Literature DB >> 32529721

Identification of a nonsense mutation in TNNI3K associated with cardiac conduction disease.

Jiang Liu1, Da Liu1, Muzheng Li1, Keke Wu1, Na Liu1, Chenyu Zhao2, Xiaoliu Shi2,3, Qiming Liu1.   

Abstract

BACKGROUND: Cardiac conduction disease (CCD) is a common cardiovascular disease which can lead to life-threatening conditions. The importance of heredity in CCD has been realized in recent years. Several causal genes have been found to be implicated in CCD such as SCN5A, TRPM4, SCN1B, TNNI3K, LMNA, and NKX2.5. To date, only four genetic mutations in TNNI3K have been identified related to CCD.
METHODS: Whole-exome sequencing (WES) was carried out in order to identify the underlying disease-causing mutation in a Chinese family with CCD. The potential mutations were confirmed by Sanger sequencing. Real-time qPCR was used to detect the level of TNNI3K mRNA expression.
RESULTS: A nonsense mutation in TNNI3K (NM_015978.2: g.170891C > T, c.1441C > T) was identified in this family and validated by Sanger sequencing. Real-time qPCR confirmed that the level of TNNI3K mRNA expression was decreased compared with the controls.
CONCLUSIONS: This study found the first nonsense TNNI3K mutation associated with CCD in a Chinese family. TNNI3K harboring the mutation (c.1441C > T) implicated a loss-of-function pathogenic mechanism with an autosomal dominant inheritance pattern. This research enriches the phenotypic spectrum of TNNI3K mutations, casting a new light upon the genotype-phenotype correlations between TNNI3K mutations and CCD and indicating the importance of TNNI3K screening in CCD patients.
© 2020 The Authors. Journal of Clinical Laboratory Analysis Published by Wiley Periodicals LLC.

Entities:  

Keywords:  zzm321990TNNI3Kzzm321990; cardiac conduction disease; nonsense mutation; nonsense-mediated mRNA decay; whole-exome sequencing

Mesh:

Substances:

Year:  2020        PMID: 32529721      PMCID: PMC7521241          DOI: 10.1002/jcla.23418

Source DB:  PubMed          Journal:  J Clin Lab Anal        ISSN: 0887-8013            Impact factor:   2.352


INTRODUCTION

Cardiac conduction disease (CCD) refers to the impaired completeness of conduction system which can be serious and potentially life‐threatening. Based on part upon the site of conduction block, CCD is recognized, namely sick sinus syndrome, intra‐atrial block, atrioventricular block, and intraventricular conduction delay. More than 20 genes have been implicated in harboring rare variants that cause CCD, containing genes that encode ion channel, transcriptional factors, enzymes, and structural proteins such as SCN5A (OMIM#600163; 3p22.2), TRPM4 (OMIM#606936; 19q13.33), NKX2.5 (OMIM#600584; 5q35.1), TBX5 (OMIM#601620; 12q24.21), PRKAG2 (OMIM#602743; 7q36.1), and LMNA (OMIM#150330; 1q22). , CCD continues to be the major cause for pacemaker (PM) implantation irrespective of its diverse underlying pathophysiological mechanisms. , TNNI3K (OMIM #613932), located in chromosome 1 (1p31.1), encodes a dual‐function kinase (both tyrosine and serine/threonine kinase activity) with biased expression in heart. , It contains four domains as follows: an N‐terminal coiled‐coil domain, ankyrin (ANK) repeats, protein kinase domain, and a C‐terminal serine‐rich domain. Interaction partners of TNNI3K embody cardiac troponin I (cTnI), anti‐oxidant protein 1 (AOP‐1), and p38, which make TNNI3K an important factor in cardiovascular diseases. , TNNI3K was related to heart failure and hypertrophy, ischemia/reperfusion injury, cardiac conduction, and heart regeneration. , , , , , , Rare mutations related to cardiovascular diseases have been identified in more than 100 genes which encode proteins belonging to different cellular structures and pathways such as cytoskeleton, sarcomere, nuclear membrane, ion channel, mitochondria, sarcoplasmic reticulum, and desmosomes. To date, there are only four mutations in TNNI3K that have been found to be relevant with cardiovascular diseases, including three missense mutations and one splicing mutation. , , , Here, we found that a nonsense variant in TNNI3K (NM_015978.2:c.1441C > T), which was not seen in the human gene mutation database (HGMD), may be the cause of cardiac abnormalities.

