Literature DB >> 32917247

Identification of circular RNAs in the ovarian follicles of Meishan and Duroc sows during the follicular phase.

Su Xie1, Mengxun Li1,2, Yansen Chen3, Yi Liu1, Lipeng Ma1, Xiaomei Sun1, Yishan Sun1, Ruonan Gao1, Tao Huang4.   

Abstract

Circular RNAs (circRNAs) are a newly discovered class of endogenous non-coding RNAs that play an important role in growth and development by regulating gene expression and participating in a variety of biological processes. However, the role of circRNAs in porcine follicles remains unclear. Therefore, this study examined middle-sized ovarian follicles obtained from Meishan and Duroc sows at day 4 of the follicular phase. High-throughput RNA sequencing (RNA-seq) was utilized to construct circRNAs, and differential expression was identified. The findings were validated using reverse transcription PCR (RT-PCR) and DNA sequencing, GO and KEGG analyses were performed, and potential miRNA targets were identified. The RNA-seq identified a total of 15,866 circRNAs, with 244 differentially expressed in the Meishan relative to the Duroc (111 up-regulated and 133 down-regulated). The RT-PCR finding confirmed the RNA-seq results, and quantitative real-time PCR (qPCR) analysis examining a subset of the circRNAs showed that they are resistant to RNase R digestion. Bioinformatics analysis (GO and KEGG) showed that the host genes associated with the differentially expressed circRNAs are involved in reproduction and follicular development signaling pathways. Furthermore, many of the circRNAs were found to interact with miRNAs that are associated with follicular development. This study presents a new perspective for studying circRNAs and provides a valuable resource for further examination into the potential roles of circRNAs in porcine follicular development.

Entities:  

Keywords:  Circular RNAs; Follicular phase; Meishan; Middle-sized ovarian follicles; Sows

Mesh:

Substances:

Year:  2020        PMID: 32917247      PMCID: PMC7488758          DOI: 10.1186/s13048-020-00709-5

Source DB:  PubMed          Journal:  J Ovarian Res        ISSN: 1757-2215            Impact factor:   4.234


Introduction

For the past few years, circular RNAs (circRNAs) have attracted attention as a new member of the noncoding RNA family in animals [1-3]. In 1976, Sanger et al. first discovered that certain higher plant viruses were covalently closed circular RNA molecules [4]. Then in 1986, Kos et al. discovered that the hepatitis delta virus (HDV) genome comprises circRNA [5]. In recent years, breakthroughs in high-throughput deep sequencing technology have identified circRNAs in humans [3, 6, 7], mice [6, 7], nematodes [7, 8] and coelacanths [9]. Furthermore, studies have shown that circRNAs exhibit specific expression patterns in different tissues or cell types and at different developmental stages [3, 7]. The richness and diversity of circRNA expression may be related to the alternative splicing of RNA transcripts. Moreover, circRNA formation is facilitated by the complementary pairing between repeated intron sequences on both sides of axons [10-13]. Recent circRNA studies have shown that circRNAs possess structural diversity, a high abundance, and a high resistance to exonuclease or RNase degradation, are highly conserved, and have cell or tissue specific expression [13-15]. However, few studies have examined the regulation of circRNAs in association with animal reproduction. When examining ovary, testis, and placental circRNA expression patterns, studies have suggested a role in regulating the reproductive system and embryo development [16-19]. In a study performing transcriptome analysis of mouse germline cells, 18,822 circRNAs were identified, with 921 being sex related [20]. In another study examining differential circRNA expression in placenta tissues in pregnant women with preeclampsia (PE), a total of 143 up-regulated and 158 down-regulated circRNAs were identified [17]. Additionally, recent evidence suggests that circRNAs are involved in a wide range of biological processes and function as competitive endogenous RNAs (ceRNA) [21, 22]. During the cell cycle, circular RNA FoxO3 interacts with CKD2 (cyclin-dependent protein kinase 2) to stop the cell cycle progression during the G1/S phase [23]. CircRNAs have also been shown to regulate gene expression at the post-transcriptional level by binding to micro-RNAs (miRNAs), with cdr1as shown to act as a potent miRNA sponge that binds mir-7 and facilitates mRNA preservation [23, 24]. In the swine industry, sow productivity is one of the most important factors affecting the production efficiency. The main factor that limits litter size is the ovulation rate, with a higher ovulation rate contributing to a larger litter size. In China, the Meishan breed, a sub-group of the Taihu pig, provides sows with larger litter sizes relative to Durocs and is known for its high fecundity. In a previous study, differences in follicular growth dynamics between prolific Meishan sows and ordinary sows were found to occur during the mid-to-late-follicular phase and greatly contributed to the high ovulation rate [25]. Furthermore, another study suggested that there are significant differences in middle-size ovarian follicle growth regulation and physiological development between Meishan and Duroc sows [26]. Additionally, circRNAs have been examined in other organisms, including Drosophila ovarian tissue [27], goat ovarian follicles prior to ovulation [28], and honeybee ovaries in association with activation and spawning [29]. However, circRNAs have not been examined in association with porcine follicular development. Therefore, this study utilized RNA sequencing (RNA-seq) to explore circRNA differential expression during follicular development in Meishan and Duroc pigs. It is hoped that the results of this study will provide insight into the potential function of circRNA in porcine follicular development and aid in identifying circRNAs that are key to this process.

