Literature DB >> 32240179

Interleukin-10 contributes to PGE2 signalling through upregulation of EP4 via SHIP1 and STAT3.

Abrar Samiea1,2, Jeff S J Yoon1,2,3, Sylvia T Cheung1,2,3, Thomas C Chamberlain1,2,3, Alice L-F Mui1,2,3.   

Abstract

Macrophage cells form part of our first line defense against pathogens. Macrophages become activated by microbial products such as lipopolysaccharide (LPS) to produce inflammatory mediators, such as TNFα and other cytokines, which orchestrate the host defense against the pathogen. Once the pathogen has been eradicated, the activated macrophage must be appropriately deactivated or inflammatory diseases result. Interleukin-10 (IL10) is a key anti-inflammatory cytokine which deactivates the activated macrophage. The IL10 receptor (IL10R) signals through the Jak1/Tyk2 tyrosine kinases, STAT3 transcription factor and the SHIP1 inositol phosphatase. However, IL10 has also been described to induce the activation of the cyclic adenosine monophosphate (cAMP) regulated protein kinase A (PKA). We now report that IL10R signalling leads to STAT3/SHIP1 dependent expression of the EP4 receptor for prostaglandin E2 (PGE2). In macrophages, EP4 is a Gαs-protein coupled receptor that stimulates adenylate cyclase (AC) production of cAMP, leading to downstream activation of protein kinase A (PKA) and phosphorylation of the CREB transcription factor. IL10 induction of phospho-CREB and inhibition of LPS-induced phosphorylation of p85 PI3K and p70 S6 kinase required the presence of EP4. These data suggest that IL10R activation of STAT3/SHIP1 enhances EP4 expression, and that it is EP4 which activates cAMP-dependent signalling. The coordination between IL10R and EP4 signalling also provides an explanation for why cAMP elevating agents synergize with IL10 to elicit anti-inflammatory responses.

Entities:  

Mesh:

Substances:

Year:  2020        PMID: 32240179      PMCID: PMC7117666          DOI: 10.1371/journal.pone.0230427

Source DB:  PubMed          Journal:  PLoS One        ISSN: 1932-6203            Impact factor:   3.240


Introduction

Macrophages participate in host defense [1-4] by providing an immediate response to invading pathogens while also contributing to the activation of the adaptive immune system [5-7]. When lipopolysaccharide (LPS), a component of the outer membrane of gram negative bacteria, binds to the Toll-like receptor 4 (TLR4) on the macrophage, a cascade of signalling pathways is initiated leading to the production of pro-inflammatory cytokines and other inflammatory mediators [8]. However, this inflammatory response needs to be appropriately terminated or inflammatory disorders can develop [9]. The anti-inflammatory cytokine interleukin-10 (IL10) is a key suppressor of immune cell activation vital to maintaining immune homeostasis [9, 10]. Defects in IL10 signalling are associated with various autoimmune/inflammatory diseases [11-13]. IL10 knockout mice develop colitis, comparable to human inflammatory bowel disease [14, 15] and are hypersensitive to inflammatory stimuli [16]. Deficiencies or mutations in IL10 [17] or the IL10 receptor (IL10R) [12, 18] are found to cause early onset of inflammatory bowel disease (IBD) in humans. IL10 initiates signalling by binding to its receptor (IL10R), activating receptor associated Jak1 and Tyk2 tyrosine kinases [19, 20], and leading to activation of the STAT3 transcription factor [21-23]. We have shown that in addition to the STAT3 pathway, IL10R signalling also involves the SH2 domain containing inositol 5' phosphatase 1 (SHIP1) [24, 25]. SHIP1 is a cytoplasmic protein expressed predominantly in hematopoietic cells where one of its functions is to negatively regulate phosphoinositide 3-kinase (P13K) signalling by hydrolyzing the PI3K product phosphatidylinositol-3,4,5-trisphosphate (PIP3) into PI-3,4-bisphosphate (PI-3,4-P2) [26-28]. SHIP1 can also serve as an adaptor protein for assembly of protein complexes in signalling pathways [29]. We found that IL10 signalling requires SHIP1 to inhibit LPS-initiated translation of pre-existing TNFα mRNA [24] and the maturation of the microRNA, miR155 [25]. Recently, we showed that SHIP1 and STAT3 form complexes following IL10 stimulation to mediate IL10 responses and that small molecule allosteric activators of SHIP1 can mimic the anti-inflammatory actions of IL10 in vitro and in vivo (Chamberlain et al., submitted). In studies to further characterize the IL10-regulated gene products which participate in the anti-inflammatory response, we used DNA microarrays to screen for mRNAs whose regulation by IL10 involved SHIP1. We found the mRNA for ptger4 was upregulated by IL10 ~2.5 fold more in SHIP1 +/+ than -/- mouse peritoneal macrophages (perimacs). Ptger4 encodes the 513 amino acid, prostaglandin E2 (PGE2) receptor 4 (EP4), a G protein-coupled receptor, reported to have anti-inflammatory actions [30-32]. EP4 is one of four surface prostaglandin (PG) E2 receptors of the sub-group, E-type prostaglandin receptors (EP1-4) [33]. EP4, but not the other PGE2 receptors, is abundantly expressed in macrophages, suggesting a role in regulating immune responses [30, 34]. EP4 in macrophages is coupled to the Gαs trimeric G protein. Binding of PGE2 to EP4 results in activation of adenylate cyclase (AC), elevation of cAMP levels, activation of cAMP-dependent protein kinase A (PKA) and phosphorylation of the CREB transcription factor [33]. Studies of siRNA mediated EP4 knock-down cells [35] and EP4-/- mice [31, 36] suggest that EP4 is responsible for the anti-inflammatory activity of PGE2. EP4-/- mice are more susceptible to induced experimental colitis [31]. EP4 but not EP1-3 mRNA levels rise in colitic mice [31, 32] suggesting an important role for EP4 but not the other PGE2 receptors in colitis. In humans, genome-wide association studies (GWAS) have correlated EP4 polymorphisms with inflammatory diseases including Crohn’s disease [37-39] and allergic diseases [40]. EP4-specifc agonists inhibited colitis in wild type mice [31] and EP4 agonists have been developed for treating inflammatory disease in humans, with Rivenprost (ONO-4819CD, AE1-734) showing efficacy in phase II trials in ulcerative colitis [41]. These observations suggest a protective role of EP4 that is similar to IL10-mediated anti-inflammatory actions. We now present evidence IL10-induced upregulation of EP4, and subsequent EP4 signalling plays a role in the overall anti-inflammatory actions of IL10 in macrophages. IL10 utilizes both STAT3 and SHIP1 to upregulate EP4 protein and knock-down of EP4 is required for mediating some of the anti-inflammatory actions of IL10.

Materials and methods

Mouse colonies

BALB/c mice of SHIP1 wild type (+/+) or SHIP1 knockout (-/-) were kindly provided by Dr. Gerald Krystal (BC Cancer Research Centre, Vancouver, BC). C57BL/6 STAT3-/- mice were generated by crossing C57BL/6 STAT3flox/flox mice (Dr. Shizuo Akira, Hyogo College of Medicine, Nishinomiya, Japan) with C57BL/6 LysMCre mice (Jackson Laboratory). Offspring of these mice were heterozygous on both alleles, and were then crossed with homozygous STAT3flox/flox mice to generate mice with a genotype of STAT3flox/flox /LysMCre+/-. Then, STAT3flox/flox /LysMCre+/- mice were crossed with STAT3flox/flox mice to generate both STAT3flox/flox /LysMCre+/- mice (STAT3-/- mice) and STAT3flox/flox mice (STAT3+/+ mice) in the same litters. For mRNA analysis and immunoblotting studies, BALB/c mice +/+ or -/- for SHIP1 and C57BL/6 LysMCre mice +/+ or -/- for STAT3 were used. Both male and female were used, aged between 6–20 weeks old. All mice were housed and maintained in accordance with the ethic protocols approved by the University of British Columbia Animal Care Committee.