MATERIALS AND METHODS

Patients enrollment and ethical approval of the study

A Chinese family with cardiovascular diseases was enrolled in our studies. Parents of the proband are not related biologically. The pedigree of the family is shown in Figure 1A. Written informed consent was obtained from each individual, and the investigation was approved by the Ethics Committee of The Second Xiangya Hospital of Central South University.
Figure 1

The clinical data and genetic analysis in our study. A, Pedigree. TNNI3K c.1441C > T variant was positive in individuals (II‐7, II‐9, and III‐10) and negative in individuals (III‐12 and IV‐1). B, Filter strategies in our research. C, The ECG record of the proband (III‐10) before PM implantation. D, The echocardiography of III‐10. E‐F, Sanger sequencing confirmation of III‐10 and III‐12.G, RNA expression of TNNI3K in affected individuals and controls. Mean expression (±SEM) of TNNI3K in affected individual and control measured by real‐time qPCR.**** represents P < .0001. H, Mapping of the domain with TNNI3K variants identified in previous studies (denoted by black arrows) and this study (denoted by red arrow). ANK, ankyrin; CVD, cardiovascular diseases; ECG, electrocardiogram; PM, pacemaker

The clinical data and genetic analysis in our study. A, Pedigree. TNNI3K c.1441C > T variant was positive in individuals (II‐7, II‐9, and III‐10) and negative in individuals (III‐12 and IV‐1). B, Filter strategies in our research. C, The ECG record of the proband (III‐10) before PM implantation. D, The echocardiography of III‐10. E‐F, Sanger sequencing confirmation of III‐10 and III‐12.G, RNA expression of TNNI3K in affected individuals and controls. Mean expression (±SEM) of TNNI3K in affected individual and control measured by real‐time qPCR.**** represents P < .0001. H, Mapping of the domain with TNNI3K variants identified in previous studies (denoted by black arrows) and this study (denoted by red arrow). ANK, ankyrin; CVD, cardiovascular diseases; ECG, electrocardiogram; PM, pacemaker

DNA extraction and whole‐exome sequencing

DNA was extracted from blood samples of the proband (III‐10) and family members (II‐7, II‐9, III‐12, and IV‐1). Other members' blood samples were not available. Whole‐exome sequencing (WES) was performed on the proband. WES and basic bioinformatics analyses were finished in the Novogene Bioinformatics Institute (Beijing, China). Platform for high‐throughput sequencing was Illumina novaSeq. The reads data were mapped to the human reference genome 19 (UCSC hg19) using BWA. Single‐nucleotide variants (SNVs) and insertion‐deletion variants (INDELs) were annotated by ANNOVAR. Low‐quality data (cover depth<20×) and high‐frequency mutation sites (minor allele frequency [MAF] >0.001 in ExAC, ESP6500,1000 Genome Project, and gnomAD) in general population were eliminated from raw data. SIFT, PolyPhen‐2, MutationTaster, and PROVEAN were used for predicting pathogenicity of mutations. Interpretation of mutations pathogenicity was guided by American College of Medical Genetics and Genomics guideline (ACMG). The filter strategies are shown in Figure 1B and Table 1. The validation of potential mutations in the proband and his family members was done by means of Sanger sequencing. Primer 3 was used to design the primer pairs (primers Tm and sequences that have been used in co‐segregation were showed in Table. S1). ABI 3730 sequencer (Applied Biosystems) was used for Sanger sequencing.
Table 1

The gene list of Sanger sequencing validation and co‐segregation analysis in this family

GeneOMIMCHRPOSRBABAAChangeSIFTPolyPhen‐2Mutationtaster
TNNI3K6139321p31.174834917CTNM_015978:exon15:c.C1441T——1.000, D
RYR21809021q43237947718TGNM_001035:exon90:c.T12706G0.5, T0.257, B1.000, D
TTN1888402q31.2179425543CTNM_001267550:exon326:c.G85316A0, D0.701, P1.000, D
CACNA1C11420512p13.332788847CTNM_000719:exon42:c.C5329T0.002, D0.999, D1.000, D
NUBPL61362114q1232319403ACNM_001201573:exon8:c.A605C0.23, T0.002, B0.764, N
MYOM160350818p11.313164344CANM_003803:exon10:c.G1433T0.31, T1.000, D0.764, N

Abbreviations: AB, alternative base identified; B, benign; CHR, chromosome; D, disease‐causing; N, neural; POS, position; RB, reference sequencing base; T, tolerated.

