| Literature DB >> 32051495 |
Wei Xu1, Yanan Dong1,2, Yongchen Yu2,3, Yuxian Xing2,3, Xiwang Li2,3, Xin Zhang2,3, Xiangjie Hou2,3, Xiaoling Sun4,5.
Abstract
The selection of reliable reference genes (RGs) for normalization under given experimental conditions is necessary to develop an accurate qRT-PCR assay. To the best of our knowledge, only a small number of RGs have been rigorously identified and used in tea plants (Camellia sinensis (L.) O. Kuntze) under abiotic stresses, but no critical RG identification has been performed for tea plants under any biotic stresses till now. In the present study, we measured the mRNA transcriptional levels of ten candidate RGs under five experimental conditions; these genes have been identified as stable RGs in tea plants. By using the ΔCt method, geNorm, NormFinder and BestKeeper, CLATHRIN1 and UBC1, TUA1 and SAND1, or SAND1 and UBC1 were identified as the best combination for normalizing diurnal gene expression in leaves, stems and roots individually; CLATHRIN1 and GAPDH1 were identified as the best combination for jasmonic acid treatment; ACTIN1 and UBC1 were identified as the best combination for Toxoptera aurantii-infested leaves; UBC1 and GAPDH1 were identified as the best combination for Empoasca onukii-infested leaves; and SAND1 and TBP1 were identified as the best combination for Ectropis obliqua regurgitant-treated leaves. Furthermore, our results suggest that if the processing time of the treatment was long, the best RGs for normalization should be recommended according to the stability of the proposed RGs in different time intervals when intragroup differences were compared, which would strongly increase the accuracy and sensitivity of target gene expression in tea plants under biotic stresses. However, when the differences of intergroup were compared, the RGs for normalization should keep consistent across different time points. The results of this study provide a technical guidance for further study of the molecular mechanisms of tea plants under different biotic stresses.Entities:
Mesh:
Substances:
Year: 2020 PMID: 32051495 PMCID: PMC7015943 DOI: 10.1038/s41598-020-59168-z
Source DB: PubMed Journal: Sci Rep ISSN: 2045-2322 Impact factor: 4.379
Ten housekeeping genes frequently used for qRT-PCR of tea plant.
| NO. | Abbreviation | Given conditions | Ref. |
|---|---|---|---|
| 1 | Different organs Nitrogen stress Fe stress | Sun Liu Wang | |
| 2 | Different organs Leaves with Cold and short photoperiod treatments Shoots after auxin antagonist auxinole treatments | Hao | |
| 3 | Diurnal expression in leaves | Hao | |
| 4 | Different maturity of leaves Leaves with Cold and drought treatments Nitrogen stress Drought, cold, Al, and NaCl stresses | Sun Ma Liu | |
| 5 | Different organs | Hao | |
| 6 | In various tea leaf developmental stages | Wu | |
| 7 | Shoots with cold and short photoperiod treatments Mn stress | Hao Wang | |
| 8 | Shoots after auxin antagonist auxinole treatment | Hao | |
| 9 | Physical damages | Ma | |
| 10 | In various tea leaf developmental stages Leaves with hormone treatments Mn stress Post-harvest leaves Posharvest | Wu Wang Zhou |
Sequence Information of the Candidate Reference Genes and Target Genes.
