conclusion: "This study assessed V. parahaemolyticus CFU / g (or mL) levels to evaluate the bacteriological conditions of seawater and oyster samples collected from Delaware Bay. V. parahaemolyticus levels in oyster samples were notably higher than seawater samples ", it is necessary to justify that the quantification methods are equally effective for the two types of samples, especially in terms of the amount of sample taken and analyzed. 1. We followed the standard procedure of the American Public Health Association. “Recommended procedures for the examination of sea water and shellfish” in terms of samples collection and inoculation, please see the manuscript lines 165-166. 2. In addition, a few previous studies including our research team reported higher levels of this bacterium in oysters than water. Because oyster as a filter feeder can process large volume of water, please see the manuscript lines 67-68, and 245-248. 6. Likewise, attend to some specific recommendations indicated in the attached document. Comments in the document: a) Lines 34-35: The lowest detectable limit of V. parahaemolyticus in oyster and seawater samples was 1.7×10 CFU/g (or mL) during the months of September and October. Confused Sentence was deleted in the revised abstract because of the space limit since we had to include some information regarding the methods we used, please see the revised abstract of the manuscript. b) Line 36: Confused. With the temperature of the oysters? It is not documented that the temperature of the oysters or the environment where these oysters are kept has been measured. Water temperature was measured as is the case with other water parameter, and it is corrected in the revised abstract lines 34-36, 44-45. c) Introduction: It would be convenient to make clear that they are focusing on strains of clinical importance or human health, due to the markers that are being evaluated, since there are other pathogenicity markers of relevance in animal health. Clarification included, please see the manuscripts lines 70-71. d) Method: It remains to describe how occurrence, co-occurrence and co-existence were determined. PCR amplicons were visualized using gel electrophoresis, please see the manuscript lines 195-199. e) Method: Define enzyme units Included, please see the manuscript line 189. f) Method: I recommend placing both added volumes and final concentrations of the PCR components in the reaction Volumes and final concentrations are included, please see the manuscript lines 187-191. g) Method: No template control, NTC or blank. Negative control is with unrelated DNA. Corrected, please see the manuscript lines 193-195. h) The conclusion is very weak, requires forceful sentences and related to the data obtained. Please see the revised conclusion. Reviewer 2 1. I have reattached the manuscript with corrections. Overall, the manuscript needs a grammar polish. All corrected 2. Change sentences so that references are in parentheses and author names not repeated in the sentence E.g. Line 83… Miyoshi et al. and Kim et al. [24, 25] have reported that V. parahaemolyticus harbors a V. parahaemolyticus metalloprotease (vpm) gene that expresses extracellular zinc metalloprotease and shows sufficient proteolytic activity towards type I collagen. Should be written as: V. parahaemolyticus harbors a V. parahaemolyticus metalloprotease (vpm) gene that expresses extracellular zinc metalloprotease and shows sufficient proteolytic activity towards type I collagen [24, 25] And Line 98.. According to Ritchie et al. [32], an infant rabbit model infected with V. parahaemolyticus revealed that T3SS2 is essential for intestinal colonization. Should be written as: An infant rabbit model infected with V. parahaemolyticus revealed that T3SS2 is essential for intestinal colonization [32]. Corrected here and throughout the manuscript, please see the revised manuscript. 3. Be consistent: U.S. (eg line 118) or USA (line 136) USA abbreviation used consistently, please see the revised manuscript. 4. Line 153: peptone water (PW) – brand or composition? Composition was included, please see the manuscript lines 161-162. 5. Line 166: Tryptone Soy Broth (TSB) - brand or composition? The brand name was included, please see the manuscript line 175. 6. Line 170: Alkaline Peptone Water (APW) - brand or composition? Composition was included, please see the manuscript lines 179-180. 7. Line 177: The PCR reaction mixture (10uL) – should be 10 μL Corrected, please see the manuscript line 188. 8. Table 1 is not well laid out. I suggest the following columns: Gene Primer Sequences Cycling conditions Changed accordingly 9. Line 184: positive control – ATCC or some sort of identification number for V. parahaemolyticus? The positive control was V. parahaemolyticus SPRC 10290, please see the manuscript line 194-195. 10. Line 201 and elsewhere: 14.63 °C should be 14.63°C (no space between temperature and °C) Corrected here and throughout the revised manuscript. 11. Line 202 and elsewhere: space between value and ppt Corrected here and throughout the revised manuscript. 12. Line 209: 8.23 mg/L not 8.23mg/L Corrected, please see the manuscript line 224. 13. Fig 2 & Fig 3: It is not accurate to draw the temperature and salinity as lines as they are not a continuous series; either group by location and leave the temperature/salinity as lines, or use a symbol to represent those variables. Lines were changed to symbols, please see the revised figures 2 and 3. 14. Table 4: column headings should read: Column 1: Water Parameter Column 2: Spearman’s correlation coefficient, r Column 3: significance level (oyster) Column 4: significance level (seawater) Changed accordingly, please see the revised manuscript. 15. Fig 4 legend should be: Percent and number of isolates with detected tdh, trh, toxR, vpm and tlh genes in oysters and seawater. Y-axis should be “Number of isolates” Changed accordingly, please see the revised manuscript. 16. Fig 5 legend should be: Number of isolates with coexisting genes among total confirmed V. parahaemolyticus isolates. Y-axis should be “Number of isolates” Changed accordingly, please see the revised manuscript. 17. Line 328: (n ₌ 39) & (n ₌ 31) should be (n=39) & (n=31)? Corrected, please see the manuscript line 337. 