The gene list of Sanger sequencing validation and co‐segregation analysis in this family Abbreviations: AB, alternative base identified; B, benign; CHR, chromosome; D, disease‐causing; N, neural; POS, position; RB, reference sequencing base; T, tolerated.

Real‐time qPCR analysis

Total RNA was extracted by the PureLink® RNA Mini (Thermo Fisher Scientific; #12183025) from mononuclear cells in the affected patients and healthy controls. cDNA was synthesized from a total of 1 μg of RNA using the RevertAid First Strand cDNA Synthesis Kit (Thermo Fisher Scientific; #K1621) with oligo (dT) primers. Real‐time qPCRs were carried out in Fast 7500 Real‐Time PCR Systems (Applied Biosystems) using Maxima SYBR Green/ROX qPCR Master Mix (2×) (Thermo Fisher Scientific, #K0221). And 2 (−△△ t) was used to anal yze the comparative TNNI3K mRNA expression levels between mutation group and healthy group. Each assay was performed in five independent tests. The data were analyzed by unpaired two‐tailed tests using GraphPad Prism V.5 software (V.5.0). The primers used for cloning TNNI3K cDNA were as follows: forward 5′‐CTAGAGGCTGCTGATGTGCTGTTG‐3′; reverse 5′‐GGCGAGTTACCTGTTCATGTCCATAG‐3′.

RESULTS

Clinical data

The index case (III‐10) is a 56‐year‐old man from China with the clinical manifestation of chest tightness. The electrocardiogram (ECG) showed complete right bundle branch block (CRBBB)and third‐degree atrioventricular block (Figure 1C). The 24‐hour Holter indicated an average heartbeat of 46 bpm, maximum RR interval of 5.26 seconds, complete atrioventricular block, and CRBBB. His Echocardiography displayed enlargement of left atrial (LA = 40 mm), thickened left ventricular posterior wall (LVPW = 13 mm), and interventricular septum (IVS = 14 mm; Figure 1D). His father and uncles (II‐9, II‐5, II‐7, and II‐11) were also suffered from third‐degree atrioventricular block and were treated with PM therapy among their 50s. Results of echocardiography were all normal before their PM implantation. Cardiac enlargement of his uncles (II‐5 and II‐7) emerged after a period of PM implantation. The proband's aunt (II‐14) died of heart disease at her 30s recalled by him (no more details available). Owing to the implantation of PM, cardiac magnetic resonance is not performed in this family (Table 2 and Figure S1A‐D).
Table 2

Clinical characteristics and phenotype of family members

SubjectSexAge (y/old)Age of PM Implantation (y/old)UCGManifestation

III‐10

Proband

M5656LA = 40 mm, LV = 46 mm, RA = 35 mm, RV = 34 mm, IVS = 14 mm, LVPW = 13 mm, EF = 65%3rd‐degree AVB, RBBB, PVC

II‐5

Uncle

M9155LA = 38 mm, LV = 65 mm, RA = 37 mm, RV = 37 mm, EF = 55%3rd‐degree AVB, PVC, AT

II‐7

Uncle

M8954LA = 42 mm, LV = 62 mm, RA = 37 mm, RV = 39 mm, EF = 40%3rd‐degree AVB, PVC, RBBB

II‐9

Father

M8659LA = 38 mm, LV = 50 mm, RA = 34 mm, RV = 35 mm, EF = 54%3rd‐degree AVB, PVC

II‐11

Uncle

M8455LA = 33 mm, LV = 49 mm, RA = 30 mm, RV = 34 mm, EF = 60%3rd‐degree AVB, RBBB

III‐12

Sister

F52/LA = 29 mm, LV = 44 mm, RA = 28 mm, RV = 26 mm, EF = 66%/

IV‐1

Daughter

F26/LA = 27 mm, LV = 43 mm, RA = 27 mm, RV = 28 mm, EF = 66%/

Abbreviations: AT, atrial tachycardia; AVB, atrioventricular block; EF, ejection fraction; F, female; IVS, interventricular septum; LA, left atrial; LV, left ventricle; LVPW, left ventricular posterior wall; M, male; PM, pacemaker; PVC, premature ventricular contraction; RA, right atrial; RBBB, right bundle branch block; RV, right ventricle; UCG, ultrasonic cardiography.