Cells

RAW264.7 cells were obtained from the American Type Culture Collection and maintained in Roswell Park Memorial Institute medium (RPMI-1640) (HyClone, Logan, Utah) supplemented with 9% fetal bovine serum (FBS) (HyClone, Logan, Utah). Primary peritoneal macrophages (perimacs) were isolated from mice by peritoneal lavage with 3 ml of sterile Phosphate Buffered Saline (PBS) (HyClone, Logan, Utah). Perimacs were collected and transferred to Iscove’s Modified Dulbecco’s Medium (IMDM) (HyClone, Logan, Utah) supplemented with 10% (v/v) FBS, 10 μM β-mercaptoethanol, 150 μM monothioglycolate and 1 mM L-glutamine (referred to here on as Mac media). Bone marrow-derived macrophages (BMDM) were generated by first collecting femurs and tibias from mice, and then flushing out the bone marrow through a 26-G needle. Extracted cells were plated, in Mac media supplemented with 5 ng/ml each of CSF-1 and GM-CSF (Stem Cell Technologies, Vancouver, BC), on a 10-cm tissue culture plate for 2 hours at 37°C. Non-adherent cells were collected and replated at 9×106 cells per 10-cm tissue culture plate. Cells were then cultured in the presence of CSF-1 and GM-CSF. Differentiated BMDMs were used after 7 to 8 days. All cells were maintained in a 37°C, 5% CO2, 95% humidity incubator.

Constructs

Lentiviral expression vectors for the doxycycline (Dox) inducible CRISPR/Cas9 and sgRNA were purchased from Addgene (Lenti-iCas9-neo #85400; pLX-sgRNA #50662 [42, 43]). Guide sequences used in the present study to target EP4 gene were designed via CRISPR Gold online tool [44]. Two guide RNA sequences were designed to target different positions of EP4 gene: EP4 KD1 sgRNA (GGCGGCGTAGGCCGTTACGT), EP4 KD2 sgRNA (CGACTTGCACAATACTACGA). Target sequences were cloned into the pLX-sgRNA vector using overlap-extension PCR to generate sgRNA-specific inserts. In brief, the first PCR amplicons were produced from F1/R1 and F2/R2 primers using Phusion polymerase (ThermoFisher Scientific, Nepean, ON). The first PCR products were then gel purified and extracted using phenol:chloroform:isoamyl (25:24:1) alcohol (ThermoFisher Scientific, Nepean, ON) to remove any template vectors and Phusion polymerases that can interfere with producing correct clones in proceeding steps. The first PCR products were then used as templates for another PCR reaction with the F1/R2 primer pair and the same gel purification and phenol-chloroform extraction was performed. The product of second PCR reaction was digested using NheI and XhoI restriction enzymes, ligated into the empty pLX-sgRNA vector and transformed into chemically competent Stbl3 bacteria. Ampicillin resistant colonies were selected and the sequences confirmed by sequencing. The virus containing Lenti-iCas9 neo plasmid was prepared by mixing the packaging plasmid R8.9 and VSVG with Lenti-iCas9 neo plasmid and transfecting into HEK293T cells to produce virus [25]. The lentivirus in the media was collected and concentrated to use to infect RAW264.7 cells in the presence of 8 μg/ml protamine sulfate. The Lenti-iCas9 neo transduced RAW264.7 cells were selected by sorting for GFP fluorescence using FACS. After sorting, cultures were maintained in 2 mg/ml neomycin. Then, pLX-sgRNA vectors with EP4 target sequences were infected into the RAW264.7 cells containing Lenti-iCas9 neo plasmids using the same procedure. The RAW264.7 cells with pLX-sgRNA vector were selected using 5 μg/ml blasticidin. To induce the expression of Cas9, 2 μg/ml doxycycline (Dox) was added to the culture media for 48 hours. All cell lines were maintained at 37°C, 5% CO2 and 95% humidity.

Reagents

Antibodies used include SHIP1 (P1C1) mouse antibody (Santa Cruz Biotechnology, Santa Barbara, CA), pSTAT3 Y705 (3E2) mouse antibody (Cell Signaling, Danvers, MA), STAT3 (79D7) rabbit antibody (Cell Signaling, Danvers, MA), EP4 (Santa Cruz Biotechnology, Santa Barbara, CA), p-p85 PI3 Kinase (Tyr458) rabbit antibody (Cell Signaling, Danvers, MA), p85 PI3 Kinase rabbit antibody (Cell Signaling, Danvers, MA), p-p70 S6 Kinase (Thr389) rabbit antibody (Cell Signaling, Danvers, MA), p70 S6 Kinase rabbit antibody (Cell Signaling, Danvers, MA), pCREB (Ser133) rabbit antibody (Cell Signaling, Danvers, MA), CREB (48H2) rabbit antibody (Cell Signaling, Danvers, MA), and GAPDH rabbit antibody (Sigma, Oakville, ON)..

Cell stimulations for immunoblot analysis

RAW264.7 cells and BMDMs were seeded at 3.0 x 105 cells per well on 24-well tissue culture plates 1 day prior to stimulation, followed by replacement with fresh medium for 1 hour prior to stimulation with 10 ng/ml LPS (Escherichia coli serotype 0111:B4; Sigma) with and without the indicated concentrations of IL10 for the required time points. Perimacs were seeded at 1.0 x 106 cells per well in 24-well tissue culture plate and let to adhere for 3 hours before washing with PBS to remove non-adherent cells followed by stimulation with 10 ng/ml LPS +/- 10 ng/ml IL10 in Mac media for 1 hour. The EP4 Plx-sgRNA transduced cell lines were left untreated or treated with 2 μg/ml Dox for 24 hours prior to cell seeding (a total of 48 hours treatment before LPS/IL10 stimulations) to induce knockdown of EP4.

Treatment with EP4 antagonist

Cells were seeded at 2.0 x 104 cells per well in a 96-well tissue culture plate and allowed to adhere overnight. Media was changed the next day 1 hour prior to stimulation. For cells that need pre-treatment, DMSO (final concentration of 0.05%) or 100 nM ONO-AE3-208 (14522, Cayman Chemical Company, Ann Arbor, MI) prepared in RPMI-9% FBS media was used to pre-treat the cells for 1 hour prior to stimulations. Cells were then stimulated with 1 ng/ml LPS +/- IL10 (0.01–30 ng/ml) for 1 hour. Triplicates wells were used for each stimulation condition. Supernatant was collected and secreted TNFα protein levels were measured by ELISA as described below.

Real-time quantitative PCR

Perimacs were seeded at 3.0 x 106 cells/well in 6-well tissue culture plates and allowed to adhere for 3 hours before washing with PBS to remove non-adherent cells followed by stimulation with 1 ng/ml LPS +/- 10 ng/ml IL10 in Mac media for 1 hour. BMDM and RAW264.7 cells were seeded at 2 x 106 cells/well and 1.5 x 106 cells/well respectively. Total RNA was extracted using Trizol reagent (ThermoFisher, Nepean, ON) according to manufacturer’s instructions. 3 μg of RNA were treated with DNAse I (Roche Diagnostics, Laval, QC) according to the product manual. For mRNA expression analysis, 120 ng of RNA were used in the Transcriptor First Strand cDNA synthesis kit (Roche Diagnostics, Laval, QC), and 0.1 μl to 0.2 μl of cDNA generated were analyzed by SYBR Green-based real time PCR (real time-PCR) (Roche Diagnostics, Laval, QC) using 300 nM of gene-specific primers—EP4 Forward (ACCATTCCTAGATCGAACCGT), EP4 Reverse (CACCACCCCGAAGATGAACAT), GAPDH Forward (AATGTGTCCGTCGTGGATCT), GAPDH Reverse (GCTTCACCACCTTCTTGATGT). Expression levels of mRNA were measured with the StepOne Plus RT-PCR system (Applied Biosystems, Burlington, ON), and the comparative Ct method was used to quantify mRNA levels using GAPDH as the normalization control.

