Generation and validation of versatile inducible CRISPRi embryonic stem cell and mouse model.

Clustered regularly interspaced short palindromic repeat (CRISPR)-CRISPR-associated (Cas) 9 has been widely used far beyond genome editing. Fusions of deactivated Cas9 (dCas9) to transcription effectors enable interrogation of the epigenome and controlling of gene expression. However, the large transgene size of dCas9-fusion hinders its applications especially in somatic tissues. Here, we develop a robust CRISPR interference (CRISPRi) system by transgenic expression of doxycycline (Dox) inducible dCas9-KRAB in mouse embryonic stem cells (iKRAB ESC). After introduction of specific single-guide RNAs (sgRNAs), the induced dCas9-KRAB efficiently maintains gene inactivation, although it modestly down-regulates the expression of active genes. The proper timing of Dox addition during cell differentiation or reprogramming allows us to study or screen spatiotemporally activated promoters or enhancers and thereby the gene functions. Furthermore, taking the ESC for blastocyst injection, we generate an iKRAB knock-in (KI) mouse model that enables the shutdown of gene expression and loss-of-function (LOF) studies ex vivo and in vivo by a simple transduction of gRNAs. Thus, our inducible CRISPRi ESC line and KI mouse provide versatile and convenient platforms for functional interrogation and high-throughput screens of specific genes and potential regulatory elements in the setting of development or diseases.

Introduction

Clustered regularly interspaced short palindromic repeat (CRISPR) and Cas (CRISPR-associated) proteins were originally found in bacteria and archaea to defend against viruses and plasmids by using CRISPR RNAs to guide the silencing of invading nucleic acids. Rapidly, this system has been simulated in other species by introducing the endonuclease Cas9 and single-guide RNAs (sgRNAs) to cleave and edit specific DNA sequences. Ever since, the (CRISPR)/Cas9 system has been widely used as a powerful tool for genome editing [1-4]. Meanwhile, the RNA-guided epigenome editing technologies based on endonuclease deactivated Cas9 (dCas9) with 2-point mutations (D10A, H841A) have been developed. By fusion of dCas9 with transcription activator or repressor, the CRISPR activation (CRISPRa) or CRISPR interference (CRISPRi) allows researchers to control the level of endogenous gene expression [5-9].

Conventional genome editing by CRISPR/Cas9 technology may result in divergent indels and generate differential genotypes. In comparison, CRISPRi techniques block gene transcription by introducing transcription repressors at a defined genomic locus, leaving DNA sequence intact. Krüppel-associated box (KRAB) domains are the most commonly used repressors [6,7,10]. Epigenetic studies have demonstrated that KRAB containing zinc-finger proteins (KRAB-ZFPs) facilitate silencing by recruiting the KRAB-associated protein KAP1, and, in turn, other epigenetic repressors such as SETDB1, EHMT2/G9A, LSD1, and NURD complex. Thus, the dCas9-KRAB fusion protein creates an inactive chromatin environment by removing active chromatin mark-like histone H3-acetylation and establishing heterochromatin-like chromatin mark H3 lysine 9 trimethylation (H3K9me3) [11-14].

Current CRISPRi systems are usually generated by ectopic expression of dCas9-KRAB and sgRNAs via viral transduction. However, the expression of bacterial Cas9 could elicit host responses, aberrant cellular functions, or even toxicity in mammalian tissues [15,16]. Considering these potentially detrimental effects, the lasting expression of Cas9 or dCas9 proteins is not preferred. Besides, controllable genetic manipulation is crucial for most of the biological studies. Hence, the inducible expression of dCas9-KRAB serves as a better choice. Here, we generated a transgenic mouse embryonic stem cell (ESC) line with doxycycline (Dox) inducible and reversible expressions of dCas9-KRAB (iKRAB ESC). With this line, a simple transduction of sgRNAs enables us to do any locus-specific loss-of-function (LOF) studies in ESC or differentiated cells by proper timing of Dox addition or withdrawal. Having tested multiple gRNAs targeting promoters or enhancers, we found that our iKRAB system could efficiently maintain gene inactivation and control cell fate transition. And high-throughput screens could be performed in iKRAB ESC-derived cells. To facilitate broader applications, we took advantage of the ESC line and generated knock-in (KI) mice, which allowed inducible LOF studies ex vivo and in vivo. These systems especially the animal models empower us for functional studies and potentially high-throughput screens of specific genes or cis-regulatory elements.

Results

Generation and characterization of iKRAB ESC line

To generate a robust and inducible CRISPRi system, we took advantage of an engineered inducible cassette exchange (ICE) system of mouse ESCs (A2Loxcre) with reverse tetracycline transcriptional activator (rtTA) inserted into the Rosa26 locus and tetracyclin response element (TRE)-LoxP-Cre-LoxP-Δneo integrated at the housekeeping gene Hprt [17]. Transgenes integrated at the Hprt locus remain transcriptionally active in differentiated cell types as well as in ESC. First, we constructed a dCas9-KRAB fragment onto the p2Lox-FLAG vector, which contains the LoxP sites [18]. Then, we pretreated A2Loxcre cells with Dox for 16 h so that Cre is expressed and that the cells are competent for recombination. Upon transfection with the p2Lox-FLAG-dCas9-KRAB construct, homologous recombination was initiated at the LoxP locus, and genomic fragments coming from plasmids were integrated into the downstream of the TRE promoter. At the same time, the Δneo gene acquired a PGK promoter and a start codon and enabled us to select for the precise integration with G418 (Fig 1A). After around 10 days of selection, the resistant clones were picked and characterized by genotyping PCR analysis. Two positive clones showed that the FLAG-dCas9-KRAB expressing sequence was precisely integrated downstream of TRE (S1A Fig). One of the clones was expanded for further analysis.

Fig 1

Generation of the iKRAB ESC line.

(A) Schematic diagram shows the strategy of ICE to generate the iKRAB ESC line. FLAG-dCas9-KRAB was integrated into the downstream of the TRE element through homologous recombination. Dox-controlled rtTA drives the expression of fusion protein of FLAG-dCas9-KRAB. (B) Western blot analysis showing the inducible and reversible expression of FLAG-dCas9-KRAB protein at different time points after Dox addition or withdrawal. β-actin served as a loading control. A relative gray value quantification of dCas9-KRAB protein levels is below each lane of the band. (C, D) IF staining of Cas9 and FLAG in iKRAB ESC cultured with or without Dox. The scale bar represents 50 μm. Cas, CRISPR-associated; dCas9, deactivated Cas9; Dox, doxycycline; ESC, embryonic stem cell; ICE, inducible cassette exchange; IF, immunofluorescence; KRAB, Krüppel-associated box; rtTA, reverse tetracycline transcriptional activator; TRE, tetracyclin response element.

As examined by western blot assay with the Cas9 antibody, the clone did not express any detectable dCas9-KRAB protein when cultured without Dox, indicating no leaky expression. Upon addition of titrated concentration of Dox, dCas9-KRAB expression was robustly induced at 1 μg/ml after 24 h (S1B Fig and Fig 1B). Hereafter, we used Dox at 1 μg/ml for most of the experiments unless otherwise stated. Interestingly, the protein expression was gradually decreased to undetectable level 48 h after removing Dox (Fig 1B). Hence, we named this clone iKRAB ESC. Meanwhile, we did immunofluorescence (IF) analysis of the clone with Cas9 and FLAG antibodies. As shown in Fig 1C and 1D, the fusion protein was homogenously expressed after Dox treatment. These data showed that dCas9-KRAB expression could be precisely and reversibly controlled by the addition and withdrawal of Dox, which would allow controllable gene knockdown upon the introduction of gRNAs.

CRISPRi efficiency at active genes

Many previous studies have demonstrated that dCas9-KRAB can achieve efficient knockdown of gene transcription, especially when tethered near the transcription start site (TSS) by sgRNAs [6,8,9,19]. To test the efficiency of the iKRAB ESC line, we first designed 6 specific sgRNAs targeting near the TSS of Oct4. As Oct4 is 1 of the best known pluripotency factors and required for ESC self-renewal, its depletion is expected to result in a clear loss of pluripotent cell morphology. However, unexpectedly, quantitative reverse transcription PCR (RT-qPCR) analysis showed that none of the sgRNAs down-regulated the mRNA levels of Oct4 more than 50% after Dox induction, no matter targeting upstream or downstream of the TSS (Fig 2A). And IF analysis of cells transduced by Oct4#sgRNA4, the most effective one in our test, clearly showed that Oct4 expression was homogenously down-regulated after Dox treatment (S2A Fig). Thus, the inadequate down-regulation of Oct4 expression was not due to heterogeneous expression of sgRNAs or inadequate transduction rate. Therefore, our data argue against the high CRISPRi efficiency by sgRNA-guided dCas9-KRAB on actively transcribed genes.

Fig 2

Induced dCas9-KRAB at active gene promoters by sgRNAs or multi-gRNAs.

(A, B) RT-qPCR analysis of stable iKRAB ESCs containing sgRNA against Oct4 or multi-gRNAs against Oct4 or Nanog after 2 days of Dox induction. The binding location of each gRNA is indicated relative to the TSS of Oct4 or Nanog locus. (C) The cell morphology of Oct4 or Nanog multi-gRNAs-transduced iKRAB ESCs after 2 days of Dox induction. The scale bar represents 100 μm. The numerical values used to generate graphs in panels A and B are available in S1 Data. Cas, CRISPR-associated; dCas9, deactivated Cas9; Dox, doxycycline; ESC, embryonic stem cell; KRAB, Krüppel-associated box; RT-qPCR, reverse transcription PCR; sgRNA, single-guide RNA; TSS, transcription start site.