Clinical characteristics and phenotype of family members III‐10 Proband II‐5 Uncle II‐7 Uncle II‐9 Father II‐11 Uncle III‐12 Sister IV‐1 Daughter Abbreviations: AT, atrial tachycardia; AVB, atrioventricular block; EF, ejection fraction; F, female; IVS, interventricular septum; LA, left atrial; LV, left ventricle; LVPW, left ventricular posterior wall; M, male; PM, pacemaker; PVC, premature ventricular contraction; RA, right atrial; RBBB, right bundle branch block; RV, right ventricle; UCG, ultrasonic cardiography.

Genetic testing

A nonsense mutation in TNNI3K (c.1441C > T, p.R481X) was found through WES and confirmed by Sanger sequencing (Figure 1E‐F and Figure S1E‐F). This variant produces a truncated protein with 480 amino acids which is significantly shorter than the wild‐type protein (835 amino acids). It is a rare mutation with MAF of 0.0017%(2/119514 alleles) in ExAC database. In addition, this mutation was not seen in our 200 local control cohorts. The c.1441C > T mutation in the TNNI3K gene co‐segregated with the clinical phenotype in this family. Thus, we believed that this mutation seems to be the causative mutation of cardiac abnormalities in this family. The nonsense mutation results in the early appearance of stop codon which is anticipated to activate a process called nonsense‐mediated mRNA decay (NMD). We isolated the mRNA from the mononuclear cells in the patients and healthy family members. Real‐time qPCR regarded the healthy control levels of mRNA in TNNI3K as “1.” The results revealed a decreased level of TNNI3K mRNA expression in patients compared with the controls (P < .0001; Figure 1G).

DISCUSSION

Herein, using WES we have identified a nonsense mutation of the TNNI3K gene associated with CCD. Cardiovascular disease caused by the TNNI3K mutation is an autosomal dominant disease, which means individuals will have the disease if only one chromosome carries the mutant allele. In our study, the nonsense mutation (c.1441C > T) is co‐segregated with the affected ones. The real‐time qPCR test revealed that the expression level of TNNI3K mRNA in affected members was decreased compared with healthy controls. Our study is consistent with previous studies which demonstrated that TNNI3K mutations were related to CCD with or without dilated cardiomyopathy. The gene TNNI3K holds a place in cardiac physiology. A preponderance of evidence suggested that TNNI3K is associated with a broad spectrum of cardiac phenotypes including CCD, dilated cardiomyopathy, and supraventricular tachycardia. Only four disease‐causing mutations in TNNI3K, namely three missense mutations and one splicing mutation, have been reported so far (Figure 1H). Our study reported the first nonsense mutation that was linked with cardiovascular diseases, located in kinase activity domain. This mutation results in the early appearance of stop codon which is anticipated to produce truncated protein lacking partial protein kinase domain along with the C‐terminus. For all we know, a premature termination codon (PTC) may result in loss of function (LOF) through NMD. , NMD refers to rapid degradation of mRNAs in transcripts harboring a PTC existing in all eukaryotic cells, which prevents the synthesis of truncated and potentially toxic proteins. Mutations that lead to NMD can cause a pathological state owing to marked reductions in specific gene expression, predispose patients to some disorders. In our research, the decreased expression of TNNI3K mRNA caused by the mutation may lead to CCD through haploinsufficiency. Nonsense mutation has larger effects in protein function in comparison with missense mutation. Thus, it is anticipated to have more serious phenotype than missense mutation correspondingly. The clinical presentation of cases with TNNI3K mutation has been summarized in Table 3. Conduction abnormalities of TNNI3K mutation carriers in our case seem to be more serious than previously reported cases based on the fact that all of them had PMs implanted. Cardiac structures were all normal in them except for II‐5 and II‐7 whose heart was enlarged in follow‐up period. Based on the fact that II‐5 and II‐7 are old highly pacing‐dependent male patients with over 30 years' history of PM implantation, we hold the opinion that cardiac enlargement in them was PM‐related and remotely connected with the mutation. Considering the oldest patient in this family is 93 and four of the five affected members are over 80 years old, it seems that mutation TNNI3K c.1441C > T has little effect on life expectancy with appropriate treatments. However, II‐14 died of heart disease at an early age and over half of previously reported families had a history of sudden cardiac death (SCD), which indicated that TNNI3K mutation may have connections with high risk of SCD. Further research needs to be done to assess risk of SCD in TNNI3K mutation carriers and draw clear genotype‐phenotype relationships of TNNI3K.
Table 3