Immunoblot analysis

Cells were rinsed with cold PBS and lysed with hot 2 x Laemmli sample buffer. Proteins were separated by 12.5% SDS-PAGE, followed by electroblotting onto polyvinylidene fluoride (PVDF) membrane (Millipore, Etobicoke, ON). Membranes were blocked with 3% BSA/TrisHCl buffer saline (TBS)/pH 7.5 (blocking buffer), rinsed with 0.05% Tween 20/TBS (wash buffer) and probed primary antibodies/3% blocking buffer at room temperature overnight. The following day, membranes were washed 3 X 10 min, incubated 1 hour at room temperature with Alexa Fluor® 660 anti-mouse IgG or Alexa Fluor® 680 anti-rabbit IgG antibodies in wash buffer (ThermoFisher, Nepean, ON), washed and imaged using a LI-COR Odyssey Imager.

Measurement of TNFα production and IL10 IC50 calculations

Cells were seeded at 2.0 x 104 cells per well in a 96-well tissue culture plate and allowed to adhere overnight. Media was changed the next day 1 hour prior to stimulation. Cells were stimulated with 1 ng/ml LPS +/- IL10 (0.01–30 ng/ml) for 1 hour. Triplicates wells were used for each stimulation condition. Supernatant was collected and secreted TNFα protein levels were measured using a BD OptEIA Mouse TNFα Enzyme-Linked Immunosorbent Assay (ELISA) kit (BD Biosciences, Mississauga, ON). The inhibitory concentration (IC50) of IL10 needed to inhibit LPS-stimulated TNFα production was calculated using GraphPad (non-linear regression curve fit). The mean IC50 was determined from three independent IC50 determination experiments.

Statistical analysis

Quantification of band intensities in immunoblots was performed using LI-COR Odyssey imaging system and Image Studio™ Lite software (LI-COR Biosciences, Lincoln, NE). GraphPad Prism 6 (GraphPad Software Inc., La Jolla, CA) was used to perform all statistical analyses. Statistical details can be found in figure legends. Values are presented as means ± standard deviations. Unpaired t tests were used where appropriate to generate two-tailed P values. Two-way ANOVA were performed where required with appropriate multiple comparisons tests. Differences were considered significant when p≤0.05.

Ethics statement

Some of the studies required cells harvested from mice. The mice were kept, and cells were harvested in compliance with the Canadian Animal Care Committee guidelines.

Results

EP4 mRNA is upregulated by IL10 in a SHIP1 and STAT3 dependent manner

In studies to further characterize the IL10-regulated gene products which participate in the anti-inflammatory response, we looked at mRNA expression induced by IL10 in SHIP1+/+ vs SHIP1-/- peritoneal macrophages (perimacs). We found that 341 genes were upregulated by IL10 by at least two-fold in SHIP1+/+ macrophages. Of these, 124 were differentially regulated in SHIP1-/- cells by at least a two-fold difference. One IL10-regulated gene is the EP4 mRNA (encoded by the ptger4 gene) whose expression was upregulated by IL10 ~2.5 fold more in SHIP1+/+ than SHIP1-/-. To confirm our microarray finding that IL10 upregulates expression of EP4 mRNA, we performed qPCR analysis on RNA isolated from LPS +/- IL10 stimulated SHIP1 and STAT3 wild-type and knock-out perimacs. As shown in Fig 1A, at 1 hour LPS + IL10 upregulates EP4 gene expression in SHIP1+/+ and STAT3+/+ cells by 2.6 and 2.9 fold, respectively, compared to LPS alone. In contrast, IL10-induction of EP4 was impaired in both SHIP1-/- and STAT3-/- cells, by approximately 45% in SHIP1-/- cells (Fig 1A, left) and 30% in STAT3-/- cells (Fig 1A, right). This suggests that IL10-mediated expression of EP4 mRNA requires both SHIP1 and STAT3 for maximal induction. LPS by itself stimulated a slight increase (~ 0.5 fold more than the unstimulated condition) in EP4 mRNA.
Fig 1

SHIP1 and STAT3 dependence of IL10 induced expression of EP4 mRNA.

Perimacs extracted (A) or BMDM (B, C) derived from SHIP1+/+ or -/- mice and STAT3+/+ or -/- mice were stimulated with LPS +/- IL10 for 1 hour prior to total RNA extraction. Expression level of EP4 (A, B) or TNFα (C) mRNA was determined by real-time PCR and normalized to GAPDH mRNA levels. (Two-Way ANOVA with Tukey’s correction, **** p<0.0001, *** p<0.001, ** p<0.01, * p<0.05, ns = not significant). RAW264.7 cells (D) were stimulated and subjected to the same mRNA expression analyses. (One-Way ANOVA with Tukey’s correction, **** p<0.0001, *** p<0.001, ** p<0.01, * p<0.05, ns = not significant). Data represents expression levels relative to LPS stimulated cells from three independent experiments in each cell type.

SHIP1 and STAT3 dependence of IL10 induced expression of EP4 mRNA.

Perimacs extracted (A) or BMDM (B, C) derived from SHIP1+/+ or -/- mice and STAT3+/+ or -/- mice were stimulated with LPS +/- IL10 for 1 hour prior to total RNA extraction. Expression level of EP4 (A, B) or TNFα (C) mRNA was determined by real-time PCR and normalized to GAPDH mRNA levels. (Two-Way ANOVA with Tukey’s correction, **** p<0.0001, *** p<0.001, ** p<0.01, * p<0.05, ns = not significant). RAW264.7 cells (D) were stimulated and subjected to the same mRNA expression analyses. (One-Way ANOVA with Tukey’s correction, **** p<0.0001, *** p<0.001, ** p<0.01, * p<0.05, ns = not significant). Data represents expression levels relative to LPS stimulated cells from three independent experiments in each cell type. Our biochemical studies will make use of the RAW264.7 cell line and bone marrow derived macrophages (BMDM) from SHIP1+/+ or -/- and STAT3+/+ or -/- mice, so we also examined EP4 mRNA levels in those cells. Similar to that observed in perimacs, IL10 +/- LPS (but not LPS alone) induction of EP4 mRNA is impaired in SHIP1-/- BMDM (Fig 1B, left). However, unlike that observed in SHIP1-/- perimacs, STAT3 deficiency in BMDM did not affect IL10’s ability to elevate EP4 mRNA (Fig 1B, right). We confirmed that these STAT3-/- are indeed impaired in IL10 inhibition of TNFα mRNA (Fig 1C) as we and others have previously described ([25, 45]. Finally, we examined the responses in the RAW264.7 cell line. As seen in Fig 1D, the pattern of EP4 mRNA expression patterns similar to SHIP1+/+ and STAT+/+ perimacs and BMDM.

IL10 dose-dependent upregulation of EP4 protein

Next, we examined whether IL10 upregulation of EP4 mRNA reflected changes in EP4 protein levels in the RAW264.7 macrophage cell line (Fig 2) Cells were treated with the indicated concentrations of IL10 for 1 hour in the presence of 10 ng/ml LPS. IL10 induced EP4 protein in a dose-dependent manner (Fig 2). The lowest concentration of IL10 tested (10 ng/ml) was found to produce significant upregulation of EP4, compared to cells with no IL10 with no further increases with higher IL10 concentrations. Therefore, this concentration was chosen for use in further experiments. The IL10 concentration dependence of EP4 induction paralleled the phosphorylation of STAT3 tyrosine 705 (pSTAT3-Y705). No EP4 protein was observed with LPS stimulation alone.
Fig 2

IL10 dose-dependent upregulation of EP4 protein.

RAW264.7 cells were stimulated with 10 ng/ml LPS with the indicated concentrations of IL10 for 1 hour prior to protein lysate collection. Expression levels of EP4 and pSTAT3 proteins were determined by immunoblotting. Data plotted represents EP4 and pSTAT3 band intensities normalized to SHIP1 protein levels. The significance of the comparison between LPS and LPS + IL10 treatments was calculated by Two-Way ANOVA with Tukey’s correction, **** p<0.0001, *** p<0.001, ** p<0.01, * p<0.05, ns = not significant. Data are representative of three independent experiments.

IL10 dose-dependent upregulation of EP4 protein.

RAW264.7 cells were stimulated with 10 ng/ml LPS with the indicated concentrations of IL10 for 1 hour prior to protein lysate collection. Expression levels of EP4 and pSTAT3 proteins were determined by immunoblotting. Data plotted represents EP4 and pSTAT3 band intensities normalized to SHIP1 protein levels. The significance of the comparison between LPS and LPS + IL10 treatments was calculated by Two-Way ANOVA with Tukey’s correction, **** p<0.0001, *** p<0.001, ** p<0.01, * p<0.05, ns = not significant. Data are representative of three independent experiments.

