Literature DB >> 32184426

First transcriptome of the Neotropical pest Euschistus heros (Hemiptera: Pentatomidae) with dissection of its siRNA machinery.

Deise Cagliari1,2, Naymã Pinto Dias3, Ericmar Ávila Dos Santos3, Leticia Neutzling Rickes3, Frederico Schmitt Kremer4, Juliano Ricardo Farias5, Giuvan Lenz6, Diogo Manzano Galdeano7, Flávio Roberto Mello Garcia8, Guy Smagghe9, Moisés João Zotti10.   

Abstract

Over the past few years, the use of RNA interference (RNAi) for insect pest management has attracted considerable interest in academia and industry as a pest-specific and environment-friendly strategy for pest control. For the success of this technique, the presence of core RNAi genes and a functional silencing machinery is essential. Therefore, the aim of this study was to test whether the Neotropical brown stinkbug Euschistus heros has the main RNAi core genes and whether the supply of dsRNA could generate an efficient gene silencing response. To do this, total mRNA of all developmental stages was sequenced on an Illumina platform, followed by a de novo assembly, gene annotation and RNAi-related gene identification. Once RNAi-related genes were identified, nuclease activities in hemolymph were investigated through an ex vivo assay. To test the functionality of the siRNA machinery, E. heros adults were microinjected with ~28 ng per mg of insect of a dsRNA targeting the V-ATPase-A gene. Mortality, relative transcript levels of V-ATPase-A, and the expression of the genes involved in the siRNA machinery, Dicer-2 (DCR-2) and Argonaute 2 (AGO-2), were analyzed. Transcriptome sequencing generated more than 126 million sequenced reads, and these were annotated in approximately 80,000 contigs. The search of RNAi-related genes resulted in 47 genes involved in the three major RNAi pathways, with the absence of sid-like homologous. Although ex vivo incubation of dsRNA in E. heros hemolymph showed rapid degradation, there was 35% mortality at 4 days after treatment and a significant reduction in V-ATPase-A gene expression. These results indicated that although sid-like genes are lacking, the dsRNA uptake mechanism was very efficient. Also, 2-fold and 4-fold overexpression of DCR-2 and AGO-2, respectively, after dsRNA supply indicated the activation of the siRNA machinery. Consequently, E. heros has proven to be sensitive to RNAi upon injection of dsRNA into its hemocoel. We believe that this finding together with a publically available transcriptome and the validation of a responsive RNAi machinery provide a starting point for future field applications against one of the most important soybean pests in South America.

Entities:  

Mesh:

Substances:

Year:  2020        PMID: 32184426      PMCID: PMC7078254          DOI: 10.1038/s41598-020-60078-3

Source DB:  PubMed          Journal:  Sci Rep        ISSN: 2045-2322            Impact factor:   4.379


Introduction

The Neotropical brown stink bug (BS), Euschistus heros (Hemiptera: Pentatomidae), is one of the most important Pentatomidae pests in South America[1], especially in soybean (Glycine max) with a reduction in seed quality and yield[2]. Stink bugs use their piercing/sucking mouthparts to inject enzymes into the plant tissues to digest plant components and remove pre-digested fluids[3]. Although rarely reported before the 70s[2,4], since then population outbreaks[2,5] and rapid population growth have allowed expansion of the range of E. heros to all the major South American soybean production regions, including Brazil[2], Paraguay[2], and Argentina[6]. The current recommendations for the management of this insect rely on the use of broad-spectrum insecticides such as organophosphates and pyrethroids (AGROFIT, http://agrofit.agricultura.gov.br/agrofit_cons/principal_agrofit_cons). However, these are detrimental to the environment and some are harmful to beneficial organisms. Furthermore, the high infestation of E. heros has frequently been reported and the lack of a sustainable alternative for pest control has led growers frequently to spray insecticides from the same chemical group, contributing to the selection of resistant strains[7-9]. Moreover, due to favorable weather conditions found in Brazil, Argentina and Paraguay, multiple generations occur during a crop season, making the control even more difficult. Therefore, effective and environmental-friendly multiple control strategies are needed to reduce the use of highly toxic pesticides and to delay resistance development in E. heros. RNA interference (RNAi), also known as Post-Transcriptional Gene Silencing (PTGS), is a natural mechanism of gene regulation and a defense system against viruses in eukaryotic cells[10,11], and since the milestone work done by Baum et al.[12], RNAi towards insect management has significantly attracted interest as an alternative control strategy to synthetic insecticides. In 2017, genetically modified maize using RNAi-based technology against Diabrotica virgifera virgifera (Coleoptera: Chrysomelidae), an important pest in the United States of America (USA), has been approved by the Environmental Protection Agency (EPA) in the USA[13]. Besides the use of RNAi in plants, RNA-based spray insecticides, focusing on non-transformative approaches, are expected to be introduced into the market soon[14], with significant advances in the use of SIGS (Spray-Induced Gene Silencing)[15,16]. RNAi triggers gene silencing through non-coding RNAs (ncRNAs), such as micro RNAs (miRNAs) and small interfering RNA (siRNA), originally generated from double-stranded RNA (dsRNA)[17], and Piwi-interacting RNA (piRNA)[18]. The success of the RNAi relies on the ability of the insect cells to efficiently uptake the dsRNA from the environment[19] and activate the silencing machinery. The process of dsRNA uptake can be mediated by transmembrane channel proteins such as sid-like (systemic interference defective-like)[20-22], or endocytosis[23-27], allowing gene silencing in cells/tissues distant from the uptake point[19,28]. Once inside cells, dsRNAs are processed into siRNA fragments, with ~20 base pairs (bp), by the ribonuclease III enzyme Dicer 2 (DCR-2)[29]. These siRNAs are incorporated into the RISC (RNA-Induced Silencing Complex), which contains the Argonaute 2 (AGO-2) protein[30] allowing the specific breakdown of messenger RNA (mRNA) and so preventing the protein formation[19]. Transcriptome analysis focusing on RNAi as a control strategy has been reported in insects mainly for Coleoptera[31-33], Lepidoptera[34] and Hemiptera[35]. According to some studies, RNAi is less efficient in Hemiptera[36,37] when compared to Coleoptera because of the presence of double-stranded ribonucleases (dsRNases)[38-40]. In the pea aphid, Acyrthosiphon pisum (Hemiptera: Aphidoidea), the lack of RNAi response was associated with the high nuclease activity in hemolymph[41]. However, the brown marmorated stink bug, Halyomorpha halys (Heteroptera: Pentatomidae), has lower nuclease activities and gene silencing can reach up to 70% when compared to Heliothis virescens (Lepidoptera: Noctuidae)[42]. Successful use of RNAi through oral delivery has been reported in other hemipteran species such as Diaphorina citri (Hemiptera: Lividae)[43,44], Bemisia tabaci (Hemiptera: Aleyrodidae)[45], and Nilaparvata lugens (Homoptera: Delphacidae)[46], suggesting that RNAi could be further investigated towards a control strategy in E. heros. Transcriptome analysis allows researchers to understand the RNAi mechanism and its main components as well as helping in the selection of target genes, essential genes involved in biological processes and housekeeping genes. Therefore, the main goal of our work was to provide a transcriptome dataset for E. heros, characterize the genes involved in the RNAi pathways, and validate the RNAi machinery through a gene silencing assay. In brief, the RNAi core genes were identified, and the efficiency of the siRNA machinery was tested through injection of dsRNA followed by quantitative real-time PCR. Next, considering the importance of dsRNA degradation by nucleases, an ex vivo assay was performed with collected hemolymph. Finally, dsRNAs were designed to target V-ATPase subunit A gene, resulting in mortality after microinjection. To test the activation of the siRNA machinery, an upregulation of DCR-2 and AGO-2 was also investigated. Overall, these data will provide for the first time the dissection of siRNA pathway in E. heros and with an efficient dsRNA cellular uptake system, resulting in significant insect mortality. These data could then be further explored to develop a pest control strategy using RNAi.