Materials and methods

Ethics statement

All procedures involving animals were approved by the Animal Care Committee of Shihezi University (Shihezi, China) and were conducted in accordance with the ethical standards established in the 1964 Declaration of Helsinki and its subsequent amendments.

Tissue sample collection

Meishan sows (n = 3) were obtained from Yangzhou University (Yangzhou, Jiangsu, China), and Duroc sows (n = 3) were obtained from Tiankang Animal Husbandry Co., Ltd. (Xinjiang, China). All multiparous sows showed a normal estrus and reproductive performance in accordance with their breed characteristics. A day 14 of estrus, veterinary chloroprostol (0.2 mg/per pig) was injected along the ear vein, and the sows were subsequently slaughtered 4 days later. The M2 follicles (~ 5.0–6.9 mm in diameter) were collected and snap frozen in liquid nitrogen. Total RNAs were isolated using TRIzol (Invitrogen, CA, USA) according to the manufacturer’s protocol, and RNA quantity and purity were assessed using a RNA6000 Nano Kit and Bioanalyzer 2100 (Agilent, CA, USA).

RNA-seq and quality control

Prior to RNA-seq, ribosomal RNA was removed from each individual sample (3 μg) using an Epicentre Ribo-Ribo-zero™ rRNA Removal Kit (Epicentre, USA), followed by ethanol precipitation to clean-up the rRNA free residue. Sequencing libraries were then generated using the rRNA-depleted RNA and a NEBNext® Ultra™ Directional RNA Library Prep Kit for Illumina® (NEB, USA) according to the manufacturer’s recommendations. Briefly, fragmentation was carried out in NEBNext First Strand Synthesis Reaction Buffer (5X) using divalent cations under an elevated temperature. First strand cDNA synthesis was performed using random hexamer primers and M-MuLV Reverse Transcriptase (RNaseH), and second strand synthesis was performed using DNA Polymerase I and RNase H, with remaining overhangs converted to blunt ends. For the dNTPs in the reaction buffer, dTTPs were replaced with dUTPs. After performing polyadenylation, a NEBNext Adaptor with hairpin loop structure was ligated to prepare for hybridization. To select cDNA fragments of a preferred length (~ 150–200 bp), the library fragments were purified using an AMPure XP system (Beckman Coulter, Beverly, MA, USA). The obtained size-selected, adaptor-ligated cDNA was then combined with 3 μl USER Enzyme (NEB) at 37 °C for 15 min, followed by 5 min at 95 °C. The PCR reaction was then performed with Phusion High-Fidelity DNA polymerase (NEB), Universal PCR primers, and Index (X) Primer. Finally, the PCR products were purified (AMPure XP system) and the library quality was assessed using an Agilent Bioanalyzer 2100 system. Index-coded samples were clustered using a TruSeq PE Cluster Kit v3-cBot-HS (Illumia, San Diego, CA, USA) with a cBot Cluster Generation System according to the manufacturer’s instructions. The libraries were then sequenced on an Illumina Hiseq 2500 platform, and 125 bp paired-end reads were generated. Raw data (raw reads) were obtained in FASTQ format and were preliminarily processed through an in-house perl script. In this step, clean reads were obtained by removing reads containing adapters or ploy-N and by removing low quality reads. Next, Q20, Q30, and GC contents were calculated for the clean reads, and all downstream analyses were performed using this high-quality clean data.