18. Fig 6 legend should be: Co-existence of genes among confirmed V. parahaemolyticus isolates from oysters. Y-axis should be “Number of isolates” Changed accordingly, please see the revised manuscript. 19. Fig 7 legend should be: Co-existence of genes among confirmed V. parahaemolyticus isolates from seawater. Y-axis should be “Number of isolates” Changed accordingly, please see the revised manuscript. Conclusion 20. Line 357-358: Better first sentence needed eg This study assessed V. parahaemolyticus levels in oysters and seawater in Delaware Bay in relation to physico-chemical variables and the presence of key genes. Changed, please refer to the revised conclusion. 21. Line 360 Occurrence of the virulent (should be virulence) genes (tdh and/or trh) in oyster samples were notably higher – higher than what? The sentence was deleted in the revised conclusion. 22. Need to mention the relationship of V. parahaemolyticus levels to physico-chemical parameters Added please see the revised conclusion. 23. Line 371 “virulent” should be virulence Corrected, please see the manuscript line 386. 24. Line 373 “inhibiting” should be inhabiting Corrected, please see the manuscript line 388. References 25. Check scientific names need to be italicized Checked, please see the revised references. We thank the reviewers for their careful review of this manuscript. We have made every effort to address all of their comments and revised the manuscript accordingly. We hope that you will now find the manuscript acceptable for publication. Sincerely yours, Submitted filename: Response to Reviewers.docx Click here for additional data file. 29 Oct 2020 Assessment of Vibrio parahaemolyticus levels in oysters (Crassostrea virginica) and seawater in Delaware Bay in relation to environmental conditions and the prevalence of molecular markers to identify pathogenic Vibrio parahaemolyticus strains PONE-D-20-19028R1 Dear Dr. Ozbay, We’re pleased to inform you that your manuscript has been judged scientifically suitable for publication and will be formally accepted for publication once it meets all outstanding technical requirements. Within one week, you’ll receive an e-mail detailing the required amendments. When these have been addressed, you’ll receive a formal acceptance letter and your manuscript will be scheduled for publication. An invoice for payment will follow shortly after the formal acceptance. To ensure an efficient process, please log into Editorial Manager at http://www.editorialmanager.com/pone/, click the 'Update My Information' link at the top of the page, and double check that your user information is up-to-date. If you have any billing related questions, please contact our Author Billing department directly at authorbilling@plos.org. If your institution or institutions have a press office, please notify them about your upcoming paper to help maximize its impact. If they’ll be preparing press materials, please inform our press team as soon as possible -- no later than 48 hours after receiving the formal acceptance. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information, please contact onepress@plos.org. Kind regards, José A. Fernández Robledo, Ph.D. Academic Editor PLOS ONE Additional Editor Comments (optional): Reviewers' comments: Reviewer's Responses to Questions Comments to the Author 1. If the authors have adequately addressed your comments raised in a previous round of review and you feel that this manuscript is now acceptable for publication, you may indicate that here to bypass the “Comments to the Author” section, enter your conflict of interest statement in the “Confidential to Editor” section, and submit your "Accept" recommendation. Reviewer #1: All comments have been addressed Reviewer #2: All comments have been addressed ********** 2. Is the manuscript technically sound, and do the data support the conclusions? The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented. Reviewer #1: Yes Reviewer #2: Yes ********** 3. Has the statistical analysis been performed appropriately and rigorously? Reviewer #1: Yes Reviewer #2: Yes ********** 4. Have the authors made all data underlying the findings in their manuscript fully available? The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified. Reviewer #1: Yes Reviewer #2: Yes ********** 5. Is the manuscript presented in an intelligible fashion and written in standard English? PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here. Reviewer #1: Yes Reviewer #2: Yes ********** 6. Review Comments to the Author Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters) Reviewer #1: (No Response) Reviewer #2: The authors have addressed the issues raised in the first review. I suggest next time that the manuscript be sent for English editing. Some minor edits are attached. ********** 7. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files. If you choose “no”, your identity will remain anonymous but your review may still be made public. Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy. Reviewer #1: Yes: Josefina León Félix Reviewer #2: No Submitted filename: review_291020.docx Click here for additional data file. 20 Nov 2020 PONE-D-20-19028R1 Assessment of Vibrio parahaemolyticus levels in oysters (Crassostrea virginica) and seawater in Delaware Bay in relation to environmental conditions and the prevalence of molecular markers to identify pathogenic Vibrio parahaemolyticus strains Dear Dr. Ozbay: I'm pleased to inform you that your manuscript has been deemed suitable for publication in PLOS ONE. Congratulations! Your manuscript is now with our production department. If your institution or institutions have a press office, please let them know about your upcoming paper now to help maximize its impact. If they'll be preparing press materials, please inform our press team within the next 48 hours. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information please contact onepress@plos.org. If we can help with anything else, please email us at plosone@plos.org. Thank you for submitting your work to PLOS ONE and supporting open access. Kind regards, PLOS ONE Editorial Office Staff on behalf of Dr. José A. Fernández Robledo Academic Editor PLOS ONE
  64 in total