| Name | GeneBank Accession Number | Primer sequence (5′–3′) forward/reverse | Amplicon Length (bp) | qRT-PCR Efficiency (%) |
|---|---|---|---|---|
| KA280301.1 | TTGGACAAGCTCAAGGCTGAACG | 110 | 98 | |
| ATGGCCAGGAGCATCAATGACAGT | ||||
| KA291473.1 | TAGAGCGGGTAGTGGAGACCTCGTT | 129 | 102 | |
| TACCAAAGCCGGCTCGTATGAGATT | ||||
| KA280216.1 | TGGGCCAGAAAGATGCTTATGTAGG | 118 | 103 | |
| ATGCCAGATCTTTTCCATGTCATCC | ||||
| KA295375.1 | TTTTTGGCCTTAGGAACCCAGAGG | 107 | 93 | |
| GGGCAGCAGCCTTATCCTTATCAGT | ||||
| KM057790 | TCCAATTGCCCCCTTAATGACTCA | 109 | 106 | |
| GTAAGGGCAGGCAAACACCAGGTA | ||||
| AT4G34270 | TGGAGTTGGAAGTGGACGAGACCGA | 176 | 103.6 | |
| CTCTGGAAAGTGGGATGTTTGAAGC | ||||
| KA281185.1 | TGCTGGTGGGGTTTTTCTTGTTACC | 124 | 92 | |
| AAGGCATATGCTCCCATTGCTGTTT | ||||
| GAAC01052498.1 | TGACCAAGCACACTCCACACTATCG | 107 | 95 | |
| TGCCCCCTTATCATCATCCACAA | ||||
| JN399223.1 | TCACTGTTTACCCATCTCCC | 167 | 106.1 | |
| GTAGGTGGGTCGCTCAATAT | ||||
| AT1G55520 | GGCGGATCAAGTGTTGGAAGGGAG | 166 | 107.0 | |
| ACGCTTGGGATTGTATTCGGCATTA | ||||
| EF645810 | TAGCGGTTGTGGCGGAGATT | |||
| TGAGCTTCTCTCGCCTCTGC | ||||
| XM_028243785.1 | CGATCAACAGCCGGTGGATTT | |||
| GCGTGGACAGCATCAACCAC | ||||
| D26596.1 | CCAATTCCTTGCCAATCCTGTAAC | |||
| CAACTGCCTCGGCTGTCTTTCT | ||||
| KY615671 | CGGAACAAGGCCTTACATGG | |||
| TGGGCAAACATGAGCTTTCC | ||||
Figure 1Expression Profiles of Ten Candidate Reference Genes and Four Target Genes in C. sinensis. The expression level of RGs in all samples is performed in terms of the cycle threshold number (Ct value). The data are expressed as box-whisker plots; the short bar in the box refers to the Ct mean value; the box represents the 25th–75th percentiles; the median is indicated by a bar across the box; the whiskers on each box represent the distribution of the Ct values; and the dark spots refer to extreme outliers.
Ranking of 10 Reference Genes Expression under Different Experimental Manipulations.
| Group | Rank | geNorm | NormFinder | BestKeeper | ΔCt | RefFinder | |||||
|---|---|---|---|---|---|---|---|---|---|---|---|
| Reference Gene | Stability | Reference Gene | Stability | Reference Gene | Standard Deviation | Reference Gene | Standard Deviation | ||||
| Circadian rhythm of leaf | 1 | 0.243 | 0.160 | 0.366 | 0.885 | 0.333 | |||||
| 2 | 0.243 | 0.201 | 0.367 | 0.894 | 0.353 | ||||||
| 3 | 0.267 | 0.225 | 0.383 | 0.726 | 0.362 | ||||||
| 4 | 0.284 | 0.256 | 0.391 | 0.933 | 0.379 | ||||||
| 5 | 0.308 | 0.274 | 0.396 | 0.858 | 0.395 | ||||||
| 6 | 0.320 | 0.288 | 0.417 | 0.863 | 0.401 | ||||||
| 7 | 0.343 | 0.289 | 0.442 | 0.868 | 0.402 | ||||||
| 8 | 0.357 | 0.296 | 0.469 | 0.891 | 0.408 | ||||||
| 9 | 0.373 | 0.373 | 0.486 | 0.871 | 0.455 | ||||||
| 10 | 0.399 | 0.434 | 0.583 | 0.858 | 0.503 | ||||||