Results

Analysis of E. heros transcriptome

RNA sequencing resulted in a total of 126,455,838 reads of 101 bp long, corresponding to an accumulated length of 12,772,039,638 bp. De novo assembling using Trinity software resulted in 147,612 transcripts, assembled into 83,114 contigs with an average length of 1,000 bp and an average GC content of 37.12%. Based on Diamond analysis, a total of 60,956 hits was produced, representing 41.30% of the total transcripts (Fig. 1A). Out of the sequences, 60,227 hits (98.8%) were from Eukaryotes, with 84.64% of the contigs similar to sequences from Hemiptera species: 20.16% to the Lygus hesperus (Hemiptera: Miridae), 17.57% to Triatoma infestans (Hemiptera: Reduviidae), 11.69% to Rhodnius prolixus (Hemiptera: Reduviidae), 7.03% to Riptortus pedestris (Hemiptera: Alydidae), 6.55% to Panstrongylus megistus (Hemiptera: Reduviidae), 4.69% to Triatoma dimidiate (Hemiptera: Reduviidae), 4.43% to A. pisum, 4.26% to Rhodnius neglectus (Hemiptera: Reduviidae), 3.15% to Clastoptera arizonana (Hemiptera: Clastopteridae), 1.88% to Graphocephala atropunctata (Hemiptera: Cicadellidae), 1.73% to Cuerna arida (Hemiptera: Cicadellidae), 1.50% to Homalodisca liturata (Hemiptera: Cicadellidae). The reminding 15.36% belonged to Zootermopsis nevadensis (Isoptera: Archotermopsidae) (1.00%), Lasius niger (Hymenoptera: Formicidae) (0.87%), D. citri (0.83%), Tribolium castaneum (Coleoptera: Tenebrionidae) (0.78%) and Anoplophora glabripennis (Coleoptera: Cerambycidae) (0.54%), and other hits (11.34%) (Fig. 1B, Supplementary Table S1). The raw reads have been deposited in the sequence reads archive (SRA) at NCBI, and can be accessed using SRP159293 accession number.
Figure 1

Euschistus heros sequence comparison to other insect species. (A) Total transcripts (%) with known and unknown protein sequences in E. heros using BLASTx search. (B) BLASTx comparison of E. heros known sequences to other insect genera (bitscore>50) against the nr protein database of the NCBI.

Euschistus heros sequence comparison to other insect species. (A) Total transcripts (%) with known and unknown protein sequences in E. heros using BLASTx search. (B) BLASTx comparison of E. heros known sequences to other insect genera (bitscore>50) against the nr protein database of the NCBI. A total of 143,806 predicted GO terms was obtained and grouped into three categories: cellular components, biological processes, and molecular functions. Membrane was the most dominant GO term within the cellular component (28,631; 29.3%), for the biological processes it was RNA-dependent DNA biosynthesis process (46,238; 10.4%), and for the molecular function was nucleic acid binding (68,937; 8.9%) (Fig. 2A–C).
Figure 2

Percentage of E. heros contigs assigned to a gene ontology term as predicted by QuickGO from EBI. (A) Cellular components. (B) Biological process. (C) Molecular function.

Percentage of E. heros contigs assigned to a gene ontology term as predicted by QuickGO from EBI. (A) Cellular components. (B) Biological process. (C) Molecular function.

Identification of RNAi-related genes

The result of the E. heros transcriptome search for RNAi-related genes revealed the presence of 47 genes associated with dsRNA uptake, RNAi core machinery, auxiliary RISC factors, nucleases, antiviral RNAi, and intracellular transport. Some RNAi-related proteins presented variants, with the presence or absence of conserved domains. Overall, the sequences of H. halys showed the highest similarity to sequences from E. heros.

dsRNA uptake

The protein sequences involved in dsRNA uptake were searched in the E. heros transcriptome, and a total of six proteins related to this process was found, although there was an absence of sid-like genes (Table 1, Supplementary data S1). Scavenger protein was found with a CD36 domain region, Ubiquitin-protein transferase (FBX011) with an F-box conserved domain and three beta-helices, and Epsin 2 with an Epsin N-terminal homology (ENTH) domain. The Clathrin heavy chain (Chc) protein and Gap Junction Protein with an Innexin conserved domain were also found in the E. heros transcriptome.
Table 1

Overview of identified genes related to the dsRNA uptake in E. heros.

Gene IDTranscripts Per Million (TPM)First hit BLASTpHomologue IDComparisonIdentity (%)
Scavenger818,716Scavenger receptor class B member 1, partialXP_024218066.1 (Halyomorpha halys)E = 0.0; bits = 103996
CG4966 = orthologous to the Hermansky-Pudlak Syndrome4310,363Uncharacterized protein LOC106688690XP_014288755.1 (Halyomorpha halys)E = 0.0; bits = 127190
F-box protein 11 (FBX011)102,285F-box only protein 11XP_014287303.1 (Halyomorpha halys)E = 0.0; bits = 179499
Clathrin heavy chain (Chc)960,642Clathrin heavy chainXP_014287090.1 (Halyomorpha halys)E = 0.0; bits = 347799
Epsin 2 (Epn2)141,317Epsin-2 isoform X5XP_014270392.1 (Halyomorpha halys)E = 0.0; bits = 90092
Gap Junction protein (Innexin2)324,716Innexin inx2XP_014292574.1 (Halyomorpha halys)E = 0.0; bits = 73660
Overview of identified genes related to the dsRNA uptake in E. heros.

Core RNAi machinery

Proteins related to the miRNA, siRNA and piRNA pathways were identified in the E. heros transcriptome (Table 2, Supplementary data S2).
Table 2

Overview of the core RNAi-related genes in E. heros.

Gene IDTranscripts Per Million (TPM)First hit BLASTpHomologue IDComparisonIdentity (%)
miRNA
DCR-10.775Dcr-1AVK59457.1 (Nezara viridula)E = 0.0; bits = 210991
AGO-1 isoform 10.585Argonaute-1-PCAVK59466.1 (Nezara viridula)E = 0.0; bits = 1924;99.89
AGO-1 isoform 30.103Argonaute-1-PCAVK59466.1 (Nezara viridula)E = 0.0; bits = 1923;99.89
AGO-1 isoform 40.407Argonaute-1-PCAVK59466.1 (Nezara viridula)E = 0.0; bits = 1924;99.89
AGO-1 isoform 5118,437Protein argonaute-2 isoform X3XP_014287705.1 (Halyomorpha halys)E = 0.0; bits = 187799
Loquacious379,404RISC-loading complex subunit tarbp2-like isoform X1XP_014274312.1 (Halyomorpha halys)E = 0.0; bits = 52196
Drosha112,718Ribonuclease 3XP_014278529.1 (Halyomorpha halys)E = 0.0; bits = 236691
Pasha692,682Microprocessor complex subunit DGCR8XP_014282581.1 (Halyomorpha halys)E = 0.0; bits = 107889
Exportin-560,305Exportin-5XP_014280932.1 (Halyomorpha halys)E = 0.0; bits = 242098
siRNA
DCR-2 isoform 1646,601Endoribonuclease Dicer isoform X1XP_014275310.1 (Halyomorpha halys)E = 0.0; bits = 279583
DCR-2 isoform 20.618Endoribonuclease Dicer isoform X2XP_014275311.1 (Halyomorpha halys)E = 0.0; bits = 85288
AGO-2 isoform 1146,222Argonaute 2AVK59468.1 (Nezara viridula)E = 0.0; bits = 56580
AGO-2 isoform 20.137Argonaute 2AVK59468.1 (Nezara viridula)E = 0.0; bits = 151675
R2D2350,347Interferon-inducible double-stranded RNA-dependent protein kinase activator A-like isoform X1XP_014288218.1 (Halyomorpha halys)E = 0.0; bits = 55982
piRNA
AGO-3227,644Protein argonaute-3XP_014276831.1 (Halyomorpha halys)E = 0.0; bits = 159585
Aubergine (AUB)0.750Protein Aubergine-likeXP_014270559.1 (Halyomorpha halys)E = 0.0; bits = 167696
Piwi579,184Protein Aubergine-like isoform X3XP_014275927.1 (Halyomorpha halys)E = 0.0; bits = 1172;63
Zucchini (Zuc)0.13543Mitochondrial cardiolipin hydrolaseXP_014288409.1 (Halyomorpha halys)E = 1e-152; bits = 43286
Overview of the core RNAi-related genes in E. heros. The DCR-1 protein was found in E. heros with the conserved PAZ (Piwi, Argonaute and Zwille) domain, two RNaseIII domains and a Double-stranded RNA-binding domain (DSRBD), with an absence of the helicase domains. DCR-2 was also found in E. heros with two isoforms as following: 1 and 2 with 646,601 and 0.618 transcripts per million (TPM), respectively. The DCR-2 isoform 1 contained all the conserved domains: one helicase domain, one PAZ domain, two RNaseIII domains, and a DSRBD, while DCR-2 isoform 2 was found with two RNaseIII domains and a Ribonuclease III C terminal domain (RIBOc). Dicer 3 protein was not found in the E. heros transcriptome. Drosha protein was found with two RNaseIII domains and a RIBOc, but with the absence of PAZ, and an amino-terminal DExH-box helicase domain. The dsRNA-binding proteins Pasha, Loquacious and R2D2 were also identified in E. heros with conserved domains (DSRBDs). Argonaute superfamily proteins were also searched in the E. heros transcriptome and five members of the Argonaute superfamily proteins were identified: AGO-1, AGO-2, AGO-3, Aubergine (Aub) and Piwi (Table 2, Supplementary data S2). Four variants of the AGO-1 protein were found: isoforms 1, 3, 4 and 5, presenting 0.585, 0.103, 0.4 and 118,437 TPM, respectively. All AGO-1 isoforms were found with the PAZ and PIWI conserved domains. For the AGO-2 protein, two isoforms were found, isoform 1 and 2, with 146,222 and 0.14 TPM, respectively. AGO-2 isoform 1 was found with PAZ and PIWI conserved domains, while AGO-2 isoform 2 had no PAZ domains. AGO-3, Aub and Piwi proteins presented the PAZ and PIWI conserved domains. Zucchini (Zuc), with a nuclease conserved domain, was also found in the E. heros transcriptome. Phylogenetic analyses revealed distinct groups for DCR and AGO superfamily proteins (Supplementary Fig. S1, S2). The protein DCR-1 from E. heros was grouped in a clade with the DCR-1 proteins from Nezara viridula (Hemiptera: Pentatomidae) and H. halys, and the same results were found for E. heros DCR-2 (Supplementary Fig. S1). Also, E. heros DCR-1 was grouped in a distinct clade compared to E. heros DCR-2, but it showed a common ancestor. The phylogenetic analysis of the AGO superfamily resulted in two main clades, one contained the AGO subfamily proteins, AGO-1 and AGO-2, while the other had the PIWI subfamily proteins, AGO-3, Aub and Piwi (Supplementary Fig. S2). E. heros AGO-1 was clustered with AGO-1 from N. viridula and N. lugens, while E. heros AGO-2 was clustered in a second group together with other proteins of this family. E. heros AGO-3 was clustered in a distinct group as well as Aub and Piwi proteins.