CircRNA identification

Reference genome and gene model annotation files were downloaded directly from the genome website (http:/genome.ucsc.edu/). An index for the reference genome was built using bowtie v2.2.8, and paired-end clean reads were aligned to the reference genome using TopHat v2.0.9. The circRNAs were detected and identified using find_circ [7]. The basic principle of find_circ is to extract a 20 nt anchor sequence from each end of a given read without comparison to the reference sequence, and then compare each pair of anchor sequences to the reference sequence. A read was determined to be a candidate circRNA if the 5′ end of the anchor sequence was aligned to the reference sequence (the start and stop sites are labeled A3 and A4, respectively), if the 3′ end of the anchor sequence was aligned upstream of that site (the start and stop sites are labeled A1 and A2, respectively), and if a splice site (GT-AG) existed between A2 and A3 in the reference sequence. Finally, a candidate circRNA was confirmed as a circRNA if the read count is greater than or equal to 2

Analysis of differentially expressed circRNAs

The raw counts were first normalized using TPM (transcripts-per-million clean tags) [30], and differential expression analysis was performed using the R package DESeq (1.10.1). DESeq provides statistical routines for determining differential expression for digital gene expression data using a model based on the negative binomial distribution. CircRNAs with a p < 0.05 and |log2 (fold change)| > 1.5 were considered significantly differentially expressed.

Target site prediction and enrichment analysis

MicroRNA target sites were identified within the exons of circRNA loci and were identified using miRanda and psRobot. Gene Ontology (GO) enrichment analysis was employed to characterize the host genes of the differentially expressed circRNAs using DAVID [31]. GO terms with a corrected p-value less than 0.05 were considered significantly enriched. Differential gene expression and circRNA host genes were further examined using KEGG pathway analysis, and statistical enrichment was determined using KOBAS [32]. Findings were considered statistically significant if p < 0.05 was obtained.

Reverse transcription PCR (RT-PCR) analysis and sequencing

Total RNAs were extracted from the sow ovarian follicles using TRIzol (Invitrogen, CA, USA), and cDNA was synthesized using a RT-PCR kit (Takara, Dalian, China). The PCR reaction was conducted using specific primers for circ_0012855, circ_0001712, circ_0015292, circ_0001651, circ_0008449, circ_0012124, circ_0000058, circ_0003666, circ_0010513, and circ_0011249 (Table 1). The PCR products were analyzed by gel electrophoresis, and a direct gene sequence analysis was performed. The PCR product sequences were then compared with the Sus scrofa reference genome and the RNA-seq data using DNAMAN software. The PCR reaction was conducted by combining 10 μL of premix (Takara, Dalian, China), 1 μL of cDNA template, 0.6 μL each of upstream and downstream primers, and 7.8 μL of RNase-free ddH2O water. RT-PCR was performed as follows: an initial denaturation at 95 °C for 5 min, followed by 45 cycles at 95 °C for 30 s, Tm (°C) for 30 s, and 72 °C for 30 s.
Table 1

List of RT-PCR primers

CircRNAPrimer sequences (5′–3′)PCR products (bp)
GAPDHF: TTCCAGTATGATTCCACCCACG242
R: TCGGCAGAAGGGGCAGAGAT
novel_circ_0012855F: CCCAAAGTGGCAACAAGG168
R: CGGTTCACAGATGAGGAGG
novel_circ_0001712F: GGCTTCAGCATCATCCCT156
R: TCGCTCGGTCTCCCATTT
novel_circ_0015292F: CACTGTGCCTCCTTGGGG169
R: CCAACCAGAGTGTATCCTTCATC
novel_circ_0001651F: GACGAGATGAGCGATGTGG146
R: GACGGGTTCTGGATGTGC
novel_circ_0012124F: TCTTTGTGTATTTCTGCCTG147
R: CCTTGATTTTCCTTGTCCT
novel_circ_0010513F: TCACAAATAAAGCCATCAGC182
R: ATACCGAATGCCCGAAAG
novel_circ_0011249F: CTGAGCGGTGTGTGTTCG164
R: GGCATTGGTGTCGTTGGT
novel_circ_0000058F: AGCAGAGTCTGTGATGCAGG136
R: GCTCGATCCCGATCAAATGC
novel_circ_0003666F: GAAGAATGTTTTCAGGCCG143
R: CTGCTCATTTTCTACATCCA
novel_circ_0008449F: GCAATTACCGTCCCAGGAGGA139
R: CTGAAGATGGTGGGGGATTGA
List of RT-PCR primers