Comparison of clinical presentation of cases with TNNI3K mutation

Family 1Family 2Family 3Family 4Family 5Family 6Our case
Mutationc.1577G > Ac.1615A > Gc.333 + 2T>Cc.2303G > Ac.2303G > Ac.2303G > Ac.1441C > T
First authorTheis, et al (2014) 16 Xi, et al (2015) 17 Fan, et al (2018) 18 Podliesna, et al (2019) 19 Podliesna, et al (2019) 19 Podliesna, et al (2019) 19 —
Affected individuals76615695
Conduction disordersLAFB, RBBB, AVBAVB, LAFB, RBBBSBProlonged HV intervalAVB, prolonged HV intervalAVBAVB, RBBB
RhythmSR, PAF, MAT, AFL, ATSR, JETSRSVT, AF, MATSVT, AT, MATSVT, AT, VTSR, AT
DCM3/43/11
SCD1112///
ICD/PM‐implanted1 a 1/3/35

Abbreviations: AT, atrial tachycardia; AVB, atrioventricular block; DCM, dilated cardiomyopathy; JET, junctional ectopic tachycardia; LAFB, left anterior fascicular block; MAT, multifocal atrial tachycardia; PAF, paroxysmal atrial fibrillation; PM, pacemaker; RBBB, right bundle branch block; SB, sinus bradycardia; SCD, sudden cardiac death; SR, sinus rhythm; SVT, supraventricular tachycardia; VT, ventricular tachycardia.

PM‐implanted because of atrioventricular node ablation.

Comparison of clinical presentation of cases with TNNI3K mutation Abbreviations: AT, atrial tachycardia; AVB, atrioventricular block; DCM, dilated cardiomyopathy; JET, junctional ectopic tachycardia; LAFB, left anterior fascicular block; MAT, multifocal atrial tachycardia; PAF, paroxysmal atrial fibrillation; PM, pacemaker; RBBB, right bundle branch block; SB, sinus bradycardia; SCD, sudden cardiac death; SR, sinus rhythm; SVT, supraventricular tachycardia; VT, ventricular tachycardia. PM‐implanted because of atrioventricular node ablation. However, there are several limitations in our research. This study lacks direct evidence in elucidating the underlying pathways between TNNI3K and CCD. An animal model harboring specific mutation will be needed to elucidate the underlying signaling pathways. In conclusion, our study successfully identified the first nonsense mutation in TNNI3K (c.1441C > T) that was associated with CCD, paying the way for genetic diagnosis for CCD. Considering the obscure pathophysiological mechanisms and complicated variant spectrum of CCD, we suggest that WES could be applied in potential inherited patients to identify novel mutations and improve our understanding of CCD etiology.

AUTHOR CONTRIBUTIONS

Q‐M L and JL conceived the design and performed the study. JL and DL analyzed the data. JL wrote the original manuscript. Q‐M L, DL, K‐K W, M‐Z L, NL, C‐Y Z, and X‐L S revised the article. All authors reviewed and approved the final manuscript. Figure S1 Click here for additional data file. Table S1 Click here for additional data file. Supplementary Material Click here for additional data file.
  26 in total

Review 1.  Nonsense-mediated mRNA decay: an intricate machinery that shapes transcriptomes.

Authors:  Søren Lykke-Andersen; Torben Heick Jensen
Journal:  Nat Rev Mol Cell Biol       Date:  2015-09-23       Impact factor: 94.444

2.  2013 ESC Guidelines on cardiac pacing and cardiac resynchronization therapy: the Task Force on cardiac pacing and resynchronization therapy of the European Society of Cardiology (ESC). Developed in collaboration with the European Heart Rhythm Association (EHRA).