Auxiliary RISC factor

The E. heros transcriptome was searched for RNAi auxiliary factors (Table 3, Supplementary data S3). The research resulted in 17 intracellular factors associated with the RISC. The Tudor-SN (TSN) protein sequence, with a Tudor-conserved domain, and the Translin and Translin-associated factor-X (TRAX), conserved subunits of the component 3 promoter of the RISC (C3PO), were identified in E. heros. The Armitage (Armi), spindle-E (Spn-E), Maelstrom, Gawky, Staufen (STAU) and CLIP-associating protein (Clp-1) were also present in the E. heros transcriptome with all conserved domains. HEN-1 nuclease was also present, but no conserved domain was found (DSRBD, FK506 binding protein-like domain or methyltransferase domain). Other auxiliary RISC factors identified in E. heros were the Elongator complex protein 1 (Elp-1), Vasa intronic gene (VIG), DEAD-box RNA helicases, PRP16 with a DExD conserved domain, Belle with the conserved DEAD-box domain, Glucose dehydrogenase (GLD-1) and Cytoplasmic aconitate hydratase (ACO-1).
Table 3

Overview of identified genes associated to RISC complex in E. heros.

Gene IDTranscripts Per Million (TPM)First hit BLASTpHomologue IDComparisonIdentity (%)
Tudor-SN0.144Tudor domain-containing protein 1-like isoform X2XP_014284230.1 (Halyomorpha halys)E = 0.0; bits = 203176
Translin569,424TranslinXP_014290495.1 (Halyomorpha halys)E = 1e-154; bits = 43485
Similar to translin associated factor-X (TRAX)257,569Translin-associated protein X isoform X1XP_014289754.1 (Halyomorpha halys)E = 3e-162; bits = 45685
Armitage0.284Probable RNA helicase armiXP_014289817.1 (Halyomorpha halys)E = 0.0; bits = 111096
Homeless (spindle-E)0.963535Probable ATP-dependent RNA helicase spindle-EXP_014286769.1 (Halyomorpha halys)E = 0.0; bits = 270789
Maelstrom126,192Protein maelstrom homologXP_014290039.1 (Halyomorpha halys)E = 0.0; bits = 69479
HEN10.292Uncharacterized protein LOC106685926XP_014284423.1 (Halyomorpha halys)E = 0.0; bits = 65670
PRP16, mut6 homolog351,652Pre-mRNA-splicing factor ATP-dependent RNA helicase PRP16XP_014279344.1 (Halyomorpha halys)E = 0.0; bits = 242396
Clp1 homolog (kinase)0.999CLIP-associating proteinXP_014275582.1 (Halyomorpha halys)E: 0.0; bits = 273194
Elp-1221,567Elongator complex protein 1XP_014290480.1 (Halyomorpha halys)E = 0.0; bits = 204582
GLD-1 homolog0.03Glucose dehydrogenase [FAD, quinone]-like isoform X1XP_014290348.1 (Halyomorpha halys)E = 0.0; bits = 107387
ACO-1 homolog281,389Cytoplasmic aconitate hydratase-likeXP_014275296.1 (Halyomorpha halys)E: 0.0; bits = 166092
Vasa intronic gene (VIG)658,838Plasminogen activator inhibitor 1 RNA-binding protein-like isoform X2XP_014292052.1 (Halyomorpha halys)E = 0.0; bits = 64496
Staufen0.147Double-stranded RNA-binding protein Staufen homolog 2 isoform X5XP_014282526.1 (Halyomorpha halys)E = 0.0; bits = 95696
RNA helicase Belle763,119ATP-dependent RNA helicase bel isoform X2XP_014279436.1 (Halyomorpha halys)E = 0.0; bits = 137797
Protein arginine methyltransferase 7 (PRMT)244,103Protein arginine methyltransferase NDUFAF7, mitochondrialXP_014292128.1 (Halyomorpha halys)E = 0.0; bits = 72684
Gawky135,069Protein Gawky isoform X1XP_014288686.1 (Halyomorpha halys)E = 0.0; bits = 280397
Overview of identified genes associated to RISC complex in E. heros.

Nucleases

Exoribonuclease 1 (Eri-1) and DNA/RNA non-specific endonuclease (dsRNase) proteins were found in the E. heros transcriptome (Table 4, Supplementary data S4). Eri-1 was found with a 5′-3′ exonuclease N-terminus domain (XRN_N). The dsRNase protein was found with seven isoforms, 1, 3, 4, 6, 7, 9 and 10 with 0.17, 0.30, 0.46, 702,558, 719,814, 292,033 and 280,771 TMP, respectively. The isoforms presented a DNA/RNA non-specific endonuclease (Endonuclease_NS) conserved domain, except the isoform 3, which did not show any conserved domain. Small RNA degrading nuclease 1 (SDN1-like) and Nibbler were found with the 3′-5′ exonuclease conserved domain (Table 4, Supplementary data S4). The phylogenetic analyses revealed distinct clades among nuclease proteins, being the Eri-1, dsRNases, SDN1 and Nibbler grouped in clades together with these proteins from other insect species (Supplementary Fig. S3)
Table 4

Overview of identified genes associated with RNAi in E. heros.