1.  Vibrio parahaemolyticus infections in the United States, 1973-1998.

Authors:  N A Daniels; L MacKinnon; R Bishop; S Altekruse; B Ray; R M Hammond; S Thompson; S Wilson; N H Bean; P M Griffin; L Slutsker
Journal:  J Infect Dis       Date:  2000-05-15       Impact factor: 5.226

Review 2.  Cholera and other vibrioses in the United States.

Authors:  J G Morris; R E Black
Journal:  N Engl J Med       Date:  1985-02-07       Impact factor: 91.245

3.  Functional characterization of two type III secretion systems of Vibrio parahaemolyticus.

Authors:  Kwon-Sam Park; Takahiro Ono; Mitsuhiro Rokuda; Myoung-Ho Jang; Kazuhisa Okada; Tetsuya Iida; Takeshi Honda
Journal:  Infect Immun       Date:  2004-11       Impact factor: 3.441

4.  Long-term study of Vibrio parahaemolyticus prevalence and distribution in New Zealand shellfish.

Authors:  C D Cruz; D Hedderley; G C Fletcher
Journal:  Appl Environ Microbiol       Date:  2015-01-23       Impact factor: 4.792

5.  Molecular, serological, and virulence characteristics of Vibrio parahaemolyticus isolated from environmental, food, and clinical sources in North America and Asia.

Authors:  Angelo DePaola; Jodie Ulaszek; Charles A Kaysner; Bradley J Tenge; Jessica L Nordstrom; Joy Wells; Nancy Puhr; Steven M Gendel
Journal:  Appl Environ Microbiol       Date:  2003-07       Impact factor: 4.792

6.  Bile acid-induced virulence gene expression of Vibrio parahaemolyticus reveals a novel therapeutic potential for bile acid sequestrants.

Authors:  Kazuyoshi Gotoh; Toshio Kodama; Hirotaka Hiyoshi; Kaori Izutsu; Kwon-Sam Park; Rikard Dryselius; Yukihiro Akeda; Takeshi Honda; Tetsuya Iida
Journal:  PLoS One       Date:  2010-10-13       Impact factor: 3.240

7.  Prevalence and potential pathogenicity of Vibrio parahaemolyticus in Chinese mitten crabs (Eriocheir sinensis) harvested from the River Thames estuary, England.

Authors:  Sariqa Wagley; Kegakilwe Koofhethile; Rachel Rangdale
Journal:  J Food Prot       Date:  2009-01       Impact factor: 2.077

8.  Detection of the thermostable direct hemolysin gene (tdh) and the thermostable direct hemolysin-related hemolysin gene (trh) of Vibrio parahaemolyticus by polymerase chain reaction.

Authors:  J Tada; T Ohashi; N Nishimura; Y Shirasaki; H Ozaki; S Fukushima; J Takano; M Nishibuchi; Y Takeda
Journal:  Mol Cell Probes       Date:  1992-12       Impact factor: 2.365

9.  The spread of Vibrio parahaemolyticus in tissues of the Pacific white shrimp Litopenaeus vannamei analyzed by PCR and histopathology.

Authors:  Umaporn Khimmakthong; Pimwarang Sukkarun
Journal:  Microb Pathog       Date:  2017-10-19       Impact factor: 3.738

10.  Vibrio parahaemolyticus has a homolog of the Vibrio cholerae toxRS operon that mediates environmentally induced regulation of the thermostable direct hemolysin gene.

Authors:  Z Lin; K Kumagai; K Baba; J J Mekalanos; M Nishibuchi
Journal:  J Bacteriol       Date:  1993-06       Impact factor: 3.490

View more
  2 in total

1.  Nested Spatial and Temporal Modeling of Environmental Conditions Associated With Genetic Markers of Vibrio parahaemolyticus in Washington State Pacific Oysters.

Authors:  Brendan Fries; Benjamin J K Davis; Anne E Corrigan; Angelo DePaola; Frank C Curriero
Journal:  Front Microbiol       Date:  2022-03-30       Impact factor: 5.640

2.  Multilocus Sequence Typing and Virulence Potential of Vibrio parahaemolyticus Strains Isolated from Aquatic Bird Feces.

Authors:  Chonchanok Muangnapoh; Eakapong Tamboon; Neunghatai Supha; Jirachaya Toyting; Atchara Chitrak; Nakarin Kitkumthorn; Peeraya Ekchariyawat; Tetsuya Iida; Orasa Suthienkul
Journal:  Microbiol Spectr       Date:  2022-06-13
  2 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.