To find out how the induced KRAB reconfigures chromatin at active versus inactive genes, we did chromatin immunoprecipitation (ChIP)-qPCR analysis in Oct4#sgRNA4 and Fgf5#sgRNA1-transduced iKRAB ESCs. FLAG or Cas9 ChIP-qPCR analysis demonstrated that the efficiency of tethering dCas9-KRAB fusion protein at the designed locus in either of the Dox-treated cells was comparable. It indicates that the genome binding of dCas9-KRAB protein was independent of gene transcription levels. Then, we did ChIP-qPCR analyses for the repressive histone mark H3K9me3. Interestingly, H3K9me3 levels are increased at the locus of Oct4 as well as of Fgf5. However, H3K9me3 spreads more than 6 kb at Fgf5 TSS, while it only spreads around 2 kb at Oct4 TSS (S3A Fig). These data suggest that sgRNA-tethered dCas9-KRAB at the active chromatin region is not sufficient to counteract active transcription and spread the heterochromatin-like state. Actually, it has been demonstrated that loss of activation signals usually precedes transcriptional repression and deposition of repressive chromatin marks [20-23]. Hence, it is not really surprising to observe inadequate CRISPRi at the presence of active transcription when using sgRNAs.

Based on the above regulatory mechanism, multi-gRNAs by linking multiple gRNAs linearly are supposed to induce more widespread heterochromatin-like state and thereby work more efficiently to suppress active gene transcription than sgRNAs. For this reason, we cloned multi-gRNAs targeting the TSS of Oct4 and Nanog and transduced the iKRAB ESCs, respectively. Indeed, the multi-gRNAs targeting Oct4 TSS led to more than 12 kb spreading of H3K9me3 mark (S3B Fig). And accordingly, these multi-gRNAs achieved much higher knockdown efficiency (above 75%) than sgRNAs (Fig 2B). The induced ESCs failed to self-renew and lost the normal morphology (Fig 2C). Therefore, multi-gRNAs are recommended to achieve high CRISPRi efficiency on actively transcribed genes.

Nevertheless, highly efficient gene inactivation is not always preferred. In some cases, different levels of gene down-regulation may help get insight into gene dosage effect. For instance, we observed that the ratio of Nanog-positive cells was even increased in the above SL-cultured Oct4-CRISPRi ESCs, suggesting a robust pluripotent state (S2A and S2B Fig). This is consistent with a previous unexpected finding that the self-renewal efficiency in Oct4+/− ESCs is even enhanced compared with the wild type (WT) [24]. Thus, the iKRAB system may provide a valuable means to precisely control the dosage of target gene expression.

iKRAB efficiently maintains gene inactivation

A main advantage of an inducible system is to precisely control gene expression via the timing of Dox addition. Since the iKRAB was not sufficient to induce gene inactivation, we followed to test whether it would maintain gene inactivation in dynamic settings. We took advantage of the switch between naïve and primed pluripotent states of iKRAB ESC. ESCs cultured in serum-free medium containing GSK3 inhibitor and MEK inhibitor (2i) and leukemia inhibitory factor (LIF) (hereafter 2i) supports naïve pluripotency that mimics the inner cell mass (ICM) of the blastocyst. Upon switch to serum-containing medium with LIF (hereafter SL) or Fgf2 and activin (hereafter FA), ESCs will exit from naïve pluripotency and switch to primed pluripotency. Some factors such as the epiblast maker Fgf5 and the histone methyltransferase Mll1 are switched on during the transition, accompanied with loss of Nanog expression [25-27] (Fig 3A). We transduced iKRAB ESCs with lentivirus expressing sgRNAs targeting the TSS of Fgf5 or Mll1. In the absence of Dox, Fgf5 or Mll1 expression was strongly induced upon the switch of the culture condition from 2i to SL or FA. Although Dox addition in 2i medium exerted minor effects on Fgf5 or Mll1 expression, it strongly suppressed the induction by medium switch (>85%) (Fig 3B). Then, we further took the Fgf5#sgRNA2 transduced ESCs to observe how its CRISPRi affects pluripotent states. As shown by the cell morphology and immunostaining, the expression of Oct4 and Nanog are decreased to undetectable levels in the control (Dox-) cells upon switching from 2i to FA condition. In contrast, the Dox-treated cells maintained as round colonies, with majority of them Oct4 and Nanog-positive even in response to FA signals (Fig 3C and 3D). These data indicate that preset Fgf5 inactivation is maintained and thereby hinders the exit of naïve pluripotency.

Fig 3

Induced dCas9-KRAB at promoters is sufficient to maintain gene inactivation.

(A) Schematic diagram shows the dynamics of different states and marker gene expression of pluripotent stem cells cultured in different conditions. (B) RT-qPCR analysis of Fgf5 and Mll1 mRNA levels of iKRAB cells containing designated sgRNAs (with or without Dox) upon culture condition switch from 2i to FA. The binding location of each sgRNA is indicated relative to the TSS of the Fgf5 or Mll1 locus. (C) Representative IF staining of Oct4 and Nanog in iKRAB cells containing Klf5#sgRNA-2 treated with or without Dox in 2i condition or 2i switch to FA condition. The scale bar represents 100 μm. (D, G) The relative Oct4 and Nanog-positive cell numbers (normalized by DAPI+ cell numbers) are compared. (E) RT-qPCR analysis of Mll1 mRNA levels of iKRAB cells containing the same sgRNAs as (C) (with or without Dox) in FA condition. (F) Representative IF staining of Oct4 and Nanog in iKRAB cells containing Mll1#sgRNA-1 treated with or without Dox for 4 days in FA condition, followed by switch back to 2i condition. ESC constantly cultured in 2i condition was used as a control. The scale bar represents 100 μm. Data in B, D, E, and G are represented as the mean ± SD of replicates (n = 3) (*p < 0.05, **p < 0.01, ***p<0.001, ****p < 0.0001; and 2-tailed unpaired t test). The numerical values used to generate graphs in panels B, D, E, and G are available in S1 Data. ESC, embryonic stem cell; Dox, doxycycline; dCas9, deactivated Cas9; IF, immunofluorescence; RT-qPCR reverse transcription PCR; SD, standard deviation; sgRNA, single-guide RNA.

In comparison with Dox addition in 2i medium, when we initiated Dox treatment at the primed state with Mll1 highly expressed (FA culture), the same sgRNAs targeting the TSS of Mll1 achieved moderate down-regulation efficiency (approximately 60% down-regulation) (Fig 3E). Nonetheless, upon being switched back to 2i medium, a subset of the Mll1 knockdown cells regained Oct4 and Nanog expressions. In contrast, Oct4 and Nanog-positive cells could hardly be observed in the control group (Fig 3F and 3G). It indicates that Mll1 down-regulation facilitates the reprogramming from primed state to naïve state as previously reported [27]. This finding also prompts us for further CRISPRi screening to identify more chromatin regulators whose suppression may contribute to the reprogramming. Together, these data demonstrate that the iKRAB system is highly efficient to block gene activation, although inadequate to induce repression of active genes.

iKRAB maintains inactive enhancers

Epigenome editing is supposed to modulate activities of any potential cis-acting regulatory elements. Enhancers are a vital regulatory element for tissue or development stage-specific gene expression through interaction with promoters. Thus, we tested how the iKRAB system works at enhancers in ESC and derived cells. An attractive model is the dynamic reorganization of enhancers between the 2 states of pluripotent stem cells [28,29]. For example, Oct4 expression is controlled by different enhancers, distal enhancer (DE) in naïve state while proximal enhancer (PE) in primed state, although Oct4 is expressed in both naïve and primed pluripotent cells [28,30]. When 2 sgRNAs targeting Oct4 PE were respectively introduced into the 2i cultured iKRAB ESCs, Dox treatment induced no effects or even slight up-regulation of Oct4 expression, as shown by RT-qPCR analysis (Fig 4A and S4 Fig). Upon the culture condition switching from 2i to either SL or FA without Dox, Oct4 expression levels were increased in SL condition, an intermediate state with simultaneous activation of 2 enhancers. However, after Dox treatment, Oct4 activation was successfully suppressed in SL condition and was almost abrogated in FA condition (Fig 4B). IF analysis further confirmed that Oct4 expression was impeded in FA condition at the presence of Dox, although it was unaffected in 2i condition. Moreover, we found that Oct4 expression was restored 4 days after withdrawal of Dox, indicating CRISPRi effect as well as the expression of dCas9-KRAB fusion protein was reversible (Fig 4C and 4D). ChIP-qPCR analysis of 2i and FA-cultured cells showed that H3K27me3 and H3K9me3 levels at Oct4 PE were decreased, together with increased H3K4me1 and H3K27ac levels upon switch from 2i to FA condition. However, when culture condition was switched at the presence of Dox, H3K27me3 and H3K9me3 levels at Oct4 PE were maintained or even increased, and the increase of H3K4me1 and H3K27ac levels was hindered (S5 Fig). These data clearly indicated that Oct4 PE was blocked at inactive state by induced dCas9-KRAB.

Fig 4

Induced dCas9-KRAB at enhancers is sufficient to maintain gene inactivation in response to activation signals.

(A) Schematic diagram shows the PE of Oct4 is activated upon culture condition switch from 2i to FA. Dox-induced dCas9-KRAB is tethered to the PE of Oct4 in 2i condition, and Oct4 expression is to be tested in SL and FA conditions. (B) RT-qPCR analysis of Oct4 mRNA levels of iKRAB cells containing designated sgRNAs (with or without Dox) upon culture condition switch from 2i to SL or FA. The binding location of each sgRNA is indicated relative to the PE of Oct4 locus. (C) Representative IF staining of Oct4 and Nanog in designated conditions. The scale bar represents 20 μm. (D, I) The relative Oct4, Nanog, or Map2-positive cell numbers are compared. (E) Schematic diagram shows iKRAB cells containing designated sgRNAs the PE of Sox2 are differentiated to NPC and neuron. Dox was added before NPC stage together with RA. (F) RT-qPCR analysis of Sox2 mRNA levels in NPC (8 days) from the group with or without treatment. (G) RT-qPCR analysis of 2 neuron marker genes in neuron (12 days) from the group with or without treatment. (H) Representative IF staining of Map2 in neuron (12 days) from the group with or without treatment. The scale bar represents 50 μm. (J) A model for the temporal control of enhancer or promoter by the timing of Dox addition during ESC differentiation. Data in B, D, F, G, and I are represented as the mean ± SD of replicates (n = 3 or 4) (**p < 0.01, ***p < 0.001, ****p < 0.0001; and 2-tailed unpaired t test). The numerical values used to generate graphs in panel B, D, F, G, and I are available in S1 Data. Dox, doxycycline; dCas9, deactivated Cas9; IF, immunofluorescence; KRAB, Krüppel-associated box; NPC, neural progenitor cell; PE, proximal enhancer; RT-qPCR, reverse transcription PCR; sgRNA, single-guide RNA.