Gene IDTranscripts Per Million (TPM)First hit BLASTpHomologue IDComparisonIdentity (%)
Nucleases
Exoribonuclease 1 (Eri1)388,3585′-3′ exoribonuclease 1XP_014290344.1 (Halyomorpha halys)E = 0.0; bits = 270183
DNA/RNA non-specific endonuclease isoform 10.171Uncharacterized protein LOC106684787XP_024218583.1 (Halyomorpha halys)E: 6e-172; bits = 49083.4
DNA/RNA non-specific endonuclease isoform 30.294Uncharacterized protein LOC106691872XP_014293261.1 (Halyomorpha halys)E = 2e-18; bits = 83.656
DNA/RNA non-specific endonuclease isoform 40.456Uncharacterized protein LOC106684787XP_024218583.1 (Halyomorpha halys)E = 8e-173; bits = 48685
DNA/RNA non-specific endonuclease isoform 6702,558Uncharacterized protein LOC106684787XP_024218583.1 (Halyomorpha halys)E = 4e-170; bits = 48683.4
DNA/RNA non-specific endonuclease isoform 7719,814Uncharacterized protein LOC106684787XP_024218583.1 (Halyomorpha halys)E = 4e-170; bits = 48683
DNA/RNA non-specific endonuclease isoform 9292,033Uncharacterized protein LOC106684787XP_024218583.1 (Halyomorpha halys)E = 5e-170; bits = 48683
DNA/RNA non-specific endonuclease isoform 10280,771Uncharacterized protein LOC106684787XP_024218583.1 (Halyomorpha halys)E = 7e-172; bits = 49083
Small RNA degrading nuclease 1 (SDN1-like)66,023Uncharacterized exonuclease C637.09 isoform X1XP_014279339.1 (Halyomorpha halys)E = 0.0; bits = 89575
Nibbler743,764Exonuclease mut-7 homologXP_024216394.1 (Halyomorpha halys)E = 0.0; bits = 140284
Antiviral
Ars2149,588Serrate RNA effector molecule homolog isoform X1XP_014277995.1 (Halyomorpha halys)E = 0.0; bits = 152398
NinaC0.352Neither inactivation nor after potential protein CXP_014281724.1 (Halyomorpha halys)E = 0.0; bits = 52595
Beta 1,4-mannosyltransferase (egh)262,137Beta-1,4-mannosyltransferase eghXP_014283435.1 (Halyomorpha halys)E = 0.0; bits = 91497
CG4572420,293Venom serine carboxypeptidase-likeXP_014280828.1 (Halyomorpha halys)E = 0.0; bits=85789
Intracellular transport
Vacuolar H+ ATPase sub unit A (vha68)0.437V-type proton ATPase catalytic subunit AXP_014272529.1 (Halyomorpha halys)E = 0.0; bits=125099
Vacuolar H+ ATPase sub unit C (vha16)63,065V-type proton ATPase 16 kDa proteolipid subunitXP_014275063.1 (Halyomorpha halys)E = 4e-100; bits = 28999
Small Rab GTPases206,763Ras-related protein Rab-7aXP_014286452.1 (Halyomorpha halys)E = 3e-152; bits = 42599
Overview of identified genes associated with RNAi in E. heros.

Antiviral RNAi

The search for proteins related to the antiviral RNAi resulted in four protein sequences: Ars2, ninaC, a seven transmembrane-domain glycosyltransferase, Egghead (egh)[47], and the CG4572 protein (Table 4, Supplementary data S5). The phylogenetic analyses revealed distinct clusters for the four antiviral RNAi proteins (Supplementary Fig. S4).

Intracellular transport

Three sequences related to intracellular transport were found: Vacuolar H+ ATPase subunit A (vha68), Vacuolar H+ ATPase subunit C (vha16) and the Small Rab GTPases (Table 4, Supplementary data S6).

Ex vivo dsRNA hemolymph degradation

The dsRNA stability in the hemolymph was assessed at 0, 1, 10, 30, 60 and 120 min of incubation. After 10 min of incubation, the dsRNA-V-ATP-A was partially degraded, as the gel showed a smear below the band, clearly demonstrating dsRNA degradation (Supplementary Fig. S5). At 30 and 60 min of incubation we observed increased degradation, with all dsRNA degraded after 120 min incubation.

Mortality of E. heros by dsRNA microinjection

Mortality was assessed at 24, 48, 72 and 96 h post-microinjection of dsRNA-V-ATP-A (Fig. 3). At 24 h, there was 7% mortality and this increased to 19% at 48 h, 28% at 72 h, and at 96 h 35% of the treated insects were killed. Alongside the mortality in dsRNA-V-ATP-A treated E. heros, reduced mobility was observed compared to the insects microinjected with dsRNA-GFP, which were very active. These mobility effects lasted until 72 h., with a recovery in the mobility at 96 h post microinjection.
Figure 3

V-ATPase subunit A gene silencing mortality effects on Euschistus heros. Mortality after microinjection with dsRNA targeting V-ATPase-A (dsRNA-V-ATP-A) (24–96 h) expressed in percentage. Mortality in adults microinjected with dsRNA-V-ATP-A was normalized against the insects microinjected with dsRNA-GFP.The columns represent the mean ± SE. (N = 50).

V-ATPase subunit A gene silencing mortality effects on Euschistus heros. Mortality after microinjection with dsRNA targeting V-ATPase-A (dsRNA-V-ATP-A) (24–96 h) expressed in percentage. Mortality in adults microinjected with dsRNA-V-ATP-A was normalized against the insects microinjected with dsRNA-GFP.The columns represent the mean ± SE. (N = 50).

Gene expression of V-ATPase-A, and DCR-2 and AGO-2 in E. heros

The V-ATPase-A transcripts level gradually decreased following dsRNA treatment over time (14% to 74% from 24 h to 48 h, respectively) (Fig. 4). At 72 h and 96 h, there was an increase in the relative transcript levels, with ~40% reduction in gene expression, but despite this, these values were still significantly lower than the control (dsRNA-GFP-microinjected) insects (p-values <0.001 and 0.014, respectively) (Fig. 4).
Figure 4

Effects of dsRNA targeting V-ATPase subunit A (dsRNA-V-ATP-A) on the relative levels of gene expression in E. heros. Four days old adults of E. heros microinjected with ~28 ng/µL per mg body weight. The adults were sampled at 24, 48, 72 and 96 h post-microinjection at both treatments. Gene expression was normalized against positive controls that were exposed to gfp dsRNA (dsRNA-GFP) (control). The bars represent the mean ± SE based on 3 biological repeats. The p-values were calculated by an unpaired t-test. Bars with different letters indicate that the treatments differed significantly at that time point with p ≤ 0.05 (N = 50).

Effects of dsRNA targeting V-ATPase subunit A (dsRNA-V-ATP-A) on the relative levels of gene expression in E. heros. Four days old adults of E. heros microinjected with ~28 ng/µL per mg body weight. The adults were sampled at 24, 48, 72 and 96 h post-microinjection at both treatments. Gene expression was normalized against positive controls that were exposed to gfp dsRNA (dsRNA-GFP) (control). The bars represent the mean ± SE based on 3 biological repeats. The p-values were calculated by an unpaired t-test. Bars with different letters indicate that the treatments differed significantly at that time point with p ≤ 0.05 (N = 50). The involvement of the siRNA machinery in the gene silencing mechanism was assessed through a qRT-PCR analysis of DCR-2 and AGO-2 genes (Fig. 5). The relative transcript levels of DCR-2 were significantly higher in the insects microinjected with dsRNA-V-ATP-A compared to the controls (not exposed to dsRNA), with the highest DCR-2 expression level observed at 72 h post microinjection and with an increase of ~2.0-fold (Fig. 5A). At 96 h, relative transcript levels of DCR-2 dropped to ~1.5-fold, still higher than the controls. The expression pattern of AGO-2 behaved similarly as we saw for DCR-2 (Fig. 5B). At 48 and 72 h post-microinjection, the relative transcript levels of AGO-2 were higher with almost a 4.0-fold increase compared to the control samples.
Figure 5

Effects of dsRNA targeting V-ATPase subunit A (dsRNA-V-ATP-A) on the relative levels of (A) Dicer 2 (DCR-2) and (B) Argonaute 2 (AGO-2) gene expression in E. heros. Four days old adults of E. heros were microinjected with ~28 ng/µL per mg body weight. The adults (12 in total) were sampled at 24, 48, 72 and 96 h post-microinjection. Gene expression was normalized against negative control that was not exposed to dsRNA. The bars represent the mean ± SE based on 3 biological repeats. The p-values were calculated by an unpaired t-test. Bars with different letters indicate that the treatments differed significantly at that time point with p ≤ 0.05 (N = 50).

Effects of dsRNA targeting V-ATPase subunit A (dsRNA-V-ATP-A) on the relative levels of (A) Dicer 2 (DCR-2) and (B) Argonaute 2 (AGO-2) gene expression in E. heros. Four days old adults of E. heros were microinjected with ~28 ng/µL per mg body weight. The adults (12 in total) were sampled at 24, 48, 72 and 96 h post-microinjection. Gene expression was normalized against negative control that was not exposed to dsRNA. The bars represent the mean ± SE based on 3 biological repeats. The p-values were calculated by an unpaired t-test. Bars with different letters indicate that the treatments differed significantly at that time point with p ≤ 0.05 (N = 50).