Quantitative real-time PCR (qPCR) analysis

The expression levels of four circRNAs (circ_0015292, circ_0001651, circ_0012124, and circ_0010513) were detected via qPCR analysis, with GAPDH used as an internal reference gene [33]. To determine the resistance of circRNAs to RNase R digestion, total RNAs were treated with RNase R (RNR-07250; Epicentre) prior to cDNA synthesis. To validate differentially expressed circRNAs, total RNAs were directly subjected to cDNA synthesis using a RT-PCR kit (Takara, Dalian, China). Reactions were performed using SYBR Green I (TaKaRa Biotech, Dalian) according to the manufacturer’s protocol, and circRNA expression levels were normalized to linear GAPDH levels. Three independent experiments were performed using triplicate samples. The qPCR reaction was conducted by combining 10 μL of SYBR Premix DimerEraser (Takara, Dalian, China), 1 μL of cDNA, 0.6 μL each of the upstream and downstream primers, and 7.8 μL of RNase-free ddH2O water. The qPCR reaction was performed as follows: an initial denaturation at 95 °C for 300 s, followed by 45 cycles at 95 °C for 30 s, Tm (°C) for 30 s, and 72 °C for 30 s.

Results

High-throughput sequencing of porcine ovarian follicle circRNAs

To determine circRNA identities and abundances in intermediate porcine follicles obtained from Meishan and Duroc pigs, RNA-seq was performed (Fig. 1a) and circRNAs within the two libraries were identified using the find_circ program [7]. A total of 15,866 circRNAs were identified between the two groups and were found to consist of introns, exons, and a small number of intergenic sequences (Fig. 1b). Additionally, circRNA annotations, chromosomal locations, and host mRNA were also determined, with the top 25 up- and down-regulated circRNAs also identified based on log2FC values (Table 2).
Fig. 1

Swine follicle circRNA identification and structural analysis. a CircRNA identification procedure; b structural analysis of circRNAs

Table 2

Top 25 significantly up-regulated and down-regulated ovarian follicle circRNAs in Meishan sows relative to Duroc sows

Top 25 up-regulatedTop 25 down-regulated
IDlog2FCpgene symbolIDlog2FCpgene symbol
circ_00016517.15744.73E-06TUBG1circ_0015292−7.60426.84E-07C4BPA
circ_00105136.25710.000149SLC44A3circ_0012124−7.00328.38E-06YBX1
circ_00123075.87640.000529CICcirc_0001712−6.8541.58E-05SNF8
circ_00000585.37640.002057TRIP12circ_0001710−6.59534.22E-05UBE2Z
circ_00085875.3390.002296TCP11L1circ_0011249−6.16340.00019289ARFGAP3
circ_00092834.9810.005482PLEKHH2circ_0001727−5.82010.00057745ACSF2
circ_00103644.76630.009321PDE4DIPcirc_0015096−5.81960.00057511PPP2R1B
circ_00087634.73190.012184SNAP47circ_0000779−5.61150.0010579ERCC6L2
circ_00130044.68230.010512FLVCR2circ_0004779−5.36680.0020519COPS7B
circ_00141394.63140.015421APBB2circ_0011788−5.24870.0027847OSBPL1A
circ_00155594.62670.014702CT55circ_0014246−5.15310.0035303TMEM128
circ_00068394.62530.011693FAN1circ_0010747−4.90440.0068792RGS22
circ_00037994.5820.012761FAM53Bcirc_0012573−4.86690.0069703SNRNP40
circ_00062404.58030.012792BBS9circ_0002342−4.86180.0069977LSG1
circ_00091104.56590.013195FAM169Acirc_0015293−4.8350.011635C4BPA
circ_00082854.55060.013832SRFBP1circ_0015483−4.81460.0077605NKAP
circ_00155864.49120.019519PIRcirc_0000778−4.80010.0079754ERCC6L2
circ_00132674.46270.016911SLA-DQB1circ_0003666−4.74980.0088787PDCD4
circ_00132544.43240.021108SLA-1circ_0007960−4.73830.009741QKI
circ_00001104.42830.017194ASAP3circ_0002828−4.73260.0092144ITGA9
circ_00007264.40930.018716DENND1Bcirc_0005090−4.72310.0094609BAZ2B
circ_00016324.40930.018716MPP2circ_0000257−4.7140.0098126ATP8B1
circ_00152884.40590.018032SRGAP2circ_0010838−4.64540.011096RAD54B
circ_00105254.37780.02352BCAR3circ_0002634−4.64390.011083LTN1
circ_00111154.37450.01908FBXO7circ_0001669−4.60430.012109TOP2A
Swine follicle circRNA identification and structural analysis. a CircRNA identification procedure; b structural analysis of circRNAs Top 25 significantly up-regulated and down-regulated ovarian follicle circRNAs in Meishan sows relative to Duroc sows