To further test the eligibility of iKRAB ESC for the dissection of specific enhancers during differentiation, we established a neural differentiation model to observe the dynamic control of Sox2 enhancers and its downstream effects. Sox2 is highly expressed in neural progenitor cells (NPCs) as well as in ESCs; however, its expression is activated by DE in ESCs while likely by PE in NPCs [31,32]. We transduced the iKRAB ESCs with lentivirus expressing a specific sgRNA targeting Sox2 PE before proceeding with embryoid body (EB) differentiation. When RA-induced NPC differentiation was initiated, cells were cultured with or without Dox (Fig 4E). RT-qPCR analysis in 8 days differentiated NPCs showed that Sox2 mRNA levels were significantly decreased in the Dox-treated group compared with the mock control, indicating that the switch-on of Sox2 PE was blocked (Fig 4F). Consistent with the activation of Sox2 PE in NPCs, the chromatin interaction between Sox2 PE and TSS was increased after RA treatment, as shown by the 3C-PCR analysis. And this interaction failed to be established in the Dox-treated cells (S6 Fig), suggesting that induced dCas9-KRAB suppressed Sox2 PE activation and the associated chromatin looping. Then, we continued the differentiation of NPCs to neuron for each group and observed how Sox2 inactivation affected sequential neurogenesis. RT-PCR analysis showed that the expression levels of 2 neuron marker genes Map2 and Tubb3 were significantly lower in the Dox-treated group than the control group (Fig 4G). The inadequate Map2 expression in the Dox-treated group was further confirmed by IF analysis, indicating differentiation defects (Fig 4H and 4I). Collectively, a simple introduction of sgRNAs in iKRAB ESC can efficiently guide temporally induced dCas9-KRAB to block the activation of lineage-specific gene promoters or enhancers and thereby affect cell fate transitions (Fig 4J).

iKRAB ESC for high-throughput screening

As ESCs have the potential to differentiate into all cell types of the organism, the iKRAB ESC is supposed to be optimal for the identification of specific promoters or enhancers and characterization of associated genes at defined contexts. And hence, we developed a CRISPRi screen to identify specific chromatin regulators whose inhibition would alleviate the toxicity of sodium channel blockers in the derived neural cells. First, we created a sgRNA library (containing 5,115 sgRNAs with 5,096 specific sgRNAs and 19 nontargeting negative control sgRNAs) that targeted the TSSs (including different transcripts) of known or potential epigenetic regulators and RNA binding proteins coding genes (total number = 857). Then, we transduced the sgRNA library into the iKRAB ESC, induced CRISPRi activity before differentiation to NPC stage while treated the cells with NaV1.8 channel blocker A803467. The Dox-free group of NPCs almost completely died after 4 days of A803467 treatment. The survived cells in Dox-treated group were harvested for deep sequencing (Fig 5A).

Fig 5

iKRAB ESC for LOF screening.

(A) Schematic representation of CRISPRi screens in the iKRAB ESC-derived neural cells to evaluate chromatin regulators whose depletion would resist the toxicity of sodium channel blockers A803467. (B) A map of the contribution of the top 414 sgRNAs enriched in A803467-resistant cells. PRMT2 is among the top hits. (C) Representative IF staining of Map2 in designated groups. The scale bar represents 100 μm. (D) The relative Map2-positive cell numbers are compared. (E) Validation the neuroprotective effects of PRMT inhibitor AMI-1. The scale bars represent 50 μm. (F) The relative number of viable cells in each designated group (numbers per mm2) is compared. DMSO was used as a negative control in the assay. Data in D and F are represented as the mean ± SD of replicates (n = 3 or 4) (**p < 0.01, ***p < 0.001, ****p < 0.0001; and 2-tailed unpaired t test). The numerical values used to generate graphs in panel D and F are available in S1 Data. CRISPRi, CRISPR interference; ESC, embryonic stem cell; IF, immunofluorescence; LOF, loss-of-function; SD, standard deviation; sgRNA, single-guide RNA.

Compared with the input, 41 sgRNAs for 19 genes were significantly enriched in the survived cells (log10(Fold change Dox + /input) > 1, S1 Table). Cirbp, Prmt2, and Dgkh were among the top hits (Fig 5B). Then, we followed to validate certain hits by inducible shRNAs. We transduced ESCs with either of 2 inducible shRNA lentiviral constructs against Prmt2. After confirming the knockdowin efficiency by Dox induction (S7 Fig), we proceeded for NPC differentiation. As observed by Map2 IF analysis, induced Prmt2 depletion does not obviously affect the NPC differentiation in the control group (DMSO) (Fig 5C 2 upper panels and Fig 5D). Not surprisingly, A803467 negatively selected neural cells as rather few Map2-positive cells survived. However, the neural differentiation was rescued by induced Prmt2 depletion as majority of Map2-positive cells survived in the Dox-treated group (Fig 5C bottom panels and Fig 5D).

PRMT2 belongs to type I protein arginine methyltransferases, and there were inhibitors available against its activity, such as AMI-1. So we examined whether AMI-1 would alleviate the toxicity of A803467 in NPCs. As shown in Fig 5E and 5F, few cells survived at the presence of A803467 alone. However, addition of AMI-1 significantly protected NPC from cell death and largely maintained the cell morphology at the presence of A803467. Accordingly, the CRISPRi screening identified toxicity resistance gene and provided possible solutions for neuroprotection. Thus, the iKRAB ESC may serve as a versatile model for LOF screens of functional genes or regulatory elements in a wide range of settings.

Generation of an iKRAB KI mouse model for inducible gene silencing ex vivo and in vivo

Although dCas9-KRAB has been broadly applied in a few cell lines [8,9,33,34], a robust CRISPRi system for in vivo application is still urgently needed. Since we have confirmed the CRISPRi effects of the iKRAB ESC, we performed blastocyst injection. After successfully obtaining mouse chimeras and screening of germline transmitted offsprings, chimeric founder mice were crossed to generate iKRAB homozygous KI mice, verified by genotyping PCR (Fig 6A and 6B). The iKRAB KI mice were fertile, presented no morphological abnormalities, and were able to breed to homozygosity. Western blot assay of protein lysates from the mouse tails showed that no expression of dCas9-KRAB was observed in the KI mice until being fed with Dox-containing water (Fig 6C). Then, we tested inducible CRISPRi effect ex vivo and in vivo.

Fig 6

Characterization of the iKRAB KI mouse and ex vivo effect.

(A) Schematic diagram shows the generation of iKRAB KI mice. (B) Genotyping PCR analysis of TRE-dCas9-KRAB and rtTA in WT and KI mice. (C) Western blot analysis of dCas9-KRAB expression in WT and iKRAB mice. β-tubulin served as a loading control. A relative gray value quantification of dCas9-KRAB protein levels is below each lane of the band. (D) Schematic diagram shows that PDLSCs from the iKRAB KI mice were introduced with sgRNA against the TSS of Runx2, followed by differentiation into osteoblasts. (E) RT-qPCR analysis showing Runx2 mRNA levels in the designated groups. Data are represented as the mean ± SD of replicates (n = 3) (****p < 0.0001; and 2-tailed unpaired t test). (F) ALP staining of cells from the designated groups. The numerical values used to generate graphs in panel E are available in S1 Data. ALP, alkaline phosphatase; KI, knock-in; PLSC, periodontal ligament stem cell; rtTA, reverse transcriptional activator; RT-qPCR, reverse transcription PCR; SD, standard deviation; sgRNA, single-guide RNA; TSS, transcription start site; WT wild type.

To test the CRISPRi effect ex vivo, we took advantage of a previously established osteoblast differentiation model of mesenchymal stem cells (MSC) [35]. Periodontal ligament stem cells (PDLSCs) were harvested from 8-week-old iKRAB KI mice. After a short expansion in MSC medium, the cells were switched to differentiation medium (Fig 6D). RT-qPCR analysis showed that Runx2 expression was activated after 5 days of differentiation (Fig 6E). Meanwhile, alkaline phosphatase (ALP) activity, an early marker for osteoblast differentiation, was strongly induced (Fig 6F). Then, we transduced PDLSCs with lentivirus expressing specific sgRNA targeting the TSS of Runx2, encoding a key transcription factor driving osteoblast differentiation. The transduced cells were then switched to differentiation medium with or without Dox. We found that Dox treatment modestly but significantly suppressed the differentiation medium-induced Runx2 activation (Fig 6E) and ALP activity (Fig 6F). These data illustrate that primary cells isolated from the iKRAB KI mice respond well to Dox induction.

To directly test the CRISPRi effect in vivo, we designed 3 sgRNAs, which respectively target the specific enhancer and the first exon of TFAM (mitochondrial transcription factor A), whose depletion results in muscle atrophy [36]. To achieve high knockdown efficiency in vivo, we cloned multi-gRNAs by linking the 3 sgRNAs linearly into an adeno-associated viral (AAV) vector simultaneously expressing green fluorescent protein (GFP). The construct was used for AAV packaging and purification. Then the high titer virus was injected into the tibialis anterior muscle of 6-week-old iKRAB KI mice. Dox-containing water was fed to the mice 2 weeks after injection. We chose to test in muscles mainly considering of technical feasibility and local virus concentration. Mice were humanely killed after 1 month of Dox induction, and tissues from the tibialis anterior muscle were isolated for analysis (Fig 7A). Successful transduction was confirmed by the observation of GFP. And Tfam expression levels were significantly lower in GFP+ cells than in the GFP− cells as shown by RT-qPCR analysis of the sorted cells (Fig 7B). IF analysis of GFP and laminin expression at the myofiber membrane demonstrated that the diameter of muscle fibers was significantly smaller in the AAV-infected muscle fibers (GFP+) compared with the uninfected ones (GFP−) (Fig 7C). The cross-sectional areas of the GFP+ with GFP− myofibers from 6 mice were calculated. As shown in Fig 7D, the muscle fibers with down-regulated Tfam expression were much smaller than the control group, indicative of muscle atrophy. Consistently, the grip strength of AAV-injected hindlimbs was significantly weaker than the contralateral ones with PBS injection, no matter we injected virus at the left or right hindlimb (Fig 7E). Taken together, the iKRAB KI mice provide a versatile model for ex vivo and in vivo LOF studies.