Kinetics of EP4 upregulation

After determining a suitable concentration of IL10 to use to observe upregulation of EP4 protein levels, we tested different time points (from 0.5 to 2 hours) to understand the kinetics of IL10 induction of EP4. IL10-induced expression of EP4 was detected as early as 0.5 hour in RAW264.7 (Fig 3). EP4 induction peaked at 1 hour and started to decline afterwards (Fig 3). The kinetics of EP4 appearance mirrored the kinetics of pSTAT3-Y705 levels. Notably although we observed a low level of EP4 RNA upregulation in LPS treated SHIP1+/+ and STAT3+/+ cells (Fig 1), EP4 protein is detected only in the LPS + IL10 samples suggesting that IL10 is required for stable expression of EP4 protein.
Fig 3

Kinetics of EP4 upregulation.

RAW264.7 cells were stimulated with 10 ng/ml LPS ± 10 ng/ml IL10, at the indicated time points, prior to protein lysate collection. Expression levels of EP4 and pSTAT3 proteins were determined by immunoblotting. Data plotted represents EP4 and pSTAT3 band intensities normalized to SHIP1 protein levels. The significance of the comparison between LPS and LPS + IL10 treatments was calculated by Two-Way ANOVA with Tukey’s correction, **** p<0.0001, *** p<0.001, ** p<0.01, * p<0.05. Data are representative of three independent experiments.

Kinetics of EP4 upregulation.

RAW264.7 cells were stimulated with 10 ng/ml LPS ± 10 ng/ml IL10, at the indicated time points, prior to protein lysate collection. Expression levels of EP4 and pSTAT3 proteins were determined by immunoblotting. Data plotted represents EP4 and pSTAT3 band intensities normalized to SHIP1 protein levels. The significance of the comparison between LPS and LPS + IL10 treatments was calculated by Two-Way ANOVA with Tukey’s correction, **** p<0.0001, *** p<0.001, ** p<0.01, * p<0.05. Data are representative of three independent experiments.

IL10 upregulation of EP4 protein requires SHIP1 and STAT3

We found that EP4 mRNA was modestly induced by LPS and strongly upregulated by IL10 in SHIP1+/+ and STAT3+/+ perimacs but less so in cells deficient of either SHIP1 or STAT3 (Fig 1). We next examined whether IL10-mediated upregulation of EP4 protein was also impaired in SHIP1-/- or STAT3-/- cells. IL10 increased EP4 levels in both SHIP1+/+ perimacs (Fig 4A) and BMDM (Fig 4B) after 1 hour treatment; SHIP1 deficiency impaired induction in both cell types. No EP4 protein was induced by LPS alone in perimacs (Fig 4A). In BMDM we saw a basal expression of EP4 protein. This might be due to low level constitutive IL10 production in BMDM which prompt some investigators to use IL10-/- cells in their studies [23, 46], but other factors may also be involved. Regardless, the addition of IL10 increased the amount of EP4 protein in both SHIP1+/+ and STAT3+/+ cells. IL10-mediated EP4 induction is impaired in both SHIP1-/- and STAT3-/- BMDMs (Fig 4C). The impaired IL10 induction of EP4 protein in STAT3-/- BMDMs contrasts with the lack of effect of STAT3 deficiency on IL10 induction of EP4 mRNA in STAT3-/- perimacs. We also found that the level of STAT3 phosphorylation was significantly lower in perimac and BMDM cells deficient in SHIP1, suggesting a role for SHIP1 in the phosphorylation of STAT3 in response to IL10.
Fig 4

IL10 upregulation of EP4 protein requires SHIP1 and STAT3.

(A) SHIP1+/+ and -/- perimacs, (B) SHIP1+/+ and -/- BMDM and (C) STAT3+/+ and -/- BMDM were stimulated with 10 ng/ml LPS ± 10 ng/ml IL10 for 1 hour prior to protein lysate collection. Expression levels of EP4 and pSTAT3 proteins were determined by immunoblotting. Data plotted represents EP4 and pSTAT3 band intensities normalized to either STAT3 protein levels for (A) SHIP1+/+ and -/- perimacs and (B) SHIP1+/+ and -/- BMDM, or SHIP1 protein levels for (C) STAT3+/+ and -/- BMDM. (Two-Way ANOVA with Tukey’s correction, **** p<0.0001, *** p<0.001, ** p<0.01, * p<0.05). Data are representative of three independent experiments.

IL10 upregulation of EP4 protein requires SHIP1 and STAT3.

(A) SHIP1+/+ and -/- perimacs, (B) SHIP1+/+ and -/- BMDM and (C) STAT3+/+ and -/- BMDM were stimulated with 10 ng/ml LPS ± 10 ng/ml IL10 for 1 hour prior to protein lysate collection. Expression levels of EP4 and pSTAT3 proteins were determined by immunoblotting. Data plotted represents EP4 and pSTAT3 band intensities normalized to either STAT3 protein levels for (A) SHIP1+/+ and -/- perimacs and (B) SHIP1+/+ and -/- BMDM, or SHIP1 protein levels for (C) STAT3+/+ and -/- BMDM. (Two-Way ANOVA with Tukey’s correction, **** p<0.0001, *** p<0.001, ** p<0.01, * p<0.05). Data are representative of three independent experiments.

EP4 is required to mediate IL10 action in LPS-activated macrophages

To investigate whether EP4 contributes to IL10’s anti-inflammatory action, we first made use of the EP4 antagonist ONO-AE3-208 [47]. RAW264.7 cells were treated with 100 nM ONO-AE3-208 or with DMSO for 1 hour prior to stimulation with 1 ng/ml LPS with 0–30 ng/ml IL10 for 1 hour. Culture supernatants were collected and the TNFα levels in them determined by ELISA. As shown in Fig 5, the IL10 inhibited LPS-stimulated TNFα expression in the control and DMSO treated cells. The ability of IL10 to inhibit TNFα expression was significantly impaired at 0.1 and 1 ng/ml of IL10 (Fig 5). Of note, ONO-AE3-208 had no effect at 30 ng/ml of IL10. 30 ng/ml is the concentration at which maximal EP4 protein levels is induced by IL10 (Fig 2).
Fig 5

EP4 antagonist ONO-AE3-208 prevents IL10 inhibition of TNFα.

RAW264.7 cells were pre-treated with 0.05% DMSO or with 100 nM ONO-AE3-208 for 1 hour prior to stimulation. RAW264.7 cells were stimulated with 1 ng/ml LPS +/- 0.1, 1.0, 30 ng/ml IL10 for 1 hour. Supernatants were collected to measure the level of secreted TNFα. The significance of the comparison between DMSO treatment and ONO-AE3-208 treatment was calculated by Two-Way ANOVA with Tukey’s correction, **** p<0.0001, *** p<0.001, ** p<0.01 * p<0.05. The significance of the comparison between LPS and LPS + IL10 treatments was calculated by Two-Way ANOVA with Tukey’s correction, †††† p<0.0001, ††† p<0.001, †† p<0.01, † p<0.05. Data are representative of three independent experiments.

EP4 antagonist ONO-AE3-208 prevents IL10 inhibition of TNFα.

RAW264.7 cells were pre-treated with 0.05% DMSO or with 100 nM ONO-AE3-208 for 1 hour prior to stimulation. RAW264.7 cells were stimulated with 1 ng/ml LPS +/- 0.1, 1.0, 30 ng/ml IL10 for 1 hour. Supernatants were collected to measure the level of secreted TNFα. The significance of the comparison between DMSO treatment and ONO-AE3-208 treatment was calculated by Two-Way ANOVA with Tukey’s correction, **** p<0.0001, *** p<0.001, ** p<0.01 * p<0.05. The significance of the comparison between LPS and LPS + IL10 treatments was calculated by Two-Way ANOVA with Tukey’s correction, †††† p<0.0001, ††† p<0.001, †† p<0.01, † p<0.05. Data are representative of three independent experiments. To complement the chemical inhibitor studies, we also used CRISPR-Cas9 to knockdown EP4 in RAW264.7 cells. We generated RAW264.7 cells expressing a doxycycline inducible Cas9 protein (RAW264.7-Cas9) into which we introduced gRNAs KD1 and KD2 targeting two different exons of EP4 to generate the EP4-KD1 and EP4-KD2 cell lines. EP4 protein expression was knocked down by induction of Cas9 protein with doxycycline (+ Dox) for 48 hours (Fig 6A and 6B). We found that knocking down EP4 had little impact on IL10 phosphorylation of STAT3.
Fig 6

EP4 is required for IL10 induction of phospho-CREB and inhibition of LPS-stimulation of phospho-p85 and phospho-p70 S6 kinase.