Validation of circRNAs using RT-PCR

To further validate the RNA-seq findings, RT-PCR was employed and specific primers were designed to reverse amplify the circRNA junctions (Fig. 2). For the 10 randomly selected circRNAs, the head-to-tail junction sites were quantified via RT-PCR analysis and confirmed using DNA sequencing (Fig. 3). Additionally, the resistance of the circRNAs to RNase R digestion was also examined using qPCR. All of the examined circRNAs were found to be RNase R resistant, while the internal control, GAPDH, was not detected (sensitive to RNase R; Fig. 4).
Fig. 2

Circular junctions were amplified using divergent primers. Red arrows indicate the divergent primers

Fig. 3

DNA sequencing of each RT-PCR product amplified using divergent primers identifies circRNA back splicing sites. a Circ_0012855, circ_0001712, circ_0015292, circ_0001651 and circ_0012124; b circ_0010513, circ_0011249, circ_0000058, circ_0003666, and circ_0008449

Fig. 4

Determination of resistance to RNase R digestion using qPCR. GAPDH was used as a linear control

Circular junctions were amplified using divergent primers. Red arrows indicate the divergent primers DNA sequencing of each RT-PCR product amplified using divergent primers identifies circRNA back splicing sites. a Circ_0012855, circ_0001712, circ_0015292, circ_0001651 and circ_0012124; b circ_0010513, circ_0011249, circ_0000058, circ_0003666, and circ_0008449 Determination of resistance to RNase R digestion using qPCR. GAPDH was used as a linear control

Verification and analysis of differentially expressed circRNA

Further analysis confirmed the 244 differentially expressed middle follicle circRNAs, 111 up-regulated and 133 down-regulated, in Meishan sows relative to Duroc sows (Fig. 5a). Many of the circRNAs were distributed across various chromosomes, with many located on chromosome 1 (Fig. 5b). Next, four differentially expressed circRNAs were selected, and their expression levels were quantified via qPCR. The results showed in Meishan follicle samples that circ_0001651 and circ_0010513 expression is up-regulated relative to Duroc samples, while circ_0015292 and circ_0012124 expression is down-regulated (Fig. 5d). These findings are consistent with the RNA-seq findings and confirm that the sequencing results are accurate and reliable (Fig. 5e).
Fig. 5

Analysis and validation of differentially expressed circRNAs in Meishan ovarian follicle samples relative to Duroc samples. a Volcano plot demonstrating a distinguishable circRNA expression pattern between Meishan and Duroc ovarian follicles; b Circos plot displaying circRNA chromosomal distributions; c Circos plot displaying differentially expressed circRNA chromosomal distributions; d Relative expression levels of a subset of four circRNAs; e Comparison of qPCR and RNA-seq results confirms a high degree of consistency

Analysis and validation of differentially expressed circRNAs in Meishan ovarian follicle samples relative to Duroc samples. a Volcano plot demonstrating a distinguishable circRNA expression pattern between Meishan and Duroc ovarian follicles; b Circos plot displaying circRNA chromosomal distributions; c Circos plot displaying differentially expressed circRNA chromosomal distributions; d Relative expression levels of a subset of four circRNAs; e Comparison of qPCR and RNA-seq results confirms a high degree of consistency

GO and KEGG enrichment analysis of differentially expressed circRNA host genes

In previous studies, circRNAs have been shown to regulate the expression of their host genes [34-36], and their functions may relate to those of their host genes. Therefore, GO and KEGG pathway enrichment analysis was performed using the host genes associated with the differentially expressed circRNA. GO analysis identified 201 significantly enriched terms within the biological processes, molecular functions, and cellular components groups. The top 20 GO terms were associated with several functional categories, including metabolic processes, intracellular protease complexes, and enzymatic activity (Fig. 6), thus indicating that some circRNAs are involved in the basic biological regulation of porcine follicular development. The KEGG pathway analysis enriched 87 pathways (Fig. 6e), including PI3K-Akt, oocyte meiosis, and TGFβ-SMAD signaling pathways that are involved in follicular granulosa cell growth regulation. These results indicate that circRNAs play an important role in the formation and development of porcine follicles.
Fig. 6