Fig 7

In vivo inducible CRISPRi effect of the iKRAB KI mouse.

(A) Schematic diagram shows that AAV expressing multiplex gRNAs against Tfam locus was injected into the tibialis anterior muscle of the iKRAB KI mice, followed by 1 month of Dox induction and the subsequent analysis. (B) RT-qPCR analysis showing Tfam mRNA levels in the designated groups. (C) IF analysis of laminin expression of the tibialis anterior muscle tissue around the injection sites. GFPs mark the infected muscle fibers. The scale bar represents 50 μm. (D, E) Quantification of the cross-sectional area of the tibialis anterior muscle fibers and grip strength in designated groups (n = 6 mice). L, left; R, right. The data in B, D, and E are presented as means ± SD (n = 3 or 6) (*p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001; and 2-tailed unpaired t test). The numerical values used to generate graphs in panel B, C, and E are available in S1 Data. AAV, adeno-associated viral; CRISPRi, CRISPR interference; GFP, green fluorescent protein; IF, immunofluorescence; KI, knock-in; RT-qPCR, reverse transcription PCR; SD, standard deviation.

Discussion

In this study, we generate an inducible CRISPRi mouse ESC line and KI mouse, inducibly and reversibly expressing dCas9-KRAB protein. With either the cell line or animal model, a simple transduction of gRNAs enables us to do any controllable LOF studies.

CRISPRi techniques have been shown to repress gene transcription to different extent in a variety of cell models [37]. Here, we argued that induced dCas9-KRAB displayed limited effects on active promoters or enhancers. And it was not due to unoptimized gRNA designing because even the same sgRNA achieved differential repressive activities at distinct cellular states (Fig 3). Actually, this issue was also recently raised by several other studies [38-40]. For example, the sgRNA targeting the MYC promoter that led to down-regulated MYC expression 6.2-fold in HEK293T cells showed very modest or no repressive activity in cancer cell lines with high levels of MYC expression [39]. This performance is consistent with the transcriptional repression mechanism that KRAB-ZFPs facilitate heterochromatin formation and spreading at inactive chromatin regions [11,13,14,41]. Although dCas9-KRAB protein is tethered to chromatin locally by sgRNAs, it is not sufficient to counteract the active chromatin environment for the propagation of heterochromatin-like features (S3 Fig). And we did find that multi-gRNAs targeting a wide range of regions at the same gene (e.g., Oct4, Nanog, and Tfam) mediate sufficient transcriptional repression (Figs 2B and 7B). Considering the increased risk of off-target of multi-gRNAs, other optimization strategies need to be tested to improve CRISPRi effect on active genes in the future. Recently, KRAB combination with MeCP2 or LSD1 or alternative repressors like SIN3-interacting domain (SID) have been reported to achieve superior efficiency [38,40,42] and are worth further testing at active genes in different cell types.

Despite insufficiency to induce gene inactivation, we showed that dCas9-KRAB preset at inactive promoters or enhancers was sufficient to maintain or foster the inactive state. Taking cell differentiation or reprogramming models, we demonstrated that Dox-induced locus-specific perturbation in iKRAB cells is competent to restrict gene activation and thereby affect cell fate transitions. Moreover, although we only test gRNAs targeting a single gene in our study, we believe that simultaneous introduction of sgRNAs targeting multiple genes would work as well.

In addition to functional studies of individual genes or cis-regulatory elements, genome-scale CRISPRi screens have been widely applied to identify genes or noncoding RNAs that control diversity of cellular processes [8,34,38,43,44]. Similarly, we can take iKRAB ESC or its derivatives for CRISPRi screens to identify new genes that regulate stem cell self-renewal and differentiation, to screen potential barriers against reprogramming or to map any key cis-regulatory elements especially enhancers for cell fate decisions (Fig 4H). For this purpose, the iKRAB KI mouse will provide a convenient platform for broader applications. Taking adult stem cells or differentiated cells (e.g., fibroblast) from the iKRAB KI mice for ex vivo functional studies or screens will avoid the problems of inadequate ESC differentiation, which will consequently contribute to the improvement of differentiation or reprogramming efficiency for regenerative medicine in the long term. For cellular processes like hematopoiesis, a more physiologically relevant approach is to perform bone marrow transplantation (BMT) after in vitro introduction of gRNAs (Fig 8). There is no doubt that these applications have important implications in developmental and stem cell biology.

Fig 8

The versatility of the iKRAB KI mouse.

Primary cells isolated from the iKRAB KI mice, after being transduced by gRNAs in vitro, can be used for following ex vivo or in vivo functional studies or screens. Crossing the iKRAB KI mouse with other GEMM, we can deliver gRNAs targeting conserved regions harboring human SNPs for complex disease modeling. BMT, bone marrow transplantation; GEMM, genetically engineered mouse model; KI, knock-in; SNP, single nucleotide polymorphism.

More attractively, the iKRAB KI mouse may be valuable for modeling human diseases. Emerging evidences from genome-wide association studies (GWAS) have shown that the vast majority of disease-associated single nucleotide polymorphisms (SNPs) are located in the noncoding genomic regions. However, the causal–effect relationship between these noncoding mutations and phenotypes or diseases could hardly be established until the development of CRISPR-mediated genome and epigenome editing technologies. However, genome editing to generate disease-mimicking cell lines or mouse models that harbor patient-specific noncoding mutations is time-consuming and uneconomical. A trial of epigenome editing in advance to establish the regulatory potential of genomic regions harboring possible causal variants has been suggested [45]. Undoubtedly, our iKRAB systems are at least helpful for testing the conserved LOF variants. A simple delivery of gRNAs in the iKRAB KI mice will accelerate the functional exploration in living organisms that were previously beyond reach. Although our iKRAB KI mouse does not express Cre and the tissue-specific CRISPRi cannot be realized so far, the problem can be solved to pre-cross with specific Cre mouse. Furthermore, the crossing with existed genetically engineered mouse model (GEMM) will facilitate the modeling of complex human diseases including cancers (Fig 8). Moreover, these animal models will hopefully allow further drug screening and potential preclinical trials. In a word, these versatile iKRAB systems enable a wide range of CRISPRi applications in biological and disease processes.

Materials and methods

Ethics statement

All mouse experiments were performed under protocols approved by health guidelines of the Tianjin Medical University Institutional Animal Use and Care Committee in Tianjin, China (Approval number: TMUaMEC-2017009).

Cell culture

Mouse ESCs were cultured in Glasgow's Minimum Essential Medium (GMEM) with 15% fetal bovine serum (FBS) and 100 U/ml LIF in gelatin-coated plates. In order to maintain the naïve state, mouse ESCs were cultured in serum-free medium with N2 and B27 supplements, LIF, MEK inhibitor PD0325901 (1 μM), and GSK3 inhibitor CHIR99021 (3 μM). To switch to the primed state, ESC medium was switched to serum-free medium with N2 and B27 supplements, plus Fgf2 (12 ng/ml) and activin A (20 ng/ml) as described [28].

Cloning and plasmid preparation

The fragment of dCas9-KRAB was amplified from the plasmid (Addgene #50917) and introduced into Gateway Entry vector pCR8/GW/TOPO (Invitrogen, United States) following the manufacturer’s protocol and verified by sequencing. The right donor was subcloned into the destination vector p2Lox-FLAG [18] by Gateway Technology (Invitrogen).

gRNA design and cloning

To minimize off-targets, gRNAs were designed at the following website: http://crispor.tefor.net/. Synthesized oligonucleotides were annealed and cloned into pLX-sgRNA vector following protocol from Addgene (#50662). The sequences of all the gRNAs are listed in S2 Table.

Generation of iKRAB ESC line

After 16 h of Dox treatment, A2Loxcre mouse ESCs [17] were transfected with p2Lox-FLAG-dCas9-KRAB plasmids using Lipofectamine 3000 (Invitrogen), followed by G418 selection (50 μg/ml) for 7 days. Individual colonies were isolated after approximately 10 days, expanded, and screened by PCR for inserted sequence. PCR primers are F: TTACCACTCCCTATCAGTGATAG; R: AGGAAGCTCTCTTCCAGCCTATG. And the inducible expression of FLAG-dCas9-KRAB protein was confirmed by western blot assay.

RT-qPCR

Total RNA was extracted with TRIZOL (Invitrogen). Reverse transcription and quantitative real-time PCR were performed as described [46]. Gene expression was determined relative to RPLPO or Gapdh using the ΔCt method. The primers are listed in S3 Table.

ChIP-qPCR

Chromatin preparation was performed as previously described [47]. Briefly, after crosslinking with 1% formaldehyde for 10 min at room temperature and then quenching with 0.125 M glycine for another 5 min, cells were washed with PBS and lysed in SDS buffer (100 mM NaCl, 50 mM Tris-Cl pH 8.1, 5 mM EDTA pH 8.0, 0.5% SDS, protease inhibitors). Nuclei sresuspended in appropriate volume of ice-cold IP buffer (100 mM NaCl, 50 mM Tris-Cl pH 8.1, 5 mM EDTA pH 8.0, 0.3% SDS, 1.0% Triton X-100) was sonicated using a BioRuptor sonicator (Diagenode, Liege, Belgium), followed by centrifugation at 16,000×g for 20 min at 4°C. Chromatin was then divided in different aliquots that were incubated overnight at 4°C with primary antibodies. Next, 30 μl protein G magnetic beads were incubated with the reaction for 3 h at 4°C. Beads were washed 3 times with high salt buffer (1% Triton X-100, 0.1% SDS, 500 mM NaCl, 2 mM EDTA, pH 8.0, 20 mM Tris-HCl, pH 8.0). After reversal of the crosslinking, ChIP DNA was purified for qPCR analysis. The primers are listed in S4 Table.