Discussion

The Neotropical stinkbug E. heros is one of the most important soybean pests in Brazil, Argentina, and Paraguay, and the current lack of genetic information is among the factors limiting the prospects of RNAi as an alternative control approach. The RNAi pathway works primarily through dsRNA uptake, intracellular dsRNA transport, dsRNA processing to sRNA, RISC complex formation and binding, and digestion/repression of the target mRNA[48]. Based on our currently reported E. heros transcriptome database, most of the genes involved in these processes above and related to RNAi pathways, are also present in the E. heros transcriptome (Tables 1–4). However, it is important to note that although these genes are involved in the RNAi process in other organisms, it does not mean that they play the same role in the RNAi mechanism in E. heros, and the real involvement of these genes needs to be further confirmed in future functional assays. To achieve gene silencing through RNAi, dsRNA is taken up by the tissue/cell. In eukaryote organisms, this process occurs through sid-like transmembrane proteins[25,49] or endocytosis-mediated uptake[24,25]. Before Sid-like homologous proteins have been found in Coleoptera, Hymenoptera, Lepidoptera, and Hemiptera, but not in Diptera[49]. Also in the E. heros transcriptome, sid-like homolog genes were not found. In Drosophila (Diptera: Drosophilidae), with the lack of sid-like homolog genes, the dsRNA uptake occurs via endocytosis-involving scavenger receptors[23,24]. Indeed previous work demonstrated that the Scavenger protein is involved in endocytic dsRNA uptake in insects[23,24,50] and other organisms, such as mites[19,51,52]. The Chc protein, which is related to an alternative mechanism for endocytic dsRNA uptake in insects[23-26], was found in the E. heros transcriptome. Consequently, with the absence of sid-like genes in the E. heros transcriptome, we believe that the Chc protein may be involved in cellular uptake in E. heros; however the involvement of this protein in dsRNA uptake needs to be proven in future functional assays. In addition, future experiments need to investigate the importance of endocytosis in E. heros. Core RNAi machinery genes were also searched for in the E. heros transcriptome with focus on the miRNA, siRNA and piRNA pathways (Table 2), and most of these were present with the absence of a RNA-dependent RNA polymerase (RdRP) gene. The lack of RdRP was generally expected because, so far, it has been reported only in ticks, plants and in the nematode Caenorhabditis elegans (Rhabditida: Rhabditidae)[53]. The main core domains of Dicer are well known due to their involvement in dsRNA cleavage into small RNA molecules (sRNAs), including miRNAs and siRNAs. In the current work, the DCR-1 protein, which is related to the miRNA pathway, contains a PAZ domain, two RNaseIII domains, and a DSRBD, however no conserved domains for helicase were identified. For DCR-2, two isoforms with distinct structures and abundances were identified. The DCR-2 isoform 1 was the most abundant and showed a helicase domain, a PAZ domain, two RNaseIII domains, and a DSRBD[54,55]. The PAZ domain holds a binding pocket for the 3′ overhang of dsRNA substrate and a phosphate-binding pocket that recognizes the phosphorylated 5′ end of small RNAs[56,57]. The two RNaseIII domains are the catalytic core components of Dicer and responsible for the cleavage of the dsRNA substrate[58]. The function of the helicase domain remains unclear, but so far it is known that this domain is required to process siRNA but not miRNA[56]. In flies, the loss in the functionality of DEAD/Helicase domain is related to a particular function in the miRNA-based gene regulation[56]. We hypothesize here that the loss of the helicase domain in the DCR-1 protein in E. heros may be a functional adaptation, related to the miRNA pathway, but this needs to be further investigated. The canonical conserved domains of DCR-2 isoform were not identified in E. heros. Similarly, DCR-2 isoforms with the lack of conserved domains were also identified in mammals[59,60] as well as in Arabidopsis thaliana[61]. Due to the lack of important functional domains it is expected that these DCR-2 variants may not be involved in the siRNA pathway, however the function of these isoforms in insects still remains unclear. To our knowledge, this is the first report of DCR-2 variants in insects. It would be interesting in the future to investigate the role of DCR variants in cellular processes. In other insects such as Cylas puncticollis (Coleoptera: Curculionidae), N. lugens, D. v. virgifera, L. decemlineata, Drosophila and Tribolium, DCR-1 and DCR-2 are also present[31,48,62,63]. In Drosophila the involvement of DCR-1 and DCR-2 is well established in the miRNA and siRNA pathways[62]. In the piRNA pathway, there is no evidence of a dsRNA precursor and the need of DCR endonucleases[64-66]. Drosha protein was identified with two RNaseIII domains plus a RIBOc[54] and with some similar features to Dicer, although it processes miRNA precursors in the nucleus[17]. The dsRNA-binding proteins Pasha, Loquacious and R2D2, which mediate dsRNA binding to the RISC complex, are among the other proteins from the DCR superfamily identified in E. heros. These proteins are cofactors required to interact with the RNaseIII genes Drosha, DCR-1, and DCR-2, respectively[31,62] (Table 2). Five members belonging to the Argonaute superfamily were identified in the E. heros transcriptome as follows: AGO-1 and AGO-2 which belong to Argonaute subfamily, and AGO-3, Aubergine (Aub) and Piwi, which belong to the PIWI subfamily[67,68]. AGO-1 is an essential protein related to the miRNA pathway, and AGO-2 is related to the siRNA pathway[68,69]. More recently, two new functions have been attributed to AGO-1 and AGO-2 in early Drosophila melanogaster embryos: the generation of polarity within cells and tissues by modulating an important cell-cell signaling pathway[70]. These proteins are characterized by the presence of PAZ and PIWI domains, which guide sRNA recognition and binding, supporting endonucleolytic cleavage[71]. The PAZ domain forms a pocket for siRNAs binding and, specifically, the characteristic two nucleotides (nt) 3′ overhangs, trimmed by Dicer proteins, while the PIWI domain shares structural similarities with ribonucleases and degrades the corresponding RNAs[72-74]. The lack of a PAZ functional domain in the AGO-2 isoform 2 raises the hypothesis that this isoform may be related in another biological process, as mentioned above for the DCR-2 isoforms. In the shrimp Marsupenaeus japonicus (Decapoda: Penaeidae), three AGO-1 isoforms have been identified, and interestingly, two isoforms were more expressed in the lymphoid organ, suggesting a role in immunity[75]. The presence of multiple isoforms of AGO-1 and AGO-2 may indicate a role of AGO in many biological processes, including cell proliferation/differentiation, immune defense, among others[75]. AGO-3, Aub, and Piwi are proteins related to the piRNAs pathway[65,68] and they were also found in E. heros (Table 2). Zucchini (Zuc), responsible for piRNA maturation[76] and related to the germline RNAi processes[77], was also identified in the E. heros transcriptome. The identification of both DCR-1 and DCR-2 was confirmed through a phylogenetic analysis using sequences from other insects and revealed distinct groups inside DCR proteins (Supplementary Fig. S1). The E. heros protein DCR-1 was grouped in a clade with DCR-1 proteins from N. viridula and H. halys, showing a common ancestor. The same results were found for E. heros DCR-2. Also, E. heros DCR-1 was grouped in a distinct clade compared to E. heros DCR-2, but with a common ancestor. The phylogenetic analysis for the AGO superfamily resulted in two main clades; one containing the AGO subfamily proteins AGO-1 and AGO-2, and another with the PIWI subfamily proteins AGO-3, Aub and Piwi (Supplementary Fig. S2). E. heros AGO-1 clustered with AGO-1 from N. viridula and N. lugens with the same ancestor. E. heros AGO-2 was assembled in a second group together with other proteins of this family. These two clusters showed a common ancestor. The AGO-3 was clustered in a distinct group, as well as Aub and Piwi proteins. E. heros AGO-3 was grouped with the AGO-3 proteins from H. halys and other insects. Thereby, the phylogenetic analyses were useful to confirm the identification of the core RNAi genes present in the E. heros transcriptome. AGO protein is the core component of the RISC, and guided by the siRNA it promotes mRNA cleavage[72,73]. Next to AGO, other important genes related to RISC were identified in the E. heros transcriptome (Table 3). Tudor-SN (TSN) protein is known to interact with Argonaute proteins in the silkworm Bombyx mori (Lepidoptera: Bombycidae)[78], while Translin and TRAX, that are conserved subunits of the C3PO, are involved in RISC activation, supporting RNAi activity[79]. The Armi, Spn-E, Maelstrom and Hen-1 nucleases are involved in piRNA biogenesis[31]. Maelstrom mutations in Drosophila ovaries resulted in a depletion of Dicer and AGO-2 proteins, the latter two being related to the RNAi pathways[80]. Elp-1, that is also present in E. heros, is a component of the polymerase II elongator complex, and although the absence of this protein in Drosophila S2 cell lines did not affect the miRNA pathway, it can cause an inhibition of the siRNA pathway[81]. The Vasa intronic gene (VIG), that encodes a putative RNA-binding protein through association with RISC[82], and related to the production of piRNAs[83], was also identified in the E. heros transcriptome. The Gawky protein, a cytoplasmic mRNA component necessary in early embryonic development[84], Staufen (STAU), a DSRBP, and CLIP-associating