Enrichment analysis of host genes associated with the differentially expressed circRNAs. a Top 20 GO terms overall; b Top 20 GO terms in biological processes; c Top 20 GO terms in cellular components; d Top 20 GO terms in molecular functions; and e Top 20 KEGG pathways

Enrichment analysis of host genes associated with the differentially expressed circRNAs. a Top 20 GO terms overall; b Top 20 GO terms in biological processes; c Top 20 GO terms in cellular components; d Top 20 GO terms in molecular functions; and e Top 20 KEGG pathways

Porcine follicle circRNA functional predictions

Previous studies have suggested that circRNAs can act as a miRNA sponge, thereby affecting the expression of miRNA target genes [2, 24, 37, 38]. Herein, miRanda and psRobot software were used to analyze potential interactions between circRNAs and miRNAs, with 1,925,007 potential interactions identified between 15,866 circRNAs and various miRNAs. Moreover, it is worth noting that some of the known miRNAs are closely related to follicular development and are considered prospects for future research. The circRNAs examined in this study were found to contain multiple conserved binding sites for miRNAs, such as miR-21, miR-144, or miR-181-a, which indicated that circRNAs are involved in follicular development (Fig. 7). To elucidate the functional roles of the examined circRNAs in association with miRNAs, circRNA target miRNAs and downstream regulated mRNAs were predicted, and a basic circRNA-miRNA-mRNA connective network was established (Fig. 8). The results indicated that porcine follicular growth and development are likely to be affected by circRNAs.
Fig. 7

CircRNA–miRNA correlation networks for four circRNAs and their target miRNAs. a Circ_0001651-miRNA; b circ_0015292-miRNA; c circ_0010513-miRNA; and d circ_0012124-miRNA

Fig. 8

Sankey ceRNA network diagram for the top 25 differentially expressed ovarian follicle circRNAs. Each rectangle represents a gene, and the connection degree of each gene is visualized based on the size of the rectangle. a The top 25 up-regulated; b the top 25 down-regulated

CircRNA–miRNA correlation networks for four circRNAs and their target miRNAs. a Circ_0001651-miRNA; b circ_0015292-miRNA; c circ_0010513-miRNA; and d circ_0012124-miRNA Sankey ceRNA network diagram for the top 25 differentially expressed ovarian follicle circRNAs. Each rectangle represents a gene, and the connection degree of each gene is visualized based on the size of the rectangle. a The top 25 up-regulated; b the top 25 down-regulated