| Circadian rhythm of stem | 1 | 0.208 | 0.184 | 0.241 | 0.559 | 0.492 | |||||
| 2 | 0.208 | 0.253 | 0.264 | 0.819 | 0.525 | ||||||
| 3 | 0.246 | 0.315 | 0.270 | 0.547 | 0.532 | ||||||
| 4 | 0.323 | 0.33 | 0.328 | 0.792 | 0.548 | ||||||
| 5 | 0.347 | 0.334 | 0.331 | 0.577 | 0.552 | ||||||
| 6 | 0.368 | 0.342 | 0.342 | 0.530 | 0.574 | ||||||
| 7 | 0.410 | 0.375 | 0.377 | 0.786 | 0.591 | ||||||
| 8 | 0.443 | 0.376 | 0.467 | 0.869 | 0.604 | ||||||
| 9 | 0.490 | 0.599 | 0.520 | 0.615 | 0.733 | ||||||
| 10 | 0.639 | 1.182 | 0.768 | 0.719 | 1.234 | ||||||
| Circadian rhythm of root | 1 | 0.308 | 0.211 | 0.431 | 0.833 | 0.581 | |||||
| 2 | 0.308 | 0.287 | 0.433 | 0.851 | 0.594 | ||||||
| 3 | 0.367 | 0.323 | 0.454 | 0.878 | 0.609 | ||||||
| 4 | 0.421 | 0.327 | 0.471 | 0.738 | 0.617 | ||||||
| 5 | 0.429 | 0.349 | 0.492 | 0.931 | 0.618 | ||||||
| 6 | 0.451 | 0.459 | 0.520 | 0.909 | 0.680 | ||||||
| 7 | 0.502 | 0.496 | 0.616 | 0.800 | 0.710 | ||||||
| 8 | 0.549 | 0.584 | 0.660 | 0.939 | 0.780 | ||||||
| 9 | 0.638 | 0.885 | 0.814 | 0.387 | 0.995 | ||||||
| 10 | 0.727 | 0.987 | 0.992 | 0.857 | 1.085 | ||||||
| JA treatment | 1 | 0.209 | 0.132 | 0.194 | 0.604 | 0.290 | |||||
| 2 | 0.209 | 0.166 | 0.194 | 0.42 | 0.303 | ||||||
| 3 | 0.221 | 0.213 | 0.196 | 0.625 | 0.325 | ||||||
| 4 | 0.250 | 0.228 | 0.223 | 0.815 | 0.333 | ||||||
| 5 | 0.269 | 0.231 | 0.227 | 0.716 | 0.340 | ||||||
| 6 | 0.281 | 0.234 | 0.269 | 0.893 | 0.342 | ||||||
| 7 | 0.297 | 0.243 | 0.322 | 0.876 | 0.346 | ||||||
| 8 | 0.309 | 0.313 | 0.332 | 0.864 | 0.384 | ||||||
| 9 | 0.329 | 0.325 | 0.379 | 0.868 | 0.400 | ||||||
| 10 | 0.349 | 0.363 | 0.421 | 0.796 | 0.432 | ||||||
| 1 | 0.490 | 0.336 | 0.32 | 0.501 | 0.709 | ||||||
| 2 | 0.490 | 0.515 | 0.412 | 0.184 | 0.777 | ||||||
| 3 | 0.507 | 0.563 | 0.458 | 0.553 | 0.812 | ||||||
| 4 | 0.531 | 0.592 | 0.464 | 0.510 | 0.820 | ||||||
| 5 | 0.541 | 0.617 | 0.465 | 0.453 | 0.848 | ||||||
| 6 | 0.688 | 0.639 | 0.533 | 0.456 | 0.855 | ||||||
| 7 | 0.758 | 0.643 | 0.560 | 0.617 | 0.869 | ||||||
| 8 | 0.792 | 0.682 | 0.571 | 0.558 | 0.872 | ||||||
| 9 | 0.815 | 0.756 | 0.638 | 0.508 | 0.914 | ||||||
| 10 | 0.843 | 0.792 | 0.65 | 0.441 | 0.954 | ||||||
| 1 | 0.275 | 0.201 | 0.560 | 0.892 | 0.574 | ||||||
| 2 | 0.275 | 0.230 | 0.590 | 0.941 | 0.585 | ||||||
| 3 | 0.334 | 0.338 | 0.620 | 0.761 | 0.628 | ||||||
| 4 | 0.420 | 0.347 | 0.630 | 0.891 | 0.643 | ||||||
| 5 | 0.461 | 0.439 | 0.660 | 0.868 | 0.688 | ||||||
| 6 | 0.491 | 0.466 | 0.660 | 0.957 | 0.701 | ||||||
| 7 | 0.542 | 0.566 | 0.700 | 0.494 | 0.773 | ||||||
| 8 | 0.583 | 0.589 | 0.730 | 0.715 | 0.784 | ||||||
| 9 | 0.664 | 0.868 | 0.800 | 0.924 | 0.995 | ||||||
| 10 | 0.743 | 0.947 | 0.860 | 0.894 | 1.058 | ||||||