RAW264.7/Cas9 cells transduced with EP4 sgRNA KD1 or KD2 gRNA were treated ± 2 μg/ml doxycycline for 48 hours to induce EP4 knockdown followed by stimulation with 10 ng/ml LPS ± 10 ng/ml IL10 for 1 hour and collection of protein lysates. Expression levels of EP4 and the indicated proteins and phospho-proteins were determined by immunoblotting (A), and quantifications shown in (B). (Two-Way ANOVA with Tukey’s correction, **** p<0.0001, *** p<0.001, ** p<0.01, * p<0.05). Data are representative of three independent experiments. (C) The mean IC50 for IL10 inhibition of LPS-stimulated TNFα production. The significance of the comparison between no Dox and Dox treated EP4 KD cells was calculated by unpaired student’s t-test, ** p<0.01.

EP4 is required for IL10 induction of phospho-CREB and inhibition of LPS-stimulation of phospho-p85 and phospho-p70 S6 kinase.

RAW264.7/Cas9 cells transduced with EP4 sgRNA KD1 or KD2 gRNA were treated ± 2 μg/ml doxycycline for 48 hours to induce EP4 knockdown followed by stimulation with 10 ng/ml LPS ± 10 ng/ml IL10 for 1 hour and collection of protein lysates. Expression levels of EP4 and the indicated proteins and phospho-proteins were determined by immunoblotting (A), and quantifications shown in (B). (Two-Way ANOVA with Tukey’s correction, **** p<0.0001, *** p<0.001, ** p<0.01, * p<0.05). Data are representative of three independent experiments. (C) The mean IC50 for IL10 inhibition of LPS-stimulated TNFα production. The significance of the comparison between no Dox and Dox treated EP4 KD cells was calculated by unpaired student’s t-test, ** p<0.01. Next we investigated the effect of EP4 knockdown on the phosphorylation of CREB which is a transcription factor downstream of PGE2 stimulation of EP4-dependent elevation of cAMP levels in cells [33] and also implicated in IL10R signaling [48]. We found that LPS slightly, but LPS + IL10 strongly induced phosphorylation of CREB in no Dox cells (Fig 6A and 6B). The IL10-dependent induction of CREB was abolished when EP4 protein is knocked down suggesting EP4 is required for IL10 induced phosphorylation of CREB (Fig 6A and 6B). Since elevation of cAMP levels has been shown to inhibit the activity of LPS-induced, PI3K-dependent signalling [49], we also examined whether IL10 inhibition of PI3K/Akt/mTOR pathway [46] required EP4 (Fig 6A and 6B). We found that IL10 inhibited LPS-activation of p85 subunit of PI3K but this inhibition was abolished when EP4 was knocked down (Fig 6A and 6B). Similarly, IL10 inhibition of the phosphorylation of Akt/mTOR target p70 S6K disrupted with the knock-down of EP4 suggesting that EP4 contributes to IL10 inhibition of PI3K/Akt/mTOR signalling and downstream processes. Finally, we tested whether the knockdown of EP4 impacted IL10’s ability to inhibit production of TNFα following LPS stimulation. We stimulated EP4 expressing (no Dox) or not-expressing (with Dox) RAW264.7 KD1/KD2 cells with LPS and various concentrations of IL10 to determine IC50 value for IL10 inhibition of TNFα production. We found for both EP4 KD1 and KD2 cells that knockdown of EP4 impaired IL10 inhibition of TNFα production as shown by IC50 values of 1.09 ± 0.2 ng/ml IL10 and 1.56 ± 0.62 ng/ml IL10 for Dox induced EP4 KD1 and KD2 versus 0.24 ± 0.01 ng/ml IL10 and 0.21 ± 0.03 ng/ml IL10 for the respective no Dox, EP4 expressing cells (Fig 6C).

Discussion

EP4 levels have been reported to be upregulated in LPS activated macrophages [30]. We now show that elevation of EP4 protein (Figs 2–4) requires the presence of IL10, since LPS stimulation of macrophages for sufficient length of time results in production of IL10 [50, 51], but previous studies were not designed to separate the direct effects of LPS signaling through the TLR4 receptor from the subsequent actions of LPS-induced autocrine cytokines such as IL10 [52]. With respect to EP4 mRNA (Fig 1) we found LPS alone could increase levels in a SHIP1 and STAT3 independent manner in both perimacs and BMDM. The addition of IL10 + LPS increased EP4 mRNA levels much more than LPS alone, and appears to be SHIP1 dependent in both perimacs and BMDM. However, while IL10 induction of EP4 mRNA in perimacs is STAT3 dependent, in BMDM the induction is STAT3 independent. Future studies will examine whether IL10 dependent control of EP4 mRNA occurs transcriptionally or post-transcriptionally, as well as why EP4 mRNA responses with respect to STAT3 are different in BMDM compared to perimacs. IL10R signaling involves both SHIP1 and STAT3, and we found that IL10 upregulation of EP4 protein required both. EP4 has been reported to mediate PGE2’s inhibition of inflammatory mediators [31, 34]. Since LPS treatment of macrophages results in COX-2-dependent production of PGE2 [53, 54], autocrine PGE2 along with IL10-induction of EP4 protein may be a mechanism to self-limit the inflammatory response. Fig 7 shows our proposed model for the coordination and interplay between IL10 and PGE2 signalling in controlling macrophage inflammation. LPS signalling (blue) leads to production of inflammatory mediators such as TNFα [8], but also of PGE2 [53, 54] which binds to EP4 to inhibit inflammation [31, 36]. IL10 signalling (black) leads to inhibition of LPS-induced inflammatory events partly through expression of genes which include EP4. EP4 signalling (red) involves Gαs activation of AC, elevation of cAMP levels and subsequent activation and phosphorylation of the CREB transcription factor [33]. pCREB interferes with LPS-induced NFκB transcription, as well as supports transcription of more IL10 [55]. Evidence for this model is discussed below.
Fig 7

IL10 and PGE2 signaling coordinate to inhibit macrophage inflammatory responses.

LPS signaling (blue) leads to production of inflammatory mediators such as TNFα, but also of PGE2 which will have a net anti-inflammatory effect. IL10 signaling (black) leads to inhibition of LPS-induced inflammatory events partly through expression of genes which include EP4. EP4 signaling (red) involves the Gαs-dependent elevation of cAMP levels and subsequent activation and phosphorylation of the CREB transcription factor. pCREB interferes with LPS-induced NFκB transcription, and supports transcription of more IL10. Solid lines indicate protein-protein interactions; dashed lines indicate the production or action of ligands/proteins/second messengers. Abbreviations defined in the text.

IL10 and PGE2 signaling coordinate to inhibit macrophage inflammatory responses.