Discussion and conclusions

CircRNAs are a new class of endogenous non-coding RNAs that were once considered a by-product of splicing errors but have been found to be widely expressed in human cells and function in many biological processes [7, 39]. Furthermore, studies have shown that circRNAs are involved in regulation [40-42] and can be associated with diseases, including cancer [43, 44]. CircRNAs are highly conserved and very stable, contain tissue-specific sequences, and contain unique ceRNA features [2, 24, 45]. Moreover, studies have suggested that human and mouse early embryos have a high degree of similarity in relevant biological processes where circRNA host genes appear to be primary factors [19, 46]. Among different species, most circRNA expressions are highly conserved [45, 47], with abnormal circRNA expression associated with many human diseases, such as cancer, nervous system diseases, and cardiovascular diseases [21, 43, 48, 49]. In ovarian cancer cells, the up-regulation of hsa-circ-0061140 promotes EMT, cell proliferation, and migration [50]. However, when it comes to livestock, especially swine, reproduction-associated circRNA expression remains unclear. Thus, this study focused on exploring the potential role of circRNAs in porcine follicle development. First, RNA-seq was utilized to establish follicular circRNA profiles for Meishan and Duroc sows. A total of 15,866 circRNAs were identified, with 244 being differentially expressed (111 up-regulated and 133 down-regulated). At present, research focused on examining the regulation of circRNAs in animal reproduction has been making small gains year by year. To improve the reproductive capacity in sows, it is important to more fully characterize the follicles and the factors that influence them. During oocyte maturation and early embryo development, granulocytes (GCs) are very important, and follicular atresia results in granulosa cell apoptosis [51, 52]. Dicer is a conserved ribonuclease and plays a key role in regulating oocyte development in mice [53]. Furthermore, mir-145 can inhibit the proliferation of mouse granulosa cells by targeting a gene called activin receptor IB (ACVR1B) [54]. In a previous study examining human GCs, circRNA_104816 and circRNA_103827 were found to potentially serve as biomarkers indicating follicular microenvironment damage, with their up-regulation being closely associated with a decreased ovarian reserve and poor reproductive outcomes [55]. Furthermore, in another study examining goat pre-ovulatory follicles, 37 differentially expressed circRNAs were identified, with chi-circ 0008219 found to regulate follicular growth by modulating three miRNAs [28]. Based on the above results, we hypothesized that circRNAs may serve as novel regulators of ovarian follicle growth and development during porcine reproduction. Some studies have shown that circRNAs can modulate miRNAs by acting as a miRNA sponge [7, 24, 56]. In cancers, CDR1as has been shown to act as a sponge for mir-7 and subsequently suppresses its activity and promotes tumor development [57]. Moreover, testis-specific sex-determining region Y (SRY) 9 acts as a sponge for mir-138 and contains 16 mir-138 binding sites, thus reducing its effects [24, 58]. Herein, miRanda and PSrobot were used to predict miRNA target sites within the identified porcine follicular circRNAs. Of the identified miRNA interactions, miR-191, miR-210, miR-132, miR-370, and miR-181-a were found to be associated with follicular development. Furthermore, the results showed that a single circRNA has different target binding sites for different miRNAs. One of the circRNAs, ssc-circ-0001651, was found to contain 18 potential binding sites for 8 different miRNAs associated with follicular granule cell development (partial results only), including let-7 g (3 target sites), miR-21 (1 target site), miR − 224 (1 target site), miR-10b (4 target sites), miR-16 (4 target sites), miR-106a (1 target site), miR-19b (2 targets sites), and miR-31 (2 target sites). For ssc-circ-0015292, 8 target sites were identified (partial results only) that bind miR-34a (1 target site), miR-144 (1 target site), miR-320 (1 target site), miR-181a (1 target site), miR-150 (1 target site), miR-23a (2 target sites), and miR-27a (1 target site). Therefore, these findings suggest that ssc_circ_0001651 and ssc_circ_0015292 can act as potential ceRNAs, which would make them newly identified porcine ovarian follicular development regulators, but further investigation is required. In addition to regulating gene expression, circRNAs have also been shown to serve other functions. Recent studies have indicated that circRNAs can direct protein synthesis via mRNA modulation, and a few of them may be converted to proteins via an IRES (internal ribosome entry site) insertion [59, 60]. Several factors and pathways are known to be involved in follicular growth and development, including follicle-stimulating hormone (FSH), insulin growth factor (IGF), and transforming growth factor-β (TGFβ) and their related receptor-mediated signaling pathways, including PI3K-Akt, Wnt/β-catenin, and TGFβ-SMAD signaling pathways. Furthermore, Tao et al. reported that prior to goat ovulation, the host genes of ovarian follicle circRNAs participate in ovarian corpus callosum generation pathways and p53 signaling [28]. CircRNA host genes have also been implicated in the production of ovarian steroids and their mediated signals that are critical for biological processes such as follicular growth, oocyte maturation, and ovulation [61].

Conclusions

In this study, GO and KEGG pathway annotations identified important biological processes and pathways, including metabolic processes, enzyme activity regulation, endocytosis, steroid hormone biosynthesis, cell cycle and cell adhesion, and homologous recombination. Moreover, important signaling pathways, such as TGF-β, p53, insulin, oocyte meiosis, and PI3K-Akt signaling pathways, were enriched. Collectively, these findings suggest that circRNAs can affect the development of porcine follicles by modulating associated pathways. In summary, ovarian follicle circRNA profiles were obtained for Meishan and Duroc sows, with differentially expressed circRNAs also identified. GO and KEGG analyses were then utilized to elucidate the roles of the identified differential circRNAs, with several found to be involved in ovarian follicle growth and development regulation. This study provides further insight into the mechanisms of porcine follicle development and the roles of circRNAs.
  60 in total

1.  Follicle dynamics and aromatase activity in high-ovulating Meishan sows and in Large-White hybrid contemporaries.

Authors:  A T Miller; H M Picton; J Craigon; M G Hunter
Journal:  Biol Reprod       Date:  1998-06       Impact factor: 4.285

2.  Analysis of intron sequences reveals hallmarks of circular RNA biogenesis in animals.

Authors:  Andranik Ivanov; Sebastian Memczak; Emanuel Wyler; Francesca Torti; Hagit T Porath; Marta R Orejuela; Michael Piechotta; Erez Y Levanon; Markus Landthaler; Christoph Dieterich; Nikolaus Rajewsky
Journal:  Cell Rep       Date:  2014-12-31       Impact factor: 9.423

3.  MicroRNA-145 suppresses mouse granulosa cell proliferation by targeting activin receptor IB.

Authors:  Guijun Yan; Lianxiao Zhang; Ting Fang; Qun Zhang; Shaogen Wu; Yue Jiang; Haixiang Sun; Yali Hu
Journal:  FEBS Lett       Date:  2012-07-13       Impact factor: 4.124

Review 4.  Circular RNAs are miRNA sponges and can be used as a new class of biomarker.