protein (Clp-1), that is responsible for the phosphorylation of the 5′ end of siRNAs[85] and related to the splicing process of transfer RNAs[86], were all also found in the E. heros transcriptome of this study. The PRP16 protein plays a role in the pre-mRNA processing[87], while Belle has a function in the endo-siRNA pathway[88]. The proteins GLD-1 and ACO-1, known to inhibit translation of mRNA into protein[81], were also identified in E. heros. Nucleases (RNases together with other RNA enzymes) function in DNA/RNA digestion in the midgut[89] and offer an additional defense and regulatory control layer. The activity of nucleases in dsRNA degradation (dsRNases) is well known, taken an important role in RNAi efficiency across insect groups such as Hemiptera[39,41,90], Lepidoptera[91,92], and Diptera[38]. Four nucleases were identified in the E. heros transcriptome: Eri-1, Nibbler, SDN1, and dsRNase (Table 4; Supplementary Fig. S3). The Eri-1 nuclease is suggested to play a role in the intracellular siRNA and miRNA pathways[93]. In C. elegans, Eri-1 forms a complex with Dicer, generating specific classes of siRNAs, while in mouse, Eri-1 negatively regulates the global abundance of miRNA[93]. Nibbler, an exonuclease known to be involved in shaping the 3′end of the miRNAs, and its depletion leading to developmental defects in Drosophila[94], was found with conserved domains in E. heros. Another intracellular nuclease found in E. heros was SDN1. In Arabidopsis, this protein is involved in the degradation of mature miRNA, and the knockdown resulted in developmental defects[94]. However, the involvement of the Eri-1, Nibbler, and SDN1 in RNAi efficiency in insects remains unclear. In E. heros we also identified a dsRNase gene with seven isoforms and with a conserved Endonuclease_NS domain associated with the degradation of foreign dsRNA molecules[38]. In B. mori three dsRNases isoforms were identified and expressed in different tissues, such as epidermis, fat body, and gut; these dsRNases are related to the innate immune response against invasive nucleic acids[92]. The presence of a dsRNase nuclease with seven isoforms may indicate that E. heros has a strong nuclease activity, so this may result in a lower potential to suppress the expression of target genes and so in turn a lower RNAi response. In the current work, we identified some genes related to antiviral RNAi as follows: Ars2, a gene related to RISC regulation, ninaC, a gene associated with vesicle transport, and a seven transmembrane-domain glycosyltransferase, egh[47] (Table 4; Supplementary Fig. S4). These genes are known to be involved in antiviral defense in Drosophila[47,95]. The CG4572 gene was also identified in E. heros; it is a carboxypeptidase with unknown function, but related to RNAi in D. melanogaster[47]. Three genes involved in intracellular transport were also identified. Two vacuolar H+ adenosine triphosphatases (V-ATPases) genes were identified in the E. heros transcriptome: V-ATPase subunit A (vha68) and V-ATPase subunit C (vha16). These genes are located at different functional V-ATPase domains, the peripheral domain (V1) and the integral domain (V0)[96], respectively, and they are related to dsRNA release by the endocytic vesicles[23]. The Small Rab GTPases and vha68 are essential signaling components linked to the extracellular part with the cytoplasm in L. decemlineata[25,48]. The presence of some genes in E. heros suggests that it has an active and functional RNAi machinery. However, the lack of sid-like gene and the presence of nuclease raise the concern about the RNAi efficiency. So, we first checked the stability of a dsRNA molecule in the hemolymph of adults in which it was rapidly degraded. After 10 min, the dsRNA-V-ATP-A was partially degraded, with increasing dsRNA degradation over time up to 120 min (Supplementary Fig. S5B). In a similar experiment with the pea aphid A. pisum, dsRNA was completely degraded after 3 h incubation and this was associated with the lack of RNAi responses in this species[41]. In E. heros, dsRNA was completely degraded after 2 h of incubation with watery saliva[97]. Indeed, high nuclease activity in the hemolymph and saliva of E. heros may reduce RNAi efficiency and so some form of dsRNA protection may be needed for future field applications. To confirm the effectivity of the E. heros RNAi machinery, a dsRNA targeting the V-ATPase-A gene was microinjected into adults. Previously, targeting the V-ATPase-A gene led to mortality in Pectinophora gossypiella (Lepidoptera: Gelechiidae)[98], E. heros nymphs[97], A. pisum[99], H. halys nymphs[42], among others. The main V-ATPase function is the pumping of protons across the membrane[100,101], generating an energy gradient. E. heros adults were microinjected with ~28 ng of dsRNA-V-ATPase-A per mg of insect fresh weight, and the mortality was evaluated at 24, 48, 72 and 96 h after microinjection. At 24 h post-microinjection, there was 7% mortality and this increased to 35% at 96 h (Fig. 3). The same dsRNA concentration previously demonstrated to cause up to 50% mortality in E. heros 2nd instar nymphs 7 days post-microinjection[97]. Based on these results, we believe that this species is sensitive to RNAi when we compare to other insects also considered sensitive to RNAi. Fishilevich and collaborators[102] used the same dsRNA concentration through microinjection in E. heros adults targeting chromatin remodeling genes and this significantly reduced fecundity and egg viability. Coleoptera insects are considered to be more sensitive to RNAi, presenting a robust RNAi mechanism, while Lepidoptera and Hemiptera appear to be more recalcitrant[103]. Second-instar larvae of the African sweet potato weevil C. puncticollis were microinjected with 200 ng/mg of body weight targeting different genes, and mortality reached up to ~50% after six days[104]; this concentration is ~9 times higher than that one used in E. heros. One of the main reasons associated with the lack of RNAi response in the C. puncticollis weevil was the high nuclease activity[104,105]. In the pink bollworm, P. gossypiella, microinjection of 20 ng/mg of body weight of a dsRNA targeting V-ATPase-A induced mortality up 26% at 96 h post-microinjection in 3rd-instar larvae[98]. One strategy to increase RNAi efficiency is an adequate formulation of the dsRNA molecules. In E. heros nymphs, liposome-encapsulated dsRNA targeting V-ATPase-A led to 45% mortality after 14 days as compared to 30% with naked dsRNA[97]. Similar results were found for dsRNA α-tubulin and lipoplexes in the German cockroach, Blattella germanica (Blattodea: Blattellidae)[106]. Therefore, the formulation of dsRNA may provide an affordable non-transformative easy-to-use strategy to deliver gene silencing for pest control in the field. However, for successful pest control, it is very important to know the dsRNA concentration, expressed as per mg of insect body weight, to permit a rationalized pest control strategy based on dsRNA concentration and the delivery approach. Alongside the mortality, other effects were also observed. The treated insects exhibited reduced mobility in contrast to the insects microinjected with dsRNA-GFP which were very active. This effect lasted until 72 h post-microinjection. Retardation in larval development was reported in P. gossypiella[98] and Helicoverpa armigera (Lepidoptera: Noctuidae)[107] treated with dsRNA targeting the V-ATPase. To confirm that the observed mortality in E. heros injected with dsRNA-V-ATPase-A is a true phenotype of gene silencing, a qRT-PCR assay was performed. Indeed we confirmed the V-ATPase-A gene silencing with a reduction of 74% in the relative level of transcripts. At 72 and 96 h post-microinjection, there is an increase in gene expression but still 40% lower compared to the insects treated with GFP (Fig. 4). An increase in DCR-2 and AGO-2 gene expression was observed with the highest gene expression observed at 48 and 72 h, with a respective increase of ~2.0 and ~4.0-fold, so confirming the activation of the siRNA machinery upon exogenous dsRNA delivery (Fig. 5A,B). This data has shown the activity of the siRNA machinery in E. heros through the supply of dsRNA. As expected, due to the high nuclease activity, the RNAi effects were temporary, and at 72 and 96 h, there was a recovery in the relative transcript levels from the target genes. Also, at 96 h post-microinjection, there was a reduction in the expression of the siRNA-related genes. In Manduca sexta (Lepidoptera: Sphingidae), an upregulation of DCR-2 and AGO-2 expression in response to injection with dsRNA with also only transient effects in the gene upregulation was reported[108]. As discussed above, DCR-2 and AGO-2 are core components of the siRNA pathway, and the overexpression of DCR-2 and AGO-2 after dsRNA microinjection confirmed the upregulation of the siRNA machinery. Over the past year, scientists have made enormous progress towards the use of RNAi as a pest control strategy taking advantage of genetic sequences available in public databases, and used this information to understand the RNAi mechanism in insects. To our knowledge, this is the first study of E. heros transcriptome, including the identification of RNAi-related genes and dissecting the siRNA pathway. The analyses of the E. heros transcriptome have identified the main components of the three RNAi pathways with the surprising lack of sid-like genes. Identification of the core RNAi genes, efficient mortality rates and activation of the siRNA machinery, these data provide a novel and important dataset on RNAi machinery and its efficiency, underpinning future strategies to enhance RNAi in E. heros and potentially other piercing-sucking insects as models or species important in agriculture.