LPS signaling (blue) leads to production of inflammatory mediators such as TNFα, but also of PGE2 which will have a net anti-inflammatory effect. IL10 signaling (black) leads to inhibition of LPS-induced inflammatory events partly through expression of genes which include EP4. EP4 signaling (red) involves the Gαs-dependent elevation of cAMP levels and subsequent activation and phosphorylation of the CREB transcription factor. pCREB interferes with LPS-induced NFκB transcription, and supports transcription of more IL10. Solid lines indicate protein-protein interactions; dashed lines indicate the production or action of ligands/proteins/second messengers. Abbreviations defined in the text. Investigators have looked at whether PGE2 stimulation of EP4 receptor dependent production of endogenous IL10 accounts for some or all of the anti-inflammatory action of PGE2. Seldon et al used neutralizing anti-IL10 antibodies to show that PGE2 inhibition of TNFα expression in human monocytes was independent of endogenous IL10 [56]. In contrast, studies with mouse perimacs cells and anti-IL10 antibodies [57], or mouse IL10+/+ and IL10-/- BMDM [58] suggested that PGE2 induction of TNFα or COX-2 depended on PGE2 induction of IL10 expression. The apparent difference in IL10 requirement between the human and mouse studies might be due to differences in the kinetics of LPS-induced IL10 expression in the different cell types or their phenotype/differentiation state [57]. Regardless of whether EP4 agonists elicit all their anti-inflammatory actions through induction of endogenous IL10, an EP4 agonist has now been tested and shown to be effective in phase 2 trials of ulcerative colitis [41]. In this paper, we examined the conversed question of whether IL10R signalling involves subsequent PGE2 stimulation of EP4 signalling. Corraliza et al [59] had found that IL10 treatment of BMDM activated PKA activity which peaked at 2–4 hours after IL10 addition. The delayed timing of PKA activation suggests that IL10R signalling indirectly leads to PKA activation, perhaps through EP4 signalling. In support of this, investigators have found that endogenous PGE2 is synthesized in within an hour of LPS stimulation [60]). We show in this study that EP4 protein expression requires is expressed within an hour of IL10 addition (Fig 3) and that IL10 stimulation of pCREB required the presence of EP4 (Fig 6). Since elevation of cAMP levels has been shown to inhibit the activity of LPS-induced, PI3K-dependent signalling [49] in macrophages, we examined whether IL10 inhibition of PI3K signalling required EP4. We found that IL10 inhibition of LPS-stimulated phosphorylation of p85 subunit of PI3K and the downstream p70 S6 kinase does require the presence of EP4 protein (Fig 6). Altogether, these data are consistent with our model where EP4 signalling might be responsible for the activation of PKA-dependent signalling previously ascribed to the immediate signalling from the IL10R. That IL10 activation of cAMP signalling occurs indirectly through EP4 also provides an explanation for why cAMP elevating agents are synergistic rather than additive with IL10 stimulation for induction of certain inflammatory proteins [61]. Most importantly, since PGE2 agonists exert their anti-inflammatory action through EP4, only patients whose inflammatory cells express EP4 will benefit from treatment. We show in this study that IL10 can induce EP4 protein expression; it remains to be determined whether other factors can lead to EP4 expression in normal physiology and inflammatory disease. If IL10 is the main or only cytokine which upregulates EP4 protein expression in macrophages then PGE2 agonists may not be effective in diseases in which the IL10R or IL10 is deficient [12, 17, 62]. (PDF) Click here for additional data file. 18 Nov 2019 PONE-D-19-28373 Interleukin-10 contributes to PGE2 signalling through upregulation of EP4 via SHIP1 and STAT3 PLOS ONE Dear Dr. Mui, Thank you for submitting your manuscript to PLOS ONE. After careful consideration, we feel that it has merit but does not fully meet PLOS ONE’s publication criteria as it currently stands. Therefore, we invite you to submit a revised version of the manuscript that addresses the points raised during the review process. In particular, Rev 1 made several critical comments that have to be addressed before the manuscript can be reconsidered for publication including consistency of experimental systems (this requires at least additional controls and potential revision of conclusions), use of adequate controls for determining effects of Il10 on EP4 and role of LPS in that phenomenon, and, proper normalization of western blots as well as validation of nuclear localization-perturbing constructs. We would appreciate receiving your revised manuscript in 90 days from the date of this decision letter. When you are ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file. If you would like to make changes to your financial disclosure, please include your updated statement in your cover letter. To enhance the reproducibility of your results, we recommend that if applicable you deposit your laboratory protocols in protocols.io, where a protocol can be assigned its own identifier (DOI) such that it can be cited independently in the future. For instructions see: http://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocols Please include the following items when submitting your revised manuscript: A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). This letter should be uploaded as separate file and labeled 'Response to Reviewers'. A marked-up copy of your manuscript that highlights changes made to the original version. This file should be uploaded as separate file and labeled 'Revised Manuscript with Track Changes'. An unmarked version of your revised paper without tracked changes. This file should be uploaded as separate file and labeled 'Manuscript'. Please note while forming your response, if your article is accepted, you may have the opportunity to make the peer review history publicly available. The record will include editor decision letters (with reviews) and your responses to reviewer comments. If eligible, we will contact you to opt in or out. We look forward to receiving your revised manuscript. Kind regards, Michal Hetman Academic Editor PLOS ONE Journal Requirements: 1. When submitting your revision, we need you to address these additional requirements. Please ensure that your manuscript meets PLOS ONE's style requirements, including those for file naming. The PLOS ONE style templates can be found at http://www.journals.plos.org/plosone/s/file?id=wjVg/PLOSOne_formatting_sample_main_body.pdf and http://www.journals.plos.org/plosone/s/file?id=ba62/PLOSOne_formatting_sample_title_authors_affiliations.pdf 2. PLOS ONE now requires that authors provide the original uncropped and unadjusted images underlying all blot or gel results reported in a submission’s figures or Supporting Information files. This policy and the journal’s other requirements for blot/gel reporting and figure preparation are described in detail at https://journals.plos.org/plosone/s/figures#loc-blot-and-gel-reporting-requirements and https://journals.plos.org/plosone/s/figures#loc-preparing-figures-from-image-files. When you submit your revised manuscript, please ensure that your figures adhere fully to these guidelines and provide the original underlying images for all blot or gel data reported in your submission. See the following link for instructions on providing the original image data: https://journals.plos.org/plosone/s/figures#loc-original-images-for-blots-and-gels. In your cover letter, please note whether your blot/gel image data are in Supporting Information or posted at a public data repository, provide the repository URL if relevant, and provide specific details as to which raw blot/gel images, if any, are not available. Email us at plosone@plos.org if you have any questions. 3. Please include a caption for figure 7. [Note: HTML markup is below. Please do not edit.] Reviewers' comments: Reviewer's Responses to Questions Comments to the Author 1. Is the manuscript technically sound, and do the data support the conclusions? The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented. Reviewer #1: Partly Reviewer #2: Yes ********** 2. Has the statistical analysis been performed appropriately and rigorously? Reviewer #1: Yes Reviewer #2: Yes ********** 3. Have the authors made all data underlying the findings in their manuscript fully available? The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified. Reviewer #1: Yes Reviewer #2: Yes ********** 4. Is the manuscript presented in an intelligible fashion and written in standard English? PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here. Reviewer #1: Yes Reviewer #2: Yes ********** 5. Review Comments to the Author Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters) Reviewer #1: The manuscript by Samiea et al describes a potential mechanism by which the anti-inflammatory activities of IL-10 are manifested in macrophages. The authors find that IL-10 induces upregulation of the prostaglandin E2 receptor EP4 and this requires both STAT3 and SHIP1. Using a variety of knockdown systems, the authors present data suggesting that IL-10-mediated upregulation of EP4 and subsequent EP4 signaling is required to elicit the anti-inflammatory activities of IL-10. While the manuscript is presented in a clear and logical fashion, the quality of the some of the figures makes the data difficult to interpret. Furthermore, there are important controls missing from some of the figures. Specific comments. 1. The data presented in figure 1 suggests that IL-10 upregulates EP4 mRNA in peritoneal macrophages in the presence of LPS, and this is dependent on both SHIP1 and STAT3. The data in figure 2 suggests that IL-10 induces EP4 protein in a macrophage cell line and a bone marrow-derived macrophage line derived from SHIP1 knockout mice that has been reconstituted with SHIP1, and this is independent of LPS. Is the upregulation of EP4 mRNA in figure 1 also independent of LPS? The use of the different cell lines in the different figures makes the data difficult to interpret since IL-10 can have differential effects on different cell types. The authors should be consistent in the systems they use to test theit hypotheses. 2. Since it appears that LPS is not required for induction of IL-10-mediated EP4 protein induction, effects on (figure 2), the authors should consider including looking at the effects of IL-10 alone in their efforts to elucidate the IL-10/EP4 signaling axis. 3. How are the authors quantitating STAT3 activation in the STAT3 knockout cells in figure 4C? There is no STAT3 expressed in those cells. 4. The authors should show that the different point mutants of SHIP1 used for the data in figure 5 are indeed defective for nuclear translocation. 5. From figure 5B, it appears that LPS and LPS + IL-10 decrease the expression of the K331A mutant SHIP1. This needs to be clarified. Is it possible this decrease in the K331A SHIP1 level is sufficient to impair the induction of EP4? 6. The total levels of STAT3 are missing from figure 5 which should be used to normalize activation of STAT3, rather than Actin. Similarly, the levels of CREB, p85-PI3K and p70 S6K are required for normalization of the concomitant phosphor proteins in figure 6. The data is difficult to interpret without these important controls. 7. The data presented in figure 6 suggests that EP4 is required for IL-10 activity. The use of an alternate method to verify this would strengthen the manuscript. Macrophages from EP4 knockout mice or an EP4 antagonist could be used to confirm these data. 8. The western blots for EP4 in figures 3 and 4A are not clear, making it difficult to interpret the data. 9. There is no point to including an Actin loading control in Figure 4 if it is not used as a normalizer for quantitation. Reviewer #2: Interesting study well supported by the experimental data, adding to the existing information on PGE2 and IL-10 Rs. The authors wrote aclear report on their data which add to the existing information on IL-10 signaling including now the upregulation of EP4 in macrophages ********** 6. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files. If you choose “no”, your identity will remain anonymous but your review may still be made public. Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy. Reviewer #1: No Reviewer #2: No [NOTE: If reviewer comments were submitted as an attachment file, they will be attached to this email and accessible via the submission site. Please log into your account, locate the manuscript record, and check for the action link "View Attachments". If this link does not appear, there are no attachment files to be viewed.] While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com/. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Registration is free. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email us at figures@plos.org. Please note that Supporting Information files do not need this step. 7 Feb 2020 Reviewer #1 is the only one requiring changes. We thank the reviewer for their suggestions, and have added new data as requested (points #1, 6 and 7 below). We also removed all data related to the J17 cells reconstituted with SHIP1 mutants (points #4 and 5). Corrections were also made as suggested. As requested by the Editor, we have provided original uncropped and unadjusted images underlying all blot results reported in our figures. These images can be found within the file S1_raw_images.pdf within Supporting Information. --------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Reviewer #1: The manuscript by Samiea et al describes a potential mechanism by which the anti-inflammatory activities of IL-10 are manifested in macrophages. The authors find that IL-10 induces upregulation of the prostaglandin E2 receptor EP4 and this requires both STAT3 and SHIP1. Using a variety of knockdown systems, the authors present data suggesting that IL-10-mediated upregulation of EP4 and subsequent EP4 signaling is required to elicit the anti-inflammatory activities of IL-10. While the manuscript is presented in a clear and logical fashion, the quality of the some of the figures makes the data difficult to interpret. Furthermore, there are important controls missing from some of the figures. Specific comments. 1. The data presented in figure 1 suggests that IL-10 upregulates EP4 mRNA in peritoneal macrophages in the presence of LPS, and this is dependent on both SHIP1 and STAT3. The data in figure 2 suggests that IL-10 induces EP4 protein in a macrophage cell line and a bone marrow-derived macrophage line derived from SHIP1 knockout mice that has been reconstituted with SHIP1, and this is independent of LPS. Is the upregulation of EP4 mRNA in figure 1 also independent of LPS? The use of the different cell lines in the different figures makes the data difficult to interpret since IL-10 can have differential effects on different cell types. The authors should be consistent in the systems they use to test their hypotheses. ANSWER: As suggested by the reviewer, we have now looked at EP4 mRNA levels in each of the cell types (perimacs, BMDM and RAW264.7 cells) used in our study. We chose only to look at the action of IL10 in the presence of LPS activation, since the physiological target of IL10 is the activated macrophage (1). The new mRNA expression data from bone marrow derived macrophages (BMDM, Fig 1B and 1C) and RAW264.7 cells (Fig 1D) have been added to Fig 1. We found that EP4 mRNA induction by IL10 required SHIP1 in both perimacs (Fig 1A, left) and BMDM (Fig 1B, left), since the level of EP4 mRNA induced by IL10 is significantly diminished in SHIP1-/- perimacs and BMDM. However, although STAT3 seems to contribute to IL10 induction of EP4 in perimacs (Fig 1A, right), in BMDM, STAT3 is not required for EP4 induction (Fig 1B, right). We checked that the STAT3-/- are impaired in IL10 responses as we and others have shown (2, 3), and confirmed IL10 could not inhibit TNFα expression in STAT3-/- BMDM (Fig 1C). The focus of the current paper is the IL10 regulation of EP4 protein expression. In future studies we will examine whether the increased mRNA occurs transcriptionally or post-transcriptionally, whether IL10 alone is able to elicit these changes, and why the STAT3 dependence of IL10 induction of EP4 mRNA occurs only in perimacs and not BMDM. 2. Since it appears that LPS is not required for induction of IL-10-mediated EP4 protein induction, effects on (figure 2), the authors should consider including looking at the effects of IL-10 alone in their efforts to elucidate the IL-10/EP4 signaling axis. ANSWER: The physiological target of IL10 is the activated macrophage (1). IL10 is produced by an activated macrophage as an autocrine, negative feedback inhibitor. IL10 inhibits the macrophage production of TNFα (Fig 5, Fig 6C), and LPS induced signaling events (Fig 6 A/B). Furthermore, the consequence of EP4 expression (induced by IL10) is only seen in if the EP4 ligand (PGE2) is present. PGE2 is induced by LPS. We have removed the data of the studies in which IL10 is added to inactivated macrophages (old Fig 2). 3. How are the authors quantitating STAT3 activation in the STAT3 knockout cells in figure 4C? There is no STAT3 expressed in those cells. ANSWER: We apologize, this was an error. The pSTAT3 and STAT3 quantification in STAT3 knockout cells has been removed. 4. The authors should show that the different point mutants of SHIP1 used for the data in figure 5 are indeed defective for nuclear translocation. We are unable to redo the experiments in the cells reconstituted with different SHIP1 mutants since these cells have been lost (LN2 Dewar thawed). ANSWER: We have removed all the data related to analysis of effect of SHIP1 mutations on IL10 induction of EP4 protein. These analyses of the contribution of SHIP1’s nuclear localization signal is peripheral to our main message that IL10 induction of EP4 protein is SHIP1 dependent and contributes to IL10 inhibition of macrophage activation as shown by TNFα production. 5. From figure 5B, it appears that LPS and LPS + IL-10 decrease the expression of the K331A mutant SHIP1. This needs to be clarified. Is it possible this decrease in the K331A SHIP1 level is sufficient to impair the induction of EP4? ANSWER: Yes, it is possible the diminished expression of K331A rather than the K331A substitution is responsible for the impaired EP4 induction. However, we have removed all the data related to the SHIP1 mutants from the paper. 6. The total levels of STAT3 are missing from figure 5 which should be used to normalize activation of STAT3, rather than Actin. Similarly, the levels of CREB, p85-PI3K and p70 S6K are required for normalization of the concomitant phosphor proteins in figure 6. The data is difficult to interpret without these important controls. ANSWER: The levels of protein STAT3 CREB, p85-PI3K and p70-S6K were measured and used to normalize the level of phosphorylated proteins (Revised Fig 6). 7. The data presented in figure 6 suggests that EP4 is required for IL-10 activity. The use of an alternate method to verify this would strengthen the manuscript. Macrophages from EP4 knockout mice or an EP4 antagonist could be used to confirm these data. ANSWER: Thank-you for suggesting the use of an EP4 antagonist. When the EP4 antagonist, RAW264.7 cells are treated with 100 nM ONO-AE3-208 IL-10 was no longer able to inhibit TNFα production (New Fig 5); rather the level of TNFα actually increased in cells treated with low (0.1 – 1 ng/mL) concentration of IL10 concentrations. High (30 ng/mL) concentrations of IL10 was able to overcome the effect of ONO-AE3-208. 8. The western blots for EP4 in figures 3 and 4A are not clear, making it difficult to interpret the data. ANSWER: We have replaced the EP4 blots in Fig 3 and 4A. 9. There is no point to including an Actin loading control in Figure 4 if it is not used as a normalizer for quantitation. ANSWER: We have removed Actin loading control was removed from the Fig 4. References: 1. Iyer SS, Cheng G. Role of interleukin 10 transcriptional regulation in inflammation and autoimmune disease. Crit Rev Immunol. 2012;32(1):23-63. 2. Chan CS, Ming-Lum A, Golds GB, Lee SJ, Anderson RJ, Mui AL-F. Interleukin-10 inhibits LPS induced TNFα translation through a SHIP1-dependent pathway. Journal of Biological Chemistry. 2012. 3. Cheung ST, So EY, Chang D, Ming-Lum A, Mui AL. Interleukin-10 inhibits lipopolysaccharide induced miR-155 precursor stability and maturation. PLoS One. 2013;8(8):e71336. Submitted filename: Response to reviewer.docx Click here for additional data file. 2 Mar 2020 Interleukin-10 contributes to PGE2 signalling through upregulation of EP4 via SHIP1 and STAT3 PONE-D-19-28373R1 Dear Dr. Mui, We are pleased to inform you that your manuscript has been judged scientifically suitable for publication and will be formally accepted for publication once it complies with all outstanding technical requirements. Within one week, you will receive an e-mail containing information on the amendments required prior to publication. When all required modifications have been addressed, you will receive a formal acceptance letter and your manuscript will proceed to our production department and be scheduled for publication. Shortly after the formal acceptance letter is sent, an invoice for payment will follow. To ensure an efficient production and billing process, please log into Editorial Manager at https://www.editorialmanager.com/pone/, click the "Update My Information" link at the top of the page, and update your user information. If you have any billing related questions, please contact our Author Billing department directly at authorbilling@plos.org. If your institution or institutions have a press office, please notify them about your upcoming paper to enable them to help maximize its impact. If they will be preparing press materials for this manuscript, you must inform our press team as soon as possible and no later than 48 hours after receiving the formal acceptance. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information, please contact onepress@plos.org. With kind regards, Michal Hetman Academic Editor PLOS ONE Additional Editor Comments (optional): Reviewers' comments: Reviewer's Responses to Questions Comments to the Author 1. If the authors have adequately addressed your comments raised in a previous round of review and you feel that this manuscript is now acceptable for publication, you may indicate that here to bypass the “Comments to the Author” section, enter your conflict of interest statement in the “Confidential to Editor” section, and submit your "Accept" recommendation. Reviewer #1: All comments have been addressed ********** 2. Is the manuscript technically sound, and do the data support the conclusions? The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented. Reviewer #1: Yes ********** 3. Has the statistical analysis been performed appropriately and rigorously? Reviewer #1: Yes ********** 4. Have the authors made all data underlying the findings in their manuscript fully available? The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified. Reviewer #1: Yes ********** 5. Is the manuscript presented in an intelligible fashion and written in standard English? PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here. Reviewer #1: Yes ********** 6. Review Comments to the Author Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters) Reviewer #1: (No Response) ********** 7. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files. If you choose “no”, your identity will remain anonymous but your review may still be made public. Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy. Reviewer #1: No 6 Mar 2020 PONE-D-19-28373R1 Interleukin-10 contributes to PGE2 signalling through upregulation of EP4 via SHIP1 and STAT3 Dear Dr. Mui: I am pleased to inform you that your manuscript has been deemed suitable for publication in PLOS ONE. Congratulations! Your manuscript is now with our production department. If your institution or institutions have a press office, please notify them about your upcoming paper at this point, to enable them to help maximize its impact. If they will be preparing press materials for this manuscript, please inform our press team within the next 48 hours. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information please contact onepress@plos.org. For any other questions or concerns, please email plosone@plos.org. Thank you for submitting your work to PLOS ONE. With kind regards, PLOS ONE Editorial Office Staff on behalf of Dr. Michal Hetman Academic Editor PLOS ONE
  59 in total

