Literature DB >> 32017794

Comparative transcriptome provides molecular insight into defense-associated mechanisms against spider mite in resistant and susceptible common bean cultivars.

Abdul Hadi Hoseinzadeh1, Aboozar Soorni2, Marie Shoorooei1, Masoud Torkzadeh Mahani3, Reza Maali Amiri1, Hossein Allahyari4, Rahmat Mohammadi1.   

Abstract

Common bean (Phaseolus vulgaris L.) is a major source of proteins and one of the most important edible foods for more than three hundred million people in the world. The common bean plants are frequently attacked by spider mite (Tetranychus urticae Koch), leading to a significant decrease in plant growth and economic performance. The use of resistant cultivars and the identification of the genes involved in plant-mite resistance are practical solutions to this problem. Hence, a comprehensive study of the molecular interactions between resistant and susceptible common bean cultivars and spider mite can shed light into the understanding of mechanisms and biological pathways of resistance. In this study, one resistant (Naz) and one susceptible (Akhtar) cultivars were selected for a transcriptome comparison at different time points (0, 1 and 5 days) after spider mite feeding. The comparison of cultivars in different time points revealed several key genes, which showed a change increase in transcript abundance via spider mite infestation. These included genes involved in flavonoid biosynthesis process; a conserved MYB-bHLH-WD40 (MBW) regulatory complex; transcription factors (TFs) TT2, TT8, TCP, Cys2/His2-type and C2H2-type zinc finger proteins; the ethylene response factors (ERFs) ERF1 and ERF9; genes related to metabolism of auxin and jasmonic acid (JA); pathogenesis-related (PR) proteins and heat shock proteins.

Entities:  

Mesh:

Year:  2020        PMID: 32017794      PMCID: PMC6999899          DOI: 10.1371/journal.pone.0228680

Source DB:  PubMed          Journal:  PLoS One        ISSN: 1932-6203            Impact factor:   3.240


Introduction

Common bean (Phaseolus vulgaris L.), is one of the most important edible foods in the world which provides about 50% of the grain legumes for direct human consumption [1-3]. In addition, it is an inexpensive healthy food due to having the richest sources of proteins (20–25%), micronutrients and calories [2]. Common bean is widely distributed around the world. In Asia, most collections exist in India [4], and Iran [5]. Notably, over the last 10 years, the production of common bean has increased ~33% in Asia [2]. Because of high nutrient content and commercial potential, common bean holds great promise for fighting hunger and increasing income. Low yield of this crop is attributed to pest attack, weak soil fertility, drought and salinity, and poor agronomic practices [6]. According to the records, the two spotted spider mite (TSSM), Tetranychus urticae Koch, is the most widespread and the most polyphagous herbivores mites which feed on cell contents of common bean and causes serious substantial economic losses (up to 100% yield losses) in fields and greenhouses [7, 8]. The TSSM damages plant cells by its stylet that pierces the leaf either in between epidermal pavement cells or through a stomatal opening, suck-out their contents and forms the chlorotic lesions at the feeding sites [8-10]. In recent years, it has become evident that insect-resistant crops have brought great benefits, not only in terms of economic, but also because of the reduction of pesticides use and keeping a safe environment. The development of new cultivars is being established as one of the most appropriate methods and the main objective of plant breeding programs for resistance to TSSM [11, 12]. However, lacking information on how plant and mite interact with each other emphasizes the importance of a comprehensive study of the molecular interactions between common bean and T. urticae to understand the mechanisms and potential biological pathways of common bean resistance. Although RNA-Seq has been used to study the expression profiles of stress response genes in model and non-model plants, but there has not been any study of common bean transcriptome changes due to spider mite feeding. In this study we used RNA-Seq analysis to detect differences in gene expression between two cultivars of P. vulgaris (susceptible and resistant), and specify effective genes and pathways in response to T. urticae infestation. Such information could lead to identity resistant mechanisms and genes in common bean and improve the breeding efforts by identifying molecular markers to incorporate resistance into commercial bean varieties.

Materials and methods

Plants and insect infestation

According to our previous study [13], two cultivars, including Akhtar and Naz were selected as susceptible and resistant cultivars to T. urticae, respectively. Seeds were sown in plastic pots (15 cm diameter, 25 cm high) containing soil, peat moss, and perlite (1:1:1), with only a single plant in each pot. The experiment was conducted using a factorial experiment based on completely randomized design with three replicates in greenhouse condition (28 ± 3ºC temperature, 40–50% relative humidity, photoperiod 16h light and 8h darkness). The founder population of mite was collected from a commercial bean farm in Karaj, Iran and colonies were reared on the similar cultivars to be tested for three generations before being used in this experiment. In six-leaf stage (about 30 days after planting) based on Meier [14], 45 same-aged adult female mites were placed on sixth leaf of plants. Since, the number of females is higher than males and they also cause the most damages, only female mites were selected from a mass which had the opportunity for mating. The leaves were collected after 0, 1 and 5 days of infestation. Treated leaves were frozen in liquid nitrogen and kept at −80°C until they were used for RNA extraction.