| Mechanical damage and | 1 | 0.261 | 0.194 | 0.344 | 0.806 | 0.422 | |||||
| 2 | 0.322 | 0.216 | 0.372 | 0.799 | 0.435 | ||||||
| 3 | 0.337 | 0.240 | 0.381 | 0.897 | 0.451 | ||||||
| 4 | 0.343 | 0.279 | 0.382 | 0.862 | 0.460 | ||||||
| 5 | 0.363 | 0.292 | 0.429 | 0.915 | 0.477 | ||||||
| 6 | 0.388 | 0.328 | 0.436 | 0.810 | 0.482 | ||||||
| 7 | 0.420 | 0.374 | 0.447 | 0.801 | 0.513 | ||||||
| 8 | 0.453 | 0.451 | 0.494 | 0.698 | 0.576 | ||||||
| 9 | 0.518 | 0.460 | 0.520 | 0.779 | 0.583 | ||||||
| 10 | 0.261 | 0.709 | 0.616 | 0.537 | 0.775 | ||||||
Figure 2Optimal Number of Reference Genes for the Normalization of C. sinensis under Different Experimental Manipulations. The pairwise variation (Vn/n + 1) was analysed by geNorm software to determine the optimal number of RGs included in the qPCR analysis. Values less than 0.15 indicate that another RG will not significantly improve normalization.
Ranking of 10 Reference Genes Expression in Different Processing Time under Different Experimental Manipulations.
| Analysis Tool | Ranking Order (from the most stable to the least stable) | |||||||||
|---|---|---|---|---|---|---|---|---|---|---|
| 1 | 2 | 3 | 4 | 5 | 6 | 7 | 8 | 9 | 10 | |
| ΔCT | ||||||||||
| BestKeeper | ||||||||||
| Normfinder | ||||||||||
| Genorm | ||||||||||
| Recommended comprehensive ranking | ||||||||||
| ΔCT | ||||||||||
| BestKeeper | ||||||||||
| Normfinder | ||||||||||
| Genorm | ||||||||||
| Recommended comprehensive ranking | ||||||||||
| ΔCT | ||||||||||
| BestKeeper | ||||||||||
| Normfinder | ||||||||||
| Genorm | ||||||||||
| Recommended comprehensive ranking | ||||||||||
| ΔCT | ||||||||||
| BestKeeper | ||||||||||
| Normfinder | ||||||||||
| Genorm | ||||||||||
| Recommended comprehensive ranking | ||||||||||
| ΔCT | ||||||||||
| BestKeeper | ||||||||||
| Normfinder | ||||||||||
| Genorm | ||||||||||
| Recommended comprehensive ranking | ||||||||||
| ΔCT | ||||||||||
| BestKeeper | ||||||||||
| Normfinder | ||||||||||
| Genorm | ||||||||||
| Recommended comprehensive ranking | ||||||||||
| ΔCT | ||||||||||
| BestKeeper | ||||||||||
| Normfinder | ||||||||||
| Genorm | ||||||||||
| Recommended comprehensive ranking | ||||||||||
| ΔCT | ||||||||||
| BestKeeper | ||||||||||
| Normfinder | ||||||||||
| Genorm | ||||||||||
| Recommended comprehensive ranking | ||||||||||
| ΔCT | ||||||||||
| BestKeeper | ||||||||||
| Normfinder | ||||||||||
| Genorm | ||||||||||
| Recommended comprehensive ranking | ||||||||||
| ΔCT | ||||||||||
| BestKeeper | ||||||||||
| Normfinder | ||||||||||
| Genorm | ||||||||||
| Recommended comprehensive ranking | ||||||||||
| ΔCT | ||||||||||
| BestKeeper | ||||||||||
| Normfinder | ||||||||||
| Genorm | ||||||||||
| Recommended comprehensive ranking | ||||||||||
Summary of treatments and results.