NPC and neuronal differentiation

The differentiation was performed following a previous protocol [48]. Briefly, ESCs were cultured in differentiation medium (GMEM medium, 15% FBS, non-essential amino acids, β-mercaptoethanol, L-glutamine, penicillin/streptomycin, sodium pyruvate) to form EB by hanging drops. After 4 days, EBs were collected and cultured on bacteriological Petri dishes with 5 μM ATRA for another 2 days. Then EBs were digest and seeded on 0.1% gelatin-coated plates for another 2 days with RA. After 8 days NPC stage, cells were cultured in N2 medium (DMEM/F12 medium with 3 mg/ml glucose, 1/100 N2 supplement, 10 ng/ml bFGF, 50 U/ml pen/strep, 1 mM/L-glutamine) for another 4 days without ATRA to generate neurons. The derived neurons were maintained in complete neurobasal medium before proceeding for analysis.

PDLSC extraction and differentiation

PDLSCs were isolated from 8 weeks iKRAB KI mice. Clipping 4 incisors and the surrounding gingival tissue of mice. Repeated washing with PBS. Tissues were digested in Collagenase I and dispase for 1 h and shaked every 15 min in 37°C. The reaction was then stopped with the same amount of serum, followed by centrifuge and cell seeding on culture dish with StemRD MSC medium for 10 days. For PDLSC differentiation, PDLSC were cultured in osteogenic culture medium (10 mM sodium b-glycerophosphate, 100 μg/l vitamin C, 10 nM dexamethasone) for 5 days [35]. ALP staining was performed according to the protocol from Beyotime Box.

Lentivirus and AAV preparation

All lentiviruses were generated as previously described [46]. Briefly, lentiviral backbone expressing single or multiplex gRNAs with pAX8 (packaging) and pCMV-VSVG (envelope) plasmids were co-transfected into 293FT cells. After 48 h, virus supernatants were harvested, filtered, and incubated with iKRAB ESCs or primary cells from the iKRAB KI mice. For AAV2 production, HEK293 cells were transfected with the pAAV2 plasmid expressing gRNAs, helper plasmid pDF6, and PEI Max (Polysciences 24765–2, Shanghai, China). At 72 h posttransfection, the cells were rinsed and pelleted via low-speed centrifugation. Afterward, the viruses were applied to HiTrap heparin columns (GE Biosciences 17-0406-01, Shanghai, China) and washed with a series of salt solutions with increasing molarities. During the final stages, the eluates from the heparin columns were concentrated using Amicon ultra-15 centrifugal filter units (Millipore, Burlington, Massachusetts, US).

Chromosome conformation capture (3C)

3C assays were performed according to previous reports [49]. Cells were crosslinked with 1% formaldehyde for 10 min and quenched with 0.125 M glycine for 5 min. Fixed cells were resuspended in lysis buffer (50 mM Tris-HCl, pH 7.5, 150 mM NaCl, 0.5% NP-40) for 1 h on ice. Nuclei were resuspended in 0.5 ml of 1× restriction buffer with 0.3% SDS and incubated at 37°C for 1 h. After that, Triton X-100 was added to a final concentration of 1.8% followed by 20 min incubation at 37°C with shaking. Afterwards, chromatin was digested with HhaI overnight at 37°C. Restriction enzymes were inactivated by adding SDS to a final concentration of 1.6% and incubating the mixture for 20 min at 65°C while shaking. The digested chromatin was diluted 10 times and transferred to new tubes. Then digested chromatin was ligated with 100 U of T4 DNA ligase (with Triton X-100 at a final concentration of 1%) for 8 to 14 h at 16°C. Ligated chromatins were de-crosslinked with 300 mg of proteinase K and incubated at 65°C overnight, followed by RNase A treatment for 1 h at 37°C. DNA was then purified by phenol/chloroform extraction followed by ethanol precipitation and re-suspension in water. 3C-PCR primers were designed in HhaI fragments located within the enhancer and promoter regions of interest. In addition, we also designed a pair of PCR primers to amplify an approximately 200 bp fragment without intervening HhaI sites at the Sox2 locus, which was used as a loading control. The primers are listed in S5 Table.

SgRNA library preparation and CRISPRi screening

For each transcript, 3 to 5 sgRNAs were designed using CRISPRseek within 500 bp upstream and downstream of the TSS (including alternative TSS). sgRNA sequences that contained BsmbI restriction sites were excluded. The oligonucleotide library was synthesized, annealed, amplified, and ligated into the linearized pKLV-U6gRNA-EF(BbsI)-PGKbsd2ABFP vector (modified from addgene #62348 by replacing puro with bsd resistance cassette) for lentivirus packaging. The iKRAB ESCs were transduced with pooled lentiviral sgRNA with multiplicity of infection (MOI) < 0.3. After selection of blasticidin (10 μg/ml) for 4 days, the transduced cells proceeded for NPC differentiation. A803467 (8 nM) and Dox (1 μg/ml) were treated at 4 days after differentiation. 3 × 106 cells each from the input and survived cells were harvested for genomic DNA extraction 8 days after differentiation and selection. The double sgRNA-encoding regions were then amplified by PCR followed by next generation sequencing (NGS) library preparation (Vazyme cat.TD503-01, Nanjing, China) and sequencing on an Illumina Hiseq-2500 (San Diego, US). The amplification primers for the library construction and NGS are summarized in S6 Table)

Generation of animal models and AAV delivery

ESCs were injected to embryonic day 3.5 mouse blastocysts to obtain the founder mice. Chimeric founder mice were bred with C57BL/6 mice, and offsprings with germline transmission were genotyped for rtTA and TRE-dCas9-KRAB transgenes (primers list in S6 Table) and intercrossed to generate iKRAB heterozygous or homozygous KI mice. Animals were fed standard chow diets with access to drinking water ad libitum while housed under a 12-h light–dark cycle. Six-week-old iKRAB KI mice were injected at multiple sites in the tibialis anterior with AAV-Tfam (virus titer: 8.1E12) with 30 μl per mice. Injections were carried out under general anesthesia. After 2 weeks, animals were fed by 5% sucrose water with 1 mg/ml Dox for 1 month. Mice were humanely killed via cervical dislocation, and the muscles were rapidly excised.

IF

Cells were seeded onto slides followed by different treatments and proceeded for IF analysis as previously described [50]. The primary antibodies were listed in S7 Table. The muscle tissue preparation and IF analysis were performed as described [51]. Muscles isolated from tendon to tendon and covered by optimum cutting temperature (OCT) cryoprotectant (Sakura, US) were rapidly passed in liquid nitrogen-cooled isopentane (VWR) for 1 min and left at −80°C until processed. Frozen samples were cryosectioned at 8-μm thickness using a Leica CM1860 cryostat (Buffalo, US). Then sections were fixed for 10 min with 4% paraformaldehyde in PBS, washed in PBS, and blocked in a solution consisting of 1% Tween-20, 5% BSA, and PBS for 1 h. Then the sections were incubated in anti-laminin antibodies overnight at 4°C. After 2 washes with PBS-1% Tween-20, samples were incubated with secondary antibodies (1:200, ZSGB-BIO, Alexa-Fluor-594) in PBS for 2 h, followed by 5 min incubation in DAPI nuclear stain (Life Technologies, US). Images were captured using a DP72 fluorescence microscope (Olympus, Japan).

Measurement of myofiber cross-sectional area

The cross-sectional area of the myofibers was calculated on section images obtained from the tibialis anterior muscles using ImageJ.

Functional grip strength test

Treated and control mice were tested using a commercial grip strength monitor (Chatillon, UK). Briefly, mice were allowed to grip wire mesh of the apparatus by their left or right hindlimbs. Each mouse pulled gently until they released their grip and was given 3 trials per examining period. The force exerted by each hindlimb was recorded for subsequent statistical analysis.

Confirmation of the iKRAB ESC line.

(A) Genotyping PCR analysis of proper integration of dCas9-KRAB at the designed locus. (B) Western blot analysis showing the inducible expression of FLAG-dCas9-KRAB protein by different concentration of Dox. Gapdh served as a loading control. A relative gray value quantification of dCas9-KRAB protein levels is below each lane of the band. dCas9, deactivated Cas9; Dox, doxycycline; ESC, embryonic stem cell; KRAB, Krüppel-associated box; PCR, polymerase chain reaction.

(TIF)

Click here for additional data file.

CRISPRi by sgRNAs is insufficient at active genes.

(A) Oct4 expression levels are down-regulated around 50% accompanied with higher rate of Nanog-positive cells. IF staining of Oct4 and Nanog in SL-cultured iKRAB cells containing Oct4#sgRNA-4 treated with or without Dox. The scale bar represents 50 μm. Right panel: (B) The relative density of Oct4 and the relative Nanog-positive cell numbers are compared in designated group. Data are represented as the mean ± SD of replicates (n = 3). (**p < 0.01, ***p < 0.001; 2-tailed unpaired t test). The numerical values used to generate graphs in panel B are available in S1 Data. CRISPRi, CRISPR interference; Dox, doxycycline; IF, immunofluorescence; SD, standard deviation.

(TIF)

Click here for additional data file.

dCas9-KRAB binds at active and inactive chromatin regions comparably.

(A) ChIP-qPCR analysis of dCas9-KRAB guided by sgRNAs targeting around the TSS of Oct4 and Fgf5 with Cas9, FLAG, and H3K9me3 antibodies respectively. (B) ChIP-qPCR analysis of dCas9-KRAB guided by multi-gRNAs targeting around the TSS of Oct4 with Cas9 and H3K9me3 antibodies, respectively. Data are represented as the mean ± SD of replicates (n = 3). The numerical values are available in S1 Data. ChIP, chromatin immunoprecipitation; dCas9, deactivated Cas9; qPCR, quantitative polymerase chain reaction; SD, standard deviation; sgRNA, single-guide RNA; TSS, transcription start site.

(TIF)

Click here for additional data file.

CRISPRi targeting Oct4-PE does not down-regulate Oct4 expression in 2i-cultured ESCs.