Material and Methods

Brown stink bug insects

The colony of E. heros was originally started with insects collected in Pelotas, Brazil (27°48′1.7352″ S; 52°54′3.834″W) in 2013, and kept for about 73 generations under laboratory conditions before experiments. New insects collected in soybean fields in Rondinha, Brazil (27°48′1.7352″ S; 52°54′3.834″ W) were introduced in the laboratory colony in 2015. All stages were maintained in plastic cages under laboratory conditions with a photoperiod of 14:10 (Light: Dark), temperature of 25 ± 1 °C and 75 ± 10% relative humidity. Green beans, peanut and water were supplied ad libitum and replaced twice in a week. Eggs were collected twice a week to obtain the insects necessary for microinjection and colony maintenance[109]. Insects were collected every day and insects of four days old were used in the microinjection assays.

cDNA libraries, Illumina sequencing and de novo assembly

Eggs, all nymphal stages and adults of E. heros were used for total RNA extraction using the Trizol reagent (Invitrogen, Carlsbad, CA, USA), according to the manufacturer instructions. The RNA pool was prepared with an equally RNA amount from all stages, and the cDNA library preparation and Illumina sequencing were conducted at the Laboratory of Functional Genomics Applied to Agriculture and Agri-Energy, at the University of São Paulo, Brazil. The TruSeq RNA Sample Prep kit (Illumina) protocol was used to construct the cDNA library, following manufacturer instructions. A high-throughput Illumina sequencing platform (HiSeq. 2000) was used for the final library sequencing, in one lane of a 100 bp paired-end run. The raw reads originating from the Illumina sequencing were check for quality using the FastQC software (http://www.bioinformatics.babraham.ac.uk/projects/fastqc). After that, reads were trimmed using Trimmomatic[110], and only high-quality reads, showing a Phred score superior to 30, were used for the de novo assembly to generate a set of contigs using Trinity software (http://trinityrnaseq.sourceforge.net)[111]. De Bruijn graph algorithm and a k-mer length of 25 were used as parameters.

Homology search and gene ontology annotation

The generated contigs were analyzed using the UniProt-TrEMBL database[112] via Diamond algorithm[113], with an E-value<10−5 as a cut-off parameter. The contigs with insect hits were submitted to a second homology search using QuickGO to identify gene ontology (GO) terms. For this annotation, a similarity search was performed against the UniProt database using Diamond, with an E-value<10−5 as a cut-off parameter. The QuickGo from EBI (https://www.ebi.ac.uk/QuickGO/annotations) was used to calculate the GO terms, using the generated gene identifiers as inputs.

RNAi-related genes

We searched for the genes related to RNAi efficacy and these included genes on dsRNA uptake (Table 1), RNAi core machinery (Table 2), auxiliary factors (Table 3), nucleases, antiviral RNAi and intracellular transport (Table 4)[31,33,48]. Homologous sequences for these proteins were searched in UniProt or Protein database from NCBI, and we used as a query to search the E. heros transcriptome using the tBLASTn tool from NCBI. Generated contigs with a bitscore>150 and E-value <1e-5 were further used to confirm the identity. To detect the open reading frames (ORFs) in the contigs sequence, the ORF Finder from NCBI was used (https://www.ncbi.nlm.nih.gov/orffinder/), and the protein domains predicted by the NCBI Conserved Domains Database (https://www.ncbi.nlm.nih.gov/Structure/cdd/wrpsb.cgi). Protein Basic Local Alignment Tool (Protein BLAST) was used for protein homology search against insect non-redundant protein database at NCBI. To provide additional confirmation on identity and function prediction of the core RNAi proteins, nucleases and antiviral RNAi, members of these groups of proteins were subject to a phylogenetic analysis using the neighbor-joining (MEGA 7.0.26) algorithm with 1,000 bootstrap replicates. A total of 39 Argonaute superfamily protein sequences, 30 endoribonuclease III protein sequences, 25 nuclease protein sequences, and 27 antiviral RNAi sequences were aligned using the MUSCLE program from MEGA 7.0.26 software. ORF Finder from NCBI was used to predict the proteins.

dsRNA synthesis and purification

Specific primers were used to amplify the fragments of the target genes (Table 5). The cDNA was synthesized using the SuperScript First-Strand Synthesis System Kit (Invitrogen) following the manufacturer’s instructions. The T7 primer sequence (TAATACGACTCACTATAGGGAGA) was placed in the front of the forward and reverse primers. These primers were used for dsRNA synthesis with cDNA as a template. The PCR reaction was performed with 2 µl of cDNA template, 2 µl of a 10 µM solution of each primer (Integrated DNA Technologies, Coralville, IA, USA), 0.125 µl of Taq DNA polymerase, 2.5 µl of Buffer 10×X, 0.5 µl of 10 µM dNTPs, 0.75 µl of MgCl2 (Invitrogen) and 15.125 µl of nuclease-free water (GE Healthcare, Little Chalfont, UK) in a total volume of 25 µl. The PCR conditions used were 5 min at 94 °C for initial denaturation, followed by 30 s at 94 °C, 45 s at 59.5 °C, 55 s at 72 °C for 30 cycles and final extension for 10 min at 72 °C. The amplified products were purified using a PCR purification kit (Qiagen, Valencia, CA, USA) and analyzed on 1% agarose gels. The PCR product was quantified using a Nanovue spectrophotometer (GE Healthcare) and then samples were stored at −20 °C.
Table 5

Primers used in qRT-PCR and dsRNA synthesis.

Gene namePrimerSequence (5′-3′)Product size (bp)Amplification factor
qRT-PCR18 s ribosomal RNArp18SrRNA-FTACAACAAGACAACGCTCGC1502.070.997
rp18SrRNA-RTTGCGCTCAGTGACATCTCT
Ribosomal protein L32erprpl32-FTCAGTTCTGAGGCGTGCAT1752.150.992
rprpl32-RTCCGCAAAGTCCTCGTTCA
V-ATPase subunit ArpdsRNA-V-ATP-A-FGATTATGGTCGTGCGATTTC1021.930.998
rpdsRNA-V-ATP-A-FGAACACCAGCTCTCACTAA
Dicer 2rpDCR2-FGAAGCAGGATAACCTCCTAA1561.941
rpDCR2-RGGATGCAATTGTTCTACTGGA
Argonaute 2rpAGO2-FGACCATCTCCACAACAAATG1131.970.994
rpAGO2-RGTCAGAGGATTGAGGTCTAATA
dsRNA synthesisV-ATPase subunit AdsRNA-V-ATP-A-FTAATACGACTCACTATAGGGAGACAGGTTTCGACCAATGCCAA623
dsRNA-V-ATP-A-RTAATACGACTCACTATAGGGAGAACCTCAGAACACCAGCTCTC
Green Fluorescent ProteindsRNA-GFP-FTAATACGACTCACTATAGGGAGATCGTGACCACCCTGACCTAC560
dsRNA-GFP-RTAATACGACTCACTATAGGGAGATCGTCCATGCCGAGAGTGAT
Primers used in qRT-PCR and dsRNA synthesis. The V-ATPase-A dsRNA was synthesized using the MEGAscript T7 RNAi kit (Ambion, Austin, TX, USA) following the manufacturer’s instructions. The control group consisted of a dsRNA of the green fluorescent protein (dsRNA-GFP) synthesized from a DNA plasmid (pIG1783f) and cloned in Escherichia coli (DH5α). Plasmid DNA was extracted and sequenced to confirm the identity of PCR products. The identity of the sequence was confirmed by Sanger sequencing. The dsRNA was analyzed for integrity on 1% agarose gels, its concentration quantified in a Nanovue spectrophotometer (GE Healthcare) and then stored at −20 °C.