Authors:  Franceli Rodrigues Kulcheski; Ana Paula Christoff; Rogerio Margis
Journal:  J Biotechnol       Date:  2016-09-23       Impact factor: 3.307

5.  Using circular RNA as a novel type of biomarker in the screening of gastric cancer.

Authors:  Peifei Li; Shengcan Chen; Huilin Chen; Xiaoyan Mo; Tianwen Li; Yongfu Shao; Bingxiu Xiao; Junming Guo
Journal:  Clin Chim Acta       Date:  2015-02-14       Impact factor: 3.786

6.  Circular RNAs in the Mammalian Brain Are Highly Abundant, Conserved, and Dynamically Expressed.

Authors:  Agnieszka Rybak-Wolf; Christin Stottmeister; Petar Glažar; Marvin Jens; Natalia Pino; Sebastian Giusti; Mor Hanan; Mikaela Behm; Osnat Bartok; Reut Ashwal-Fluss; Margareta Herzog; Luisa Schreyer; Panagiotis Papavasileiou; Andranik Ivanov; Marie Öhman; Damian Refojo; Sebastian Kadener; Nikolaus Rajewsky
Journal:  Mol Cell       Date:  2015-04-23       Impact factor: 17.970

7.  High throughput circRNAs sequencing profile of follicle fluid exosomes of polycystic ovary syndrome patients.

Authors:  Li-Ping Wang; Xiao-Yu Peng; Xiao-Qin Lv; Lin Liu; Xue-Li Li; Xiao He; Fang Lv; Yu Pan; Li Wang; Kai-Feng Liu; Xiao-Mei Zhang
Journal:  J Cell Physiol       Date:  2019-02-18       Impact factor: 6.384

8.  CircInteractome: A web tool for exploring circular RNAs and their interacting proteins and microRNAs.

Authors:  Dawood B Dudekula; Amaresh C Panda; Ioannis Grammatikakis; Supriyo De; Kotb Abdelmohsen; Myriam Gorospe
Journal:  RNA Biol       Date:  2016       Impact factor: 4.652

9.  Integrated profiling of microRNAs and mRNAs: microRNAs located on Xq27.3 associate with clear cell renal cell carcinoma.

Authors:  Liang Zhou; Jiahao Chen; Zhizhong Li; Xianxin Li; Xueda Hu; Yi Huang; Xiaokun Zhao; Chaozhao Liang; Yong Wang; Liang Sun; Min Shi; Xiaohong Xu; Feng Shen; Maoshan Chen; Zujing Han; Zhiyu Peng; Qingna Zhai; Jing Chen; Zhongfu Zhang; Ruilin Yang; Jiongxian Ye; Zhichen Guan; Huanming Yang; Yaoting Gui; Jun Wang; Zhiming Cai; Xiuqing Zhang
Journal:  PLoS One       Date:  2010-12-30       Impact factor: 3.240

Review 10.  Biogenesis, identification, and function of exonic circular RNAs.

Authors:  Iju Chen; Chia-Ying Chen; Trees-Juen Chuang
Journal:  Wiley Interdiscip Rev RNA       Date:  2015-07-31       Impact factor: 9.957

View more
  2 in total

1.  CircRNAs in Xiang pig ovaries among diestrus and estrus stages.

Authors:  Xi Niu; Yali Huang; Huan Lu; Sheng Li; Shihui Huang; Xueqin Ran; Jiafu Wang
Journal:  Porcine Health Manag       Date:  2022-06-23

2.  Ovary-derived circular RNAs profile analysis during the onset of puberty in gilts.

Authors:  Xiangchun Pan; Wentao Gong; Yingting He; Nian Li; Hao Zhang; Zhe Zhang; Jiaqi Li; Xiaolong Yuan
Journal:  BMC Genomics       Date:  2021-06-15       Impact factor: 3.969

  2 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.