RT-qPCR analysis of Oct4 expression in stable iKRAB ESCs (2i condition) containing sgRNA against Oct4-PE. Data are represented as the mean ± SD of replicates (n = 3). The numerical values are available in S1 Data. CRISPRi, CRISPR interference; ESC, embryonic stem cell; PE, proximal enhancer; RT-qPCR, reverse transcription PCR; SD, standard deviation; sgRNA, single-guide RNA.

(TIF)

Click here for additional data file.

CRISPRi targeting Oct4-PE hinders the epigenetic changes induced by medium switch.

ChIP-qPCR analysis of epigenomic alterations at PE of Oct4 with or without Dox treatment during switch from 2i to SL conditions. Data are represented as the mean ± SD of replicates (n = 3) (***p < 0.001, **p < 0.01, *p < 0.05; 2-tailed unpaired t test). The numerical values are available in S1 Data. ChIP, chromatin immunoprecipitation; CRISPRi, CRISPR interference; Dox, doxycycline; PE, proximal enhancer; qPCR, quantitative polymerase chain reaction; SD, standard deviation.

(TIF)

Click here for additional data file.

CRISPRi targeting Sox2-PE hinders the RA-induced chromatin interaction.

3C-PCR analysis of Sox2 PE in designed groups. The primers tested the interaction between Oct4-TSS and Sox2-PE served as a negative control. A relative gray value quantification of PCR products is below each lane of the band. ChIP, chromatin immunoprecipitation; PCR, polymerase chain reaction; PE, proximal enhancer; TSS, transcription start site.

(TIF)

Click here for additional data file.

Confirmation of Prmt2 knockdown efficiency.

RT-qPCR analysis of Prmt2 expression in the shPrmt2-transduced cells (shPrmt2-1 and -2) with or without Dox induction. Data are represented as the mean ± SD of replicates (n = 3) (***p < 0.001; 2-tailed unpaired t test). The numerical values are available in S1 Data. Dox, doxycycline; RT-qPCR, reverse transcription PCR; SD, standard deviation.

(TIF)

Click here for additional data file.

List of sgRNAs with log10FC > 1 and p < 0.05.

sgRNA, single-guide RNA.

(XLSX)

Click here for additional data file.

SgRNA sequences.

sgRNA, single-guide RNA.

(DOCX)

Click here for additional data file.

RT-qPCR primers.

RT-qPCR, reverse transcription PCR.

(DOCX)

Click here for additional data file.

ChIP-qPCR primers.

ChIP, chromatin immunoprecipitation; RT-qPCR, reverse transcription PCR.

(DOCX)

Click here for additional data file.

3C-PCR primers.

PCR, polymerase chain reaction.

(DOCX)

Click here for additional data file.

SgRNA and NGS library construction and genotyping PCR primers.

NGS, next generation sequencing; PCR, polymerase chain reaction; sgRNA, single-guide RNA.

(DOCX)

Click here for additional data file.

Antibodies in this study.

(DOCX)

Click here for additional data file.

Numerical data used in all the figures.

(XLSX)

Click here for additional data file.

22 Apr 2020

Dear Dr Wu,

Thank you for submitting your manuscript entitled "Generation and Validation of Versatile Inducible CRISPRi Embryonic Stem Cell and Mouse Models" for consideration as a Methods and Resources by PLOS Biology.

Your manuscript has now been evaluated by the PLOS Biology editorial staff as well as by an academic editor with relevant expertise and I am writing to let you know that we would like to send your submission out for external peer review.

However, before we can send your manuscript to reviewers, we need you to complete your submission by providing the metadata that is required for full assessment. To this end, please login to Editorial Manager where you will find the paper in the 'Submissions Needing Revisions' folder on your homepage. Please click 'Revise Submission' from the Action Links and complete all additional questions in the submission questionnaire.

Please re-submit your manuscript within two working days, i.e. by Apr 24 2020 11:59PM.

Login to Editorial Manager here: https://www.editorialmanager.com/pbiology

During resubmission, you will be invited to opt-in to posting your pre-review manuscript as a bioRxiv preprint. Visit http://journals.plos.org/plosbiology/s/preprints for full details. If you consent to posting your current manuscript as a preprint, please upload a single Preprint PDF when you re-submit.

Once your full submission is complete, your paper will undergo a series of checks in preparation for peer review. Once your manuscript has passed all checks it will be sent out for review.

Given the disruptions resulting from the ongoing COVID-19 pandemic, please expect delays in the editorial process. We apologise in advance for any inconvenience caused and will do our best to minimize impact as far as possible.

Feel free to email us at plosbiology@plos.org if you have any queries relating to your submission.

Kind regards,

Di Jiang

PLOS Biology

29 May 2020

Dear Dr Wu,

Thank you very much for submitting your manuscript "Generation and Validation of Versatile Inducible CRISPRi Embryonic Stem Cell and Mouse Models" for consideration as a Methods and Resources at PLOS Biology. Your manuscript has been evaluated by the PLOS Biology editors, an Academic Editor with relevant expertise, and by four independent reviewers.

The reviews of your manuscript are appended below. You will see that the reviewers find the work potentially interesting. However, based on their specific comments and following discussion with the academic editor, I regret that we cannot accept the current version of the manuscript for publication. We remain interested in your study and we would be willing to consider resubmission of a comprehensively revised version that thoroughly addresses all the reviewers' comments. We cannot make any decision about publication until we have seen the revised manuscript and your response to the reviewers' comments. Your revised manuscript would be sent for further evaluation by the reviewers.

We appreciate that these requests represent a great deal of extra work, and we are willing to relax our standard revision time to allow you six months to revise your manuscript.We expect to receive your revised manuscript within 6 months.

Please email us (plosbiology@plos.org) if you have any questions or concerns, or would like to request an extension. At this stage, your manuscript remains formally under active consideration at our journal; please notify us by email if you do not intend to submit a revision so that we may end consideration of the manuscript at PLOS Biology.

**IMPORTANT - SUBMITTING YOUR REVISION**

Your revisions should address the specific points made by each reviewer. Please submit the following files along with your revised manuscript:

1. A 'Response to Reviewers' file - this should detail your responses to the editorial requests, present a point-by-point response to all of the reviewers' comments, and indicate the changes made to the manuscript.

*NOTE: In your point by point response to the reviewers, please provide the full context of each review. Do not selectively quote paragraphs or sentences to reply to. The entire set of reviewer comments should be present in full and each specific point should be responded to individually, point by point.

You should also cite any additional relevant literature that has been published since the original submission and mention any additional citations in your response.

2. In addition to a clean copy of the manuscript, please also upload a 'track-changes' version of your manuscript that specifies the edits made. This should be uploaded as a "Related" file type.

*Resubmission Checklist*

When you are ready to resubmit your revised manuscript, please refer to this resubmission checklist: https://plos.io/Biology_Checklist

To submit a revised version of your manuscript, please go to https://www.editorialmanager.com/pbiology/ and log in as an Author. Click the link labelled 'Submissions Needing Revision' where you will find your submission record.

Please make sure to read the following important policies and guidelines while preparing your revision:

*Published Peer Review*

Please note while forming your response, if your article is accepted, you may have the opportunity to make the peer review history publicly available. The record will include editor decision letters (with reviews) and your responses to reviewer comments. If eligible, we will contact you to opt in or out. Please see here for more details:

https://blogs.plos.org/plos/2019/05/plos-journals-now-open-for-published-peer-review/

*PLOS Data Policy*

Please note that as a condition of publication PLOS' data policy (http://journals.plos.org/plosbiology/s/data-availability) requires that you make available all data used to draw the conclusions arrived at in your manuscript. If you have not already done so, you must include any data used in your manuscript either in appropriate repositories, within the body of the manuscript, or as supporting information (N.B. this includes any numerical values that were used to generate graphs, histograms etc.). For an example see here: http://www.plosbiology.org/article/info%3Adoi%2F10.1371%2Fjournal.pbio.1001908#s5

*Blot and Gel Data Policy*

We require the original, uncropped and minimally adjusted images supporting all blot and gel results reported in an article's figures or Supporting Information files. We will require these files before a manuscript can be accepted so please prepare them now, if you have not already uploaded them. Please carefully read our guidelines for how to prepare and upload this data: https://journals.plos.org/plosbiology/s/figures#loc-blot-and-gel-reporting-requirements

*Protocols deposition*

To enhance the reproducibility of your results, we recommend that if applicable you deposit your laboratory protocols in protocols.io, where a protocol can be assigned its own identifier (DOI) such that it can be cited independently in the future. For instructions see: https://journals.plos.org/plosbiology/s/submission-guidelines#loc-materials-and-methods

Thank you again for your submission to our journal. We hope that our editorial process has been constructive thus far, and we welcome your feedback at any time. Please don't hesitate to contact us if you have any questions or comments.

Sincerely,

Di Jiang

PLOS Biology

*****************************************************

REVIEWS:

Reviewer #1: Overall, the authors present a resource that will be useful for the scientific community for basic studies as well as disease modeling in vitro and in vivo. However, much of their data is not quantified and there are logical gaps in some of their conclusions. These issues should be addressed prior to publication.

Major Comments

From data presented in Fig 2 and Fig 5, it is difficult to conclude that CRISPRi by iKRAB is not efficient on actively transcribed genes.

-For example, the most efficient window for CRISPRi gRNA design is reportedly the 100nt window downstream of the TSS. For OCT4 and BAP1, while the authors show multiple gRNAs, some are outside this window and therefore less likely to be effective. The authors do identify a gRNA for OCT4 which shows 50% knockdown. Showing a range of knockdown efficiencies for different gRNAs is not convincing for their argument above.

-If BAP1 triggers cell death as discussed by the authors, could the authors be selecting for cells with reduced BAP1 knockdown in Fig. S2B?

-In Fig 5E, it appears Runx2 expression is already activated by day 5 of differentiation and gRNA activation significantly inhibits Runx2 expression, which is nice to see in the mouse model but seems to conflict with their conclusions that the CRISPRi system is inefficient for silencing active genes.