| No. | Treatments | Recommended RGs for each treatment | ||
|---|---|---|---|---|
| Names | Organs | Conditions | ||
| 1 | Circadian rhythm of different tissues | Leaf | All test period | |
| Stem | All test period | |||
| Root | All test period | |||
| 2 | JA treatment | 2nd leaves | 0.5–1.5 h | |
| 3–6 h | ||||
| 12–48 h | ||||
| All test period | ||||
| 3 | 2nd leaves | 6–24 h | ||
| 48 h | ||||
| All test period | ||||
| 4 | 2nd leaves | 12–72 h | ||
| 96 h | ||||
| 120–144 h | ||||
| All test period | ||||
| 5 | Mechanical damage and | 2nd leaves | 1.5–3 h | |
| 6 h | ||||
| 12–48 h | ||||
| All test period | ||||
Figure 3Validation of the gene stability measure. Expression profiles of CsMYC2, CsOPR3, CsPAL and CsPALc under different experimental conditions using different RGs. (A) Diurnal expression profile of CsMYC2 in leaves, NF (1–2) were UBC1 and CLATHRIN1, NF (9–10) were TIP41 and PTB1; (B) Diurnal expression profile of CsMYC2 in stems, NF (1–2) were TUA1 and SAND1, NF (9–10) were EF1 and GAPDH1; (C) Diurnal expression profile of CsMYC2 in roots, NF(1–2) were SAND1 and UBC1, NF (9–10) were TUA1 and ACTIN1; (D) Expression profile of CsOPR3 at 3 h normalized with the best combination (GAPDH1 and TIP41) at 3 h, the best combination (CLATHRIN1 and UBC1) at 0.5–1.5 h, and the best combination (CLATHRIN1 and GAPDH1) at 12–48 h RGs under JA treatment; (E) Expression profile of CsPAL at 48 h normalized with the best combination (ACTIN1 and EF1) at 48 h, and the best combination (ACTIN1 and UBC1) at 6–24 h RGs under T. aurantii infestation; (F) Expression profile of CsPALc at 96 h normalized with the best combination (PTB1 and TBP) at 96 h, the best combination (GAPDH1 and UBC1) at 12–72 h, and the best combination (TIP41 and EF1) at 120–144 h under E. onukii infestation; (G) Expression profile of CsOPR3 at 6 h normalized with the best combination (TBP1 and CLATHRIN1) at 6 h, the best combination (TIP41 and TBP) at 1.5–3 h, and the best combination (SAND1 and TBP) at 12–48 h RGs under E. obliqua infestation; (H) Expression profile of CsOPR3 normalized with the stable and unstable RGs at 3 h under JA treatment. NF1 was GAPDH1, NF (1–2) were GAPDH1 and TIP41, NF10 was ACTIN1, NF (9–10) were TUA1 and ACTIN1; (I) Expression profiles of CsPAL normalized with the stable and unstable RGs at 6 h under T. aurantii infestation. NF1 was ACTIN1, NF (1–2) were ACTIN1 and UBC1, NF10 was TUA1, NF (9–10) were PTB1 and TUA1; (J) Expression profile of CsPALc normalized with the stable and unstable RGs at 96 h under E. onukii infestation. NF1 was PTB1, NF (1–2) were PTB1 and TBP, NF10 was TUA1, NF (9–10) were TIP41 and TUA1; (K) Expression profile of CsOPR3 normalized with the stable and unstable RGs at 6 h under E. obliqua infestation. NF1 was TBP, NF (1–2) were TBP and CLATHRIN1, NF10 was TUA1, NF (9–10) were EF1 and TUA1; Data are means ± SE. One-way ANOVA (Tukey’s test) was used to analyze significant difference among treatments (A~C,F,G,J,K); different letters indicate significant differences among treatments (lowercase letters, P < 0.05; uppercase letters, P < 0.01). Two samples were compared by using Student’s t-test (D, E, H, I); **P < 0.01.