1.  The prostaglandin EP4 receptor is a master regulator of the expression of PGE2 receptors following inflammatory activation in human monocytic cells.

Authors:  Alaa Kashmiry; Rothwelle Tate; Giuliana Rotondo; Jillian Davidson; Dino Rotondo
Journal:  Biochim Biophys Acta Mol Cell Biol Lipids       Date:  2018-07-24       Impact factor: 4.698

Review 2.  IL-10 and IL-10 receptor defects in humans.

Authors:  Erik-Oliver Glocker; Daniel Kotlarz; Christoph Klein; Neil Shah; Bodo Grimbacher
Journal:  Ann N Y Acad Sci       Date:  2011-12       Impact factor: 5.691

Review 3.  The role of the transcription factor CREB in immune function.

Authors:  Andy Y Wen; Kathleen M Sakamoto; Lloyd S Miller
Journal:  J Immunol       Date:  2010-12-01       Impact factor: 5.422

4.  Loss of interleukin-10 signaling and infantile inflammatory bowel disease: implications for diagnosis and therapy.

Authors:  Daniel Kotlarz; Rita Beier; Dhaarini Murugan; Jana Diestelhorst; Ole Jensen; Kaan Boztug; Dietmar Pfeifer; Hans Kreipe; Eva-Doreen Pfister; Ulrich Baumann; Jacek Puchalka; Jens Bohne; Odul Egritas; Buket Dalgic; Kaija-Leena Kolho; Axel Sauerbrey; Stephan Buderus; Tayfun Güngör; Axel Enninger; Yu Kar Ling Koda; Graziella Guariso; Batia Weiss; Selim Corbacioglu; Piotr Socha; Nuray Uslu; Ayse Metin; Ghassan T Wahbeh; Khalid Husain; Dina Ramadan; Waleed Al-Herz; Bodo Grimbacher; Martin Sauer; Karl-Walter Sykora; Sibylle Koletzko; Christoph Klein
Journal:  Gastroenterology       Date:  2012-04-28       Impact factor: 22.682

5.  Induction of COX-2 by LPS in macrophages is regulated by Tpl2-dependent CREB activation signals.

Authors:  Aristides G Eliopoulos; Calin D Dumitru; Chun-Chi Wang; Jeonghee Cho; Philip N Tsichlis
Journal:  EMBO J       Date:  2002-09-16       Impact factor: 11.598

6.  MSK1 and MSK2 inhibit lipopolysaccharide-induced prostaglandin production via an interleukin-10 feedback loop.

Authors:  Kirsty F MacKenzie; Mirjam W M Van Den Bosch; Shaista Naqvi; Suzanne E Elcombe; Victoria A McGuire; Alastair D Reith; Perry J Blackshear; Jonathan L E Dean; J Simon C Arthur
Journal:  Mol Cell Biol       Date:  2013-02-04       Impact factor: 4.272

Review 7.  Macrophages in the embryo and beyond: much more than just giant phagocytes.

Authors:  Dmitry A Ovchinnikov
Journal:  Genesis       Date:  2008-09       Impact factor: 2.487

8.  Interleukin-10 inhibits lipopolysaccharide-induced tumor necrosis factor-α translation through a SHIP1-dependent pathway.

Authors:  Catherine S Chan; Andrew Ming-Lum; Gary B Golds; Shaina J Lee; Raymond J Anderson; Alice L-F Mui
Journal:  J Biol Chem       Date:  2012-09-06       Impact factor: 5.157

9.  Investigation of multiple susceptibility loci for inflammatory bowel disease in an Italian cohort of patients.

Authors:  Anna Latiano; Orazio Palmieri; Tiziana Latiano; Giuseppe Corritore; Fabrizio Bossa; Giuseppina Martino; Giuseppe Biscaglia; Daniela Scimeca; Maria Rosa Valvano; Maria Pastore; Antonio Marseglia; Renata D'Incà; Angelo Andriulli; Vito Annese
Journal:  PLoS One       Date:  2011-07-27       Impact factor: 3.240

10.  Interleukin-10 inhibits lipopolysaccharide induced miR-155 precursor stability and maturation.

Authors:  Sylvia T Cheung; Eva Y So; David Chang; Andrew Ming-Lum; Alice L-F Mui
Journal:  PLoS One       Date:  2013-08-12       Impact factor: 3.240

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.