-In the paper by Mandegar et al (Cell Stem Cell, 2016), they are able to largely eliminate NANOG expression in multiple iPSC clones using CRISPRi; how do the authors' reconcile these conclusions?

A significant amount of data used to draw conclusions is not quantified. A few examples are given below.

-Fig S2A (reportedly showing homogeneous downregulation of OCT4) is not at all convincing. These data should be quantified (e.g., Western blot analysis).

-Similarly, other immunostaining figures throughout the manuscript used to draw conclusions (e.g., Fig 2D, 3C, 3G, 4C) should be quantified.

-In Fig 4C, again the data needs to be quantitative in order to any draw conclusions and in this case, the data underlying their conclusions seems particularly weak. From the single images, it appears AMI-1+ alone (upper right) and A803467+ alone (bottom left) significantly alter cell morphology and/or viability. And it is difficult to tell what's going on in the AMI-1+ and A803467+ condition (bottom right).

-Fig 3G is insufficient to conclude differentiation defects. Are these fewer neurons? Less MAP2 per neuron?

RT-qPCR analyses:

-Similar fold changes are met with different conclusions by the authors. For example, all of the comparisons in Fig. 3B are significant (**), but based on the text, we are to conclude that the 2i comparison is not relevant, but the SL and FA conditions are.

-The authors conclude that the switch-on of Sox2 PE was blocked in Fig 3E but with essentially the same fold change and significance values, the authors conclude that OCT4 sgRNA#4 (Fig 2A) was of poor efficiency.

-In line 186-187, the authors reference a slight upregulation of OCT4 expression as shown by RT-qPCR (Fig 3A and S4) but Fig 3A is a schematic and the RT-qPCR data in Fig S4 shows no change. Should this be Fig 3B? If Fig 3B, why does OCT4 go up significantly when targeted under 2i conditions?

-It would be helpful to include fold-change for different conditions, as the reader has to compare relative changes across different baselines in the current RT-qPCR graphs.

Minor comments

-Please be consistent with nomenclature (e.g., gRNA and sgRNA used interchangeably).

-The labeling of Fig 6C, D seems off (lines 289-293) as Fig 6D is never referenced in the text.

Reviewer #2: The submitted manuscript "Generation and Validation of Versatile Inducible CRISPRi Embryonic Stem Cell and Mouse Models" describes generation of mouse ES cells (iKRAB) and consequently mice containing an inducible dCas9-KRAB construct. The authors find that CRISPRi induction does not repress its target locus well at highly expressed genes referred to as "actively transcribed genes" (eg when targeting the Oct4 promoter). The authors leverage transition states of differentiating iKRAB ES cells and demonstrate that dCas9-KRAB is capable of maintaining a repressed state at promoters or block activation at gene proximal enhancers. Finally, mice expressing inducible dCas9-KRAB are created to test repression ex vivo and in vivo.

Although this manuscript holds a great premise, this reviewer does not feel that the current manuscript lives up to its claims. The authors have made interesting observations that appear to only apply to a subset of cell states. This manuscript is of interest to the field, but claims about versatility cannot be made. Especially, considering another recent study has developed enCRISPRi and enCRISPRa mice (PMID:31980609) and have demonstrated versatility of their system and shown functionality in several mouse tissues.

Major concerns:

CRISPRi is a well-established system that has been used for high-throughput screens in many studies. In this study, the authors conclude: "Therefore our data argue against the high CRISPRi efficiency by iKRAB on actively transcribed genes". Did the authors intend to refer to highly expressed genes or any gene that is expressed and hence actively transcribed? This claim needs to be better defined and strengthened by careful evaluation of the effect of iKRAB on genes with various expression levels. This is a necessity to evaluate the versatility of these cells.

The authors then identify very specific developmental stages to evaluate their CRISPRi ES cell line. In these particular situations of cell state transitions, the authors show convincingly that dCas-KRAB induction can maintain repression of inactive genes when targeting promoters or proximal enhancers. While these are interesting observations for iKRAB cells, they only apply to particular cell states and transitions and hence will have limited applications.

The authors further demonstrate the use of iKRAB cells in a screen targeting promoters of chromatin regulators to identify genes involved in toxicity of sodium channel blockers. Here the authors chose gRNAs targeting gene promoters. This is an interesting experiment again taking advantage of transitioning cells and identifying 19 candidate genes. It is unclear if the experiments were carried with biological replicates as this would be important to demonstrate validity of these findings. More thorough experimental design and validation is needed to support these observations.

When the iKRAB mouse model is used in combination with 3 gRNAs delivered to the muscle, significant reduction of TFAM is observed in vivo. All prior experiments are based on a single gRNA. Perhaps the iKRAB ES cells and mouse model would be more versatile when using multiple gRNAs. Could targeting of multiple guides to one target have a synergistic effect and more efficiently repress "actively transcribed genes"?

Minor comments:

Authors need to clearly identify all plasmids obtained from other sources (Addgene #) and add reference for each of these plasmids.

Inducible protein expression was confirmed by Western. There should be some reference to which antibody and protocol was used.

Which antibodies were used for ChIP? Please include company and catalog#

In all figures where applicable, please add sgRNA#s to corresponding position diagram. I assume they are graphed in the same order, but that would make it clearer.

Supplementary Figure S6. I did not see the difference between +/- DOX.

Reviewer #3: The goal of this study was to develop tools to suppress genes in murine ES cells and mice. The authors generated murine ES cells in which dCas9-KRAB was inserted into the Hprt locus under the control of a doxycycline (rtTA)-responsive promoter. They then demonstrate that introduction of sgRNAs targeting inactive, but not active, genes can maintain the target genes in an inactive state. They also demonstrate the utility of the ES cells by performing a high-throughput screen and by using them to create mice harboring the dCas9-KRAB cassette. Lastly, they use the novel mouse model to demonstrate suppression of a target gene in vivo.

Comments

1. A major limitation of the tools developed by the authors is the inability of the dCas9-KRAB transgene to silence active genes. Although the authors cite a study demonstrating a similar phenomenon, they do not acknowledge or discuss the numerous studies in which dCas9-KRAB effectively suppresses actively transcribing genes. For example, using an approach very similar to the authors, Conklin and co-workers created human iPSCs harboring a Dox-regulated dCas9-KRAB and showed that it effectively suppressed Nanog, which was robustly expressed prior to Dox addition (see Figure 2C in Cell Stem Cell 18:541, 2016). Indeed, the development of this technology by the Weissman and Qi labs for use in genome-wide screens depends on the ability of CRISPRi to suppress most target genes, irrespective of their initial transcriptional state. No explanation is provided for the lack of effectiveness in this particular model.

2. Another significant limitation is the lack of any demonstration of target gene specificity. While others have demonstrated relatively high specificity of the dCas9-KRAB system, whether such specificity exists in the ES cells and mice generated by the authors is unclear.

3. The statement on page 14 suggesting that in vivo use of dCas9-KRAB is challenging due to its large size is not supported by recent publications (Sci Reports 9:17312, 2019; Nature Neuroscience 21:447, 2018).

Reviewer #4: This manuscript presents data of using an inducible Crispr repression system to probe gene functions and epigenetic modulator-screening in mouse ES cells (iKRAB ESC), and in the mouse.

The system is in general not a novel one since many similar studies have been published. They however present some interesting findings. For example, the system suppresses gene expression more effectively for the genes that are not initially expressed. For genes that are highly expressing in ESCs, targeting the promoters or TSS is not effective. This finding is in line with other studies where targeting suitable enhancers is much more effective than TSS or promoters for actively expressing genes. The CRISPRi screening in this study has identified toxicity resistance genes which may provide possible solutions for neuroprotection, which is interesting.

Since the rtTA is inserted into the Rosa26 locus and the TRE-dCas9-KRAB integrated at the Hprt, it is expected that these two transgenes are segregated into different germline transmission mice from chimeras. The authors need to state clearly how the mice carrying the two transgenes are generated for in vivo study.

In the mouse experiment, the system is used to target the specific enhancer and the first exon of Mitochondrial transcription factor A (TFAM), whose depletion results in muscle atrophy. The data show that Tfam expression levels are significantly lower in GFP+ (AAV-gRNA-expressing) cells, which also have smaller diameter of muscle fibers, indicative of muscle atrophy. Have the authors performed any functional tests of these mice that have putative muscle atrophy?

Some details also appear missing. For example, the section describing Figure 6B-C is confusing, and apparently mis-cites figure panels. There is no citation of Figure 6D.

14 Sep 2020

Submitted filename: response to Reviewers.docx

Click here for additional data file.

9 Oct 2020

Dear Dr Wu,

Thank you for submitting your revised Methods and Resources paper entitled "Generation and Validation of Versatile Inducible CRISPRi Embryonic Stem Cell and Mouse Models" for publication in PLOS Biology. I have now obtained advice from the original reviewers and have discussed their comments with the Academic Editor.

Based on the reviews, we will probably accept this manuscript for publication, assuming that you will modify the manuscript to address the remaining points raised by the reviewers. IMPORTANT: Please also make sure to address the Data and other Policy-related requests noted at the end of this email.

We expect to receive your revised manuscript within two weeks. Your revisions should address the specific points made by each reviewer. In addition to the remaining revisions and before we will be able to formally accept your manuscript and consider it "in press", we also need to ensure that your article conforms to our guidelines. A member of our team will be in touch shortly with a set of requests. As we can't proceed until these requirements are met, your swift response will help prevent delays to publication.

To submit your revision, please go to https://www.editorialmanager.com/pbiology/ and log in as an Author. Click the link labelled 'Submissions Needing Revision' to find your submission record. Your revised submission must include the following:

- a cover letter that should detail your responses to any editorial requests, if applicable

- a Response to Reviewers file that provides a detailed response to the reviewers' comments (if applicable)

- a track-changes file indicating any changes that you have made to the manuscript.

*Copyediting*

Upon acceptance of your article, your final files will be copyedited and typeset into the final PDF. While you will have an opportunity to review these files as proofs, PLOS will only permit corrections to spelling or significant scientific errors. Therefore, please take this final revision time to assess and make any remaining major changes to your manuscript.