Ex vivo dsRNA hemolymph degradation assay

Insects were anesthetized with CO2 during ~30 s and then taped with the abdomen upwards on a glass plate. Legs and rostrum were cut, and hemolymph collected by a needle, prepared with glass capillary tubes, coupled to an insulin syringe (8 ×X 0.30 mm) and placed in chilled 1.5 ml tubes containing phenylthiourea (PTU) to prevent melanisation. After that, 30 µl of dsRNAs-V-ATPase-A solution at 200 ng/µl was incubated in 3 µl of RNase-free water or 3 µl of hemolymph at 25 °C. Aliquots of 5 µl were collected after 0, 1, 10, 30, 60, and 120 min, and the same volume of EDTA (10 mM) was added to the solution to stop the enzymatic reaction[41]. The integrity of the samples was analyzed on 1% agarose gel.

Adult microinjection

To silence the V-ATPase-A gene in E. heros, dsRNA-V-ATP-A with 623 bp was microinjected in adults (~60 mg) at the concentration of ~28 ng per mg of body weight (0.50 µl of a 3350 ng/µl dsRNA solution)[102]. The control group consisted of insects microinjected with a 560 bp dsRNA molecule targeting GFP[31,104]. The dsRNA-V-ATP-A was designed to have a length similar to the one used in previous RNAi assays in the hemipterans D. citri[43] and N. lugens[114]. To perform the microinjection, insects were anesthetized with CO2 and immobilized in a glass plate with double-sided tape (3 M, São Paulo, Brazil). The microinjection was performed using an insulin syringe (8 ×x 0.30 mm) with a needle (30 g) (Solidor) coupled to a micro-applicator (Burkard, Rickmansworth, UK). In total, 62 adults were injected per treatment, of which 12 individuals were used for qRT-PCR and 50 individuals for mortality assay, at 24, 48, 72 and 96 h post-microinjection. Alongside mortality analysis, visual observations were carried out to analyze other effects related to the dsRNA in the insects. After microinjection, the insects were placed in plastic cages containing green beans, peanut and water ad libitum, and kept at 25 °C, photoperiod of 14:10 (L:D) and 75 ± 10% RH, as with the colony maintenance. The insect mortality was normalized against the control (dsRNA-GFP).

Quantitative reverse-transcription polymerase chain reaction (qRT-PCR)

Total RNA was extracted from whole insect body at 24, 48, 72 and 96 h after microinjection, and each time point had three biological samples containing one insect. RNA extraction was performed using RNAzol RT (MCR, Cincinnati, OH, USA), following the manufacturer’s instructions. The samples were quantified using a Nanovue spectrophotometer (GE Healthcare), verified in a 1% agarose gel electrophoresis, and kept at −80 °C. First-strand cDNA synthesis proceeded as described in the dsRNA synthesis and purification section. The qRT-PCR was performed on a Roche LightCycler 480 (LC480) (Roche Diagnostics, Basel, Switzerland) real-time PCR platform. To validate the primers used in the analysis (Table 5), a melting curve analysis with temperatures from 60 to 95 °C and a standard curve based on a serial dilution of cDNA were used to determine the primer annealing efficiency and specificity. The reaction included 6 µl of EvaGreen 2X qPCR MasterMix (ABM, Milton, ON, Canada), 1.25 µl of 10 µM forward primer (Integrated DNA Technologies), 1.25 µl of 10 µM reverse primer (Integrated DNA Technologies), 2.5 µl of nuclease-free water and 2 µl of cDNA, in a total volume of 13 µl. The amplification conditions were 3 min at 95 °C followed by 45 cycles of 30 s at 95 °C, 45 s at 59 °C and 30 s at 77 °C. The reactions were set-up in 96-well microtiter plates (Roche Life Science, Indianapolis, IN, USA), using the cDNA dilution of 1:25 and three technical replicates. The normalization of the data was performed using two endogenous genes, ribosomal protein L32e (rpl32) and 18 s ribosomal RNA (18S rRNA) (Table 5); also an appropriate no template control (NTC) was included. The equation ratio 2−∆∆Ct was used for normalization of the relative gene expression levels[115]. Data were analyzed using analysis of variance (one-way ANOVA) and unpaired t-test (p-value ≤ 0.05).

Ethical approval

This article does not contain any studies with human participants or vertebrate performed by any of the authors Supplementary material.
  85 in total

1.  Evaluation of SmartStax and SmartStax PRO maize against western corn rootworm and northern corn rootworm: efficacy and resistance management.

Authors:  Graham P Head; Matthew W Carroll; Sean P Evans; Dwain M Rule; Alan R Willse; Thomas L Clark; Nicholas P Storer; Ronald D Flannagan; Luke W Samuel; Lance J Meinke
Journal:  Pest Manag Sci       Date:  2017-03-17       Impact factor: 4.845

2.  The next generation of insecticides: dsRNA is stable as a foliar-applied insecticide.

Authors:  Keri San Miguel; Jeffrey G Scott
Journal:  Pest Manag Sci       Date:  2015-07-14       Impact factor: 4.845

3.  Insecticide resistance, control failure likelihood and the First Law of Geography.

Authors:  Raul Narciso C Guedes
Journal:  Pest Manag Sci       Date:  2016-12-05       Impact factor: 4.845

4.  Control of coleopteran insect pests through RNA interference.

Authors:  James A Baum; Thierry Bogaert; William Clinton; Gregory R Heck; Pascale Feldmann; Oliver Ilagan; Scott Johnson; Geert Plaetinck; Tichafa Munyikwa; Michael Pleau; Ty Vaughn; James Roberts
Journal:  Nat Biotechnol       Date:  2007-11-04       Impact factor: 54.908

5.  [Occurrence and performance of Euschistus heros (F.) (Heteroptera: Pentatomidae) on alternative host plants in Rio Grande do Sul State, Brazil].

Authors:  Lenice Medeiros; Gabriela A Megier
Journal:  Neotrop Entomol       Date:  2009 Jul-Aug       Impact factor: 1.434

6.  Insecticide susceptibility of Euschistus heros (Heteroptera: Pentatomidae) in Brazil.

Authors:  Daniel R Sosa-Gómez; Jovenil J Da Silva; Ivani de Oliveira Negrao Lopes; Ivan C Corso; Alvaro M R Almeida; Giorla C Piubelli De Moraes; Matrhew E Baur
Journal:  J Econ Entomol       Date:  2009-06       Impact factor: 2.381

7.  An invasive pentatomid pest in Argentina: neotropical brown stink bug, Euschistus heros (F.) (Hemiptera: Pentatomidae).

Authors:  A Saluso; L Xavier; F A C Silva; A R Panizzi
Journal:  Neotrop Entomol       Date:  2011 Nov-Dec       Impact factor: 1.434

8.  RNA interference in Colorado potato beetle: steps toward development of dsRNA as a commercial insecticide.

Authors:  Subba Reddy Palli
Journal:  Curr Opin Insect Sci       Date:  2014-12       Impact factor: 5.186

Review 9.  piRNAs: from biogenesis to function.

Authors:  Eva-Maria Weick; Eric A Miska
Journal:  Development       Date:  2014-09       Impact factor: 6.868

10.  RNA interference-mediated antiviral defense in insects.

Authors:  Don B Gammon; Craig C Mello
Journal:  Curr Opin Insect Sci       Date:  2015-04-01       Impact factor: 5.186

View more
  4 in total

1.  RNAi-induced knockdown of white gene in the southern green stink bug (Nezara viridula L.).

Authors:  Dariane Souza; Shawn A Christensen; Ke Wu; Lyle Buss; Kaylin Kleckner; Constance Darrisaw; Paul D Shirk; Blair D Siegfried
Journal:  Sci Rep       Date:  2022-06-21       Impact factor: 4.996

2.  Silencing of Double-Stranded Ribonuclease Improves Oral RNAi Efficacy in Southern Green Stinkbug Nezaraviridula.

Authors:  Rohit Sharma; Clauvis Nji Tizi Taning; Guy Smagghe; Olivier Christiaens
Journal:  Insects       Date:  2021-01-28       Impact factor: 2.769

3.  RNAi in Piezodorus guildinii (Hemiptera: Pentatomidae): Transcriptome Assembly for the Development of Pest Control Strategies.

Authors:  Claudia Schvartzman; Pablo Fresia; Sara Murchio; María Valentina Mujica; Marco Dalla-Rizza
Journal:  Front Plant Sci       Date:  2022-04-01       Impact factor: 6.627

4.  SfDicer2 RNA Interference Inhibits Molting and Wing Expansion in Sogatella furcifera.

Authors:  Qing-Hui Zeng; Gui-Yun Long; Xi-Bin Yang; Ze-Yan Jia; Dao-Chao Jin; Hong Yang
Journal:  Insects       Date:  2022-07-27       Impact factor: 3.139

  4 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.