Authors:  Michele Brignole; Angelo Auricchio; Gonzalo Baron-Esquivias; Pierre Bordachar; Giuseppe Boriani; Ole-A Breithardt; John Cleland; Jean-Claude Deharo; Victoria Delgado; Perry M Elliott; Bulent Gorenek; Carsten W Israel; Christophe Leclercq; Cecilia Linde; Lluís Mont; Luigi Padeletti; Richard Sutton; Panos E Vardas; Jose Luis Zamorano; Stephan Achenbach; Helmut Baumgartner; Jeroen J Bax; Héctor Bueno; Veronica Dean; Christi Deaton; Cetin Erol; Robert Fagard; Roberto Ferrari; David Hasdai; Arno W Hoes; Paulus Kirchhof; Juhani Knuuti; Philippe Kolh; Patrizio Lancellotti; Ales Linhart; Petros Nihoyannopoulos; Massimo F Piepoli; Piotr Ponikowski; Per Anton Sirnes; Juan Luis Tamargo; Michal Tendera; Adam Torbicki; William Wijns; Stephan Windecker; Paulus Kirchhof; Carina Blomstrom-Lundqvist; Luigi P Badano; Farid Aliyev; Dietmar Bänsch; Helmut Baumgartner; Walid Bsata; Peter Buser; Philippe Charron; Jean-Claude Daubert; Dan Dobreanu; Svein Faerestrand; David Hasdai; Arno W Hoes; Jean-Yves Le Heuzey; Hercules Mavrakis; Theresa McDonagh; Jose Luis Merino; Mostapha M Nawar; Jens Cosedis Nielsen; Burkert Pieske; Lidija Poposka; Frank Ruschitzka; Michal Tendera; Isabelle C Van Gelder; Carol M Wilson
Journal:  Eur Heart J       Date:  2013-06-24       Impact factor: 29.983

3.  TNNI3K mutation in familial syndrome of conduction system disease, atrial tachyarrhythmia and dilated cardiomyopathy.

Authors:  Jeanne L Theis; Michael T Zimmermann; Brandon T Larsen; Inna N Rybakova; Pamela A Long; Jared M Evans; Sumit Middha; Mariza de Andrade; Richard L Moss; Eric D Wieben; Virginia V Michels; Timothy M Olson
Journal:  Hum Mol Genet       Date:  2014-06-11       Impact factor: 6.150

Review 4.  Nonsense-mediated mRNA decay in humans at a glance.

Authors:  Tatsuaki Kurosaki; Lynne E Maquat
Journal:  J Cell Sci       Date:  2016-01-19       Impact factor: 5.285

5.  AOP-1 interacts with cardiac-specific protein kinase TNNI3K and down-regulates its kinase activity.

Authors:  Yan Feng; Dong-Qing Liu; Zhen Wang; Zhao Liu; Hui-Qing Cao; Lai-Yuan Wang; Na Shi; Xian-Min Meng
Journal:  Biochemistry (Mosc)       Date:  2007-11       Impact factor: 2.487

6.  Overexpression of TNNI3K, a cardiac-specific MAPKKK, promotes cardiac dysfunction.

Authors:  Hao Tang; Kunhong Xiao; Lan Mao; Howard A Rockman; Douglas A Marchuk
Journal:  J Mol Cell Cardiol       Date:  2012-10-16       Impact factor: 5.000

7.  Dissection of a quantitative trait locus for PR interval duration identifies Tnni3k as a novel modulator of cardiac conduction.

Authors:  Elisabeth M Lodder; Brendon P Scicluna; Annalisa Milano; Albert Y Sun; Hao Tang; Carol Ann Remme; Perry D Moerland; Michael W T Tanck; Geoffrey S Pitt; Douglas A Marchuk; Connie R Bezzina
Journal:  PLoS Genet       Date:  2012-12-06       Impact factor: 5.917

8.  Statistically based splicing detection reveals neural enrichment and tissue-specific induction of circular RNA during human fetal development.