NOTE: If Supporting Information files are included with your article, note that these are not copyedited and will be published as they are submitted. Please ensure that these files are legible and of high quality (at least 300 dpi) in an easily accessible file format. For this reason, please be aware that any references listed in an SI file will not be indexed. For more information, see our Supporting Information guidelines:

https://journals.plos.org/plosbiology/s/supporting-information

*Published Peer Review History*

Please note that you may have the opportunity to make the peer review history publicly available. The record will include editor decision letters (with reviews) and your responses to reviewer comments. If eligible, we will contact you to opt in or out. Please see here for more details:

https://blogs.plos.org/plos/2019/05/plos-journals-now-open-for-published-peer-review/

*Early Version*

Please note that an uncorrected proof of your manuscript will be published online ahead of the final version, unless you opted out when submitting your manuscript. If, for any reason, you do not want an earlier version of your manuscript published online, uncheck the box. Should you, your institution's press office or the journal office choose to press release your paper, you will automatically be opted out of early publication. We ask that you notify us as soon as possible if you or your institution is planning to press release the article.

*Protocols deposition*

To enhance the reproducibility of your results, we recommend that if applicable you deposit your laboratory protocols in protocols.io, where a protocol can be assigned its own identifier (DOI) such that it can be cited independently in the future. For instructions see: https://journals.plos.org/plosbiology/s/submission-guidelines#loc-materials-and-methods

Please do not hesitate to contact me should you have any questions.

Sincerely,

Roli Roberts

Roland G Roberts, PhD,

Senior Editor,

rroberts@plos.org,

PLOS Biology

------------------------------------------------------------------------

ETHICS STATEMENT:

-- Many thanks for including the full name of the IACUC/ethics committee that reviewed and approved the animal care and use protocol/permit/project license. However, please could you also also include an approval number.

-- Please include the specific national or international regulations/guidelines to which your animal care and use protocol adhered. Please note that institutional or accreditation organization guidelines (such as AAALAC) do not meet this requirement.

------------------------------------------------------------------------

DATA POLICY:

You may be aware of the PLOS Data Policy, which requires that all data be made available without restriction: http://journals.plos.org/plosbiology/s/data-availability. For more information, please also see this editorial: http://dx.doi.org/10.1371/journal.pbio.1001797

Note that we do not require all raw data. Rather, we ask that all individual quantitative observations that underlie the data summarized in the figures and results of your paper be made available in one of the following forms:

1) Supplementary files (e.g., excel). Please ensure that all data files are uploaded as 'Supporting Information' and are invariably referred to (in the manuscript, figure legends, and the Description field when uploading your files) using the following format verbatim: S1 Data, S2 Data, etc. Multiple panels of a single or even several figures can be included as multiple sheets in one excel file that is saved using exactly the following convention: S1_Data.xlsx (using an underscore).

2) Deposition in a publicly available repository. Please also provide the accession code or a reviewer link so that we may view your data before publication.

Regardless of the method selected, please ensure that you provide the individual numerical values that underlie the summary data displayed in the following figure panels as they are essential for readers to assess your analysis and to reproduce it: Figs 2AB, 3BDEG, 4BDFGI, 5BDF, 6E, 7BDE, S2AB, S3, S4,S5, S7. NOTE: the numerical data provided should include all replicates AND the way in which the plotted mean and errors were derived (it should not present only the mean/average values).

Please also ensure that figure legends in your manuscript include information on where the underlying data can be found, and ensure your supplemental data file/s has a legend.

Please ensure that your Data Statement in the submission system accurately describes where your data can be found.

------------------------------------------------------------------------

BLOT AND GEL REPORTING REQUIREMENTS:

For manuscripts submitted on or after 1st July 2019, we require the original, uncropped and minimally adjusted images supporting all blot and gel results reported in an article's figures or Supporting Information files. We will require these files before a manuscript can be accepted so please prepare and upload them now. Please carefully read our guidelines for how to prepare and upload this data: https://journals.plos.org/plosbiology/s/figures#loc-blot-and-gel-reporting-requirements

------------------------------------------------------------------------

REVIEWERS' COMMENTS:

Reviewer #1:

The authors present new data and analysis which overall increase the rigor of the manuscript and the resources they have developed will be useful to the scientific community. However, a few key issues remain which should be addressed prior to publication.

First, the author's conclusions about dCas9-KRAB exerting modest effects on active gene expression remain confusing and not entirely supported by the data.

-The manuscript contains a mix of statements like, "after introduction of specific gRNAs, the induced dCas9-KRAB efficiently maintains gene inactivation, though it exerts modest effects on active gene expression" (lines 38-39), "induced dCas9-KRAB displayed limited effects on active promoters or enhancers" (lines 337-338), and "multi-gRNAs targeting a wide-range of regions of the same gene mediate sufficient transcriptional repression" (lines 348-349). Overall, are the authors arguing that dCas9-KRAB has modest effects on active gene expression only when using sgRNAs but that this problem can be resolved by multiplexing? Or that dCas9-KRAB, regardless of single- or multi-gRNAs utilization, has limited effects on active gene expression? This is an important difference and it is not always clear from the text and figures which position the authors are taking. If the authors want to draw conclusions about single- versus multi-gRNAs, then using multi-gRNAs should indeed spread the heterochromatin-like state in contrast to single-gRNAs (Fig S3). However, experiments like this were not done to directly test the hypothesis, if this is the position the authors want to argue. Their conclusions about single- versus multi-gRNAs remain limited; really just data shown for Oct4 for a direct comparison of single- versus multi- gRNA effects on a gene.

-In Fig 4B, there appears to be a rather dramatic effect with an Oct4 PE sgRNA in the SL conditions where the PE is active. Oct4 levels were referred to as "successfully repressed in the SL condition" in line 215 of the text. Was dox treatment given after the change from 2i to SL? Does this conflict with the conclusion of limited effects on active enhances?

-The point raised previously about BAP1 potentially triggering cell death (and therefore selecting for cells with reduced BAP1 knockdown) means that it is not a great example to select to show limited CRISPRi efficiency. Can the authors show other examples of genes that would not have this confound?

There are a few concerns with regard to quantification of IF images.

-Quantification was presented as cell number / mm2, which requires uniform plating density of all cultures for accuracy. These types of analyses should anchor the signal relative to the number of DAPI positive cells.

-In some cases, it's not clear how quantification was performed. For example, in Fig S2, Oct4 looks present but of reduced intensity in some cells in panel A, but the authors appear to take a positive / not positive approach to quantification in panel B. How did they threshold and quantify images like this? Moreover, the conclusion that "Oct4 expression was homogeneously downregulated after Dox treatment" (lines 130-131) seems at odd with quantification showing a nearly three-fold reduction in the number of positive cells (panel B)?

Finally, I am confused by Figure 3F/G. The authors state in lines 193-195 that "upon being switched back to 2i medium, a subset of the Mll1 knockdown cells regained Oct4 and Nanog expression. In contrast, Oct4 and Nanog-positive cells could hardly be observed in the control group." In Figure 3F/G, doesn't Mll1 knockdown (+dox) in 2i shows no Oct4 or Nanog expression in contrast to the control or -dox condition?

Reviewer #2:

The authors have addressed all concerns.

Reviewer #3:

The responses are adequate except for the response to comment 3. The authors claim that in vivo delivery of dCas9 is challenging but still do not adequately support this contention. They mistakenly claim that the references I cited use "super high titer of virus". The definition of "super high" is debatable. However, one of the publications I cited does not use virus at all but instead used a transgene via pronuclear injection, a procedure that is not really challenging at all. I maintain that the authors should modify this statement without providing evidence to support it.

28 Oct 2020

Submitted filename: response to Reviewers 202010.docx

Click here for additional data file.

2 Nov 2020

Dear Dr Wu,

On behalf of my colleagues and the Academic Editor, Bon-Kyoung Koo, I am pleased to inform you that we will be delighted to publish your Methods and Resources in PLOS Biology.

PRODUCTION PROCESS

Before publication you will see the copyedited word document (within 5 business days) and a PDF proof shortly after that. The copyeditor will be in touch shortly before sending you the copyedited Word document. We will make some revisions at copyediting stage to conform to our general style, and for clarification. When you receive this version you should check and revise it very carefully, including figures, tables, references, and supporting information, because corrections at the next stage (proofs) will be strictly limited to (1) errors in author names or affiliations, (2) errors of scientific fact that would cause misunderstandings to readers, and (3) printer's (introduced) errors. Please return the copyedited file within 2 business days in order to ensure timely delivery of the PDF proof.

If you are likely to be away when either this document or the proof is sent, please ensure we have contact information of a second person, as we will need you to respond quickly at each point. Given the disruptions resulting from the ongoing COVID-19 pandemic, there may be delays in the production process. We apologise in advance for any inconvenience caused and will do our best to minimize impact as far as possible.

EARLY VERSION

The version of your manuscript submitted at the copyedit stage will be posted online ahead of the final proof version, unless you have already opted out of the process. The date of the early version will be your article's publication date. The final article will be published to the same URL, and all versions of the paper will be accessible to readers.

PRESS

We frequently collaborate with press offices. If your institution or institutions have a press office, please notify them about your upcoming paper at this point, to enable them to help maximise its impact. If the press office is planning to promote your findings, we would be grateful if they could coordinate with biologypress@plos.org. If you have not yet opted out of the early version process, we ask that you notify us immediately of any press plans so that we may do so on your behalf.

We also ask that you take this opportunity to read our Embargo Policy regarding the discussion, promotion and media coverage of work that is yet to be published by PLOS. As your manuscript is not yet published, it is bound by the conditions of our Embargo Policy. Please be aware that this policy is in place both to ensure that any press coverage of your article is fully substantiated and to provide a direct link between such coverage and the published work. For full details of our Embargo Policy, please visit http://www.plos.org/about/media-inquiries/embargo-policy/.

Thank you again for submitting your manuscript to PLOS Biology and for your support of Open Access publishing. Please do not hesitate to contact me if I can provide any assistance during the production process.

Kind regards,

Alice Musson

Publishing Editor,

PLOS Biology

on behalf of

Roland Roberts,

Senior Editor

PLOS Biology