Authors:  Linda Szabo; Robert Morey; Nathan J Palpant; Peter L Wang; Nastaran Afari; Chuan Jiang; Mana M Parast; Charles E Murry; Louise C Laurent; Julia Salzman
Journal:  Genome Biol       Date:  2015-06-16       Impact factor: 13.583

9.  Identification of a nonsense mutation in TNNI3K associated with cardiac conduction disease.

Authors:  Jiang Liu; Da Liu; Muzheng Li; Keke Wu; Na Liu; Chenyu Zhao; Xiaoliu Shi; Qiming Liu
Journal:  J Clin Lab Anal       Date:  2020-06-11       Impact factor: 2.352

10.  TNNI3K is a novel mediator of myofilament function and phosphorylates cardiac troponin I.

Authors:  Hui Wang; Lin Wang; Li Song; Yan-Wan Zhang; Jue Ye; Rui-Xia Xu; Na Shi; Xian-Min Meng
Journal:  Braz J Med Biol Res       Date:  2013-02-01       Impact factor: 2.590

View more
  8 in total

1.  Functional testing for variant prioritization in a family with long QT syndrome.

Authors:  Maliheh Najari Beidokhti; Alexander C Bertalovitz; Weizhen Ji; Jorge McCormack; Lauren Jeffries; Emily Sempou; Mustafa K Khokha; Thomas V McDonald; Saquib A Lakhani
Journal:  Mol Genet Genomics       Date:  2021-04-19       Impact factor: 3.291

2.  A Novel Missense Mutation in TNNI3K Causes Recessively Inherited Cardiac Conduction Disease in a Consanguineous Pakistani Family.

Authors:  Shafaq Ramzan; Stephanie Tennstedt; Muhammad Tariq; Sheraz Khan; Hafiza Noor Ul Ayan; Aamir Ali; Matthias Munz; Holger Thiele; Asad Aslam Korejo; Abdul Razzaq Mughal; Syed Zahid Jamal; Peter Nürnberg; Shahid Mahmood Baig; Jeanette Erdmann; Ilyas Ahmad
Journal:  Genes (Basel)       Date:  2021-08-21       Impact factor: 4.096

3.  The prevalent I686T human variant and loss-of-function mutations in the cardiomyocyte-specific kinase gene TNNI3K cause adverse contractility and concentric remodeling in mice.

Authors:  Peiheng Gan; Catalin Baicu; Hirofumi Watanabe; Kristy Wang; Ge Tao; Daniel P Judge; Michael R Zile; Takako Makita; Rupak Mukherjee; Henry M Sucov
Journal:  Hum Mol Genet       Date:  2021-01-06       Impact factor: 6.150

4.  Identification of a nonsense mutation in TNNI3K associated with cardiac conduction disease.

Authors:  Jiang Liu; Da Liu; Muzheng Li; Keke Wu; Na Liu; Chenyu Zhao; Xiaoliu Shi; Qiming Liu
Journal:  J Clin Lab Anal       Date:  2020-06-11       Impact factor: 2.352

5.  NONMMUT140591.1 may serve as a ceRNA to regulate Gata5 in UT-B knockout-induced cardiac conduction block.

Authors:  Xuejiao Lv; Yuxin Sun; Wenxi Tan; Yang Liu; Naiyan Wen; Shuang Fu; Lanying Yu; Tiantian Liu; Xiaocui Qi; Nanqi Shu; Yanwei Du; Wenfeng Zhang; Yan Meng
Journal:  Open Life Sci       Date:  2021-11-27       Impact factor: 0.938

Review 6.  The Diverse Roles of TNNI3K in Cardiac Disease and Potential for Treatment.

Authors:  Caroline Pham; Noelia Muñoz-Martín; Elisabeth M Lodder
Journal:  Int J Mol Sci       Date:  2021-06-15       Impact factor: 5.923

7.  Gene Amplification as a Mechanism of Yeast Adaptation to Nonsense Mutations in Release Factor Genes.

Authors:  Evgeniia M Maksiutenko; Yury A Barbitoff; Andrew G Matveenko; Svetlana E Moskalenko; Galina A Zhouravleva
Journal:  Genes (Basel)       Date:  2021-12-19       Impact factor: 4.096

8.  Whole-Exome Sequencing Identifies a Novel Variant (c.1538T > C) of TNNI3K in Arrhythmogenic Right Ventricular Cardiomyopathy.

Authors:  Ting Xie; Yifeng Yang; Ke Gong; Yong Luo; Hui Guo; Ruilin Liu; Lei Wang; Zhiping Tan; Jinwen Luo; Li Xie
Journal:  Front Cardiovasc Med       Date:  2022-02-22
  8 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.