RNA isolation and transcriptome sequencing

Total RNA was extracted from two biological replicates, which each were pooled samples from at least three plants using TRIzol® Reagent (Invitrogen) as described by the manufacturer's protocol, and then treated with RNase-free DNaseI (Invitrogen). Nanodrop™ 2000 spectrophotometer, agarose gel electrophoresis and Bioanalyzer 2100 (Agilent) were used to check and confirm quantity and quality of RNAs. All RNAs were sent to Beijing Genomic Institute (BGI) in China for library preparation and transcriptome sequencing using the Illumina HiSeq 2500 platform to generate Paired-end (2×150 bp) reads.

Reads preprocessing and differentially expression analysis

The raw reads were downloaded from BGI institute web site in Fastq format and then were subjected to quality control (QC) analysis using Trimmomatic software [15] to trim low quality reads, adapters and other Illumina-specific sequences, minimum length 50 bp and minimum quality 30 determined as quality thresholds. Before and after filtering, the quality of the raw sequences was assessed with FastQC (https://www.bioinformatics.babraham.ac.uk/projects/fastqc/). Clean reads were mapped to the P. vulgaris [16] and T.urticae [17] reference genomes V. 2.0 (https://phytozome.jgi.doe.gov) via RNA-Seq aligner STAR software [18] requiring at least 90% of the read sequence to match with at least 95% identity. The STAR-resultant. bam files were used to estimate the abundance of mapped reads, differential expression analyses, and visualization of analyses results using Cufflinks [19] package coupled with CummeRbund [20]. Cufflinks was used to calculate FPKM values and differential expression analysis was done with Cuffdiff. The analysis focused on genes with statistically significant difference in expression levels between times and cultivars. The genes were considered significantly differentially expressed if false discovery rate (FDR, the adjusted P value) was <0.01 and Log2 FPKM (fold change) was ≥1.0. All RNA-Seq data were deposited in the NCBI SRA database under the project PRJNA482175.

GO terms and KEGG pathways enrichment analysis

The functions of the DEGs were characterized using AgriGO’s Singular Enrichment Analysis (SEA) module to identify the enriched Gene Ontology terms (http://bioinfo.cau.edu.cn/agriGO/analysis.php) with the agriGO database [21]. The enrichment analysis was performed at significance level of 0.05. Enrichment analysis of Kyoto Encyclopedia of Genes and Genomics (KEGG) pathways was also carried out on DEGs using KOBAS 3.0 web server (http://kobas.cbi.pku.edu.cn/). KEGG pathways with corrected p-value ≤0.05 were considered as significantly enriched.

Quantitative real-time PCR validation

To validate candidate differentially expressed genes (DEGs), qRT-PCR was performed for six DEGs and Actin 11 as a reference gene with three replicates. Primers were designed by Primer 3.0 [22] (Table 1), and cDNAs were synthesized by using TaKaRa cDNA Synthesis Kit (TaKaRa, Dalian, China) according to the manufacturer’s instructions. The 20 μL qRT-PCR solutions contained EvaGreen Master Mix (Solis Biodyne, 5x), 0.3 μL forward and 0.3 μL reverse primers, and 30 ng of cDNA template. qRT-PCR reactions (95 °C, 3 min; 95 °C, 5 s; 60 °C, 34 s; 40 cycles) were carried out on a Bio-Rad iQ5 Optical System (Bio-Rad Laboratories, CA, USA). Finally, relative gene expression was calculated using 2-ΔΔCT formula and REST software [23].
Table 1

Description of the candidate gens and primer sequences for qRT-PCR assay efficiencies.

Funcional annotationGene IDForward primerReverse prime
Pathogenesis-related proteinPhvul.004G155500TGGGATACAGCTACAGCATCGTATCTTCATTGGGTGGAGCATCT
WRKY transcription factor 50Phvul.009G080000GTCGCTGAGATCGGAGAATCGCAAATCCAGCTTTGACCAT
Heat shock protein (Molecular chaperone)Phvul.008G011400CTTTCAACACCAACGCCATGGCTCAAGCTCCGAGTAGG
Leucine Rich RepeatPhvul.008G044600CTTGACTATGAGCTTGTCCCCTGCTTTCTCTGTAAGGTGTCC
MYB113Phvul.008G038200GTCGCTGAGATCGGAGAATCGCAAATCCAGCTTTGACCAT
Xyloglucan endotransglucosylase/hydrolasesPhvul.005G111300AGTTCGACGAGCTGTTCCAGACGTTGGTCTGCACGCTGTA

Results and discussion

Quality control and mapping statistics

A total of 12 RNA libraries were sequenced with the number of reads ranging from 26.8–30.2 million paired-end reads (Table 2). Approximately 70–73% of reads passed the quality control and an 84.58–90.30% of the clean reads were mapped to unique location in the common bean reference genome. Alignment of clean reads to T. urticae reference genome was also carried out to determine whether a significant mite RNA contamination exists in our datasets. Assessment of quality of mRNA-Seq data revealed less than 0.1% mapping, indicating a strong enrichment of genes specific for P. vulgaris in all samples.
Table 2

Summary of sample information and transcriptome sequencing output statistics for the RNA-Seq libraries.

CultivarsReplicateTime pointsReads before quality controlReads after quality controlRemoving percent
Akhtar (susceptible)Replicate 1Control302613542102056330.54
1 Day288340082087138027.62
5 Day268325851913148228.70
Replicate 2Control312612542202035429.56
1 Day278362082097168224.66
5 Day266323821923118027.79
Naz (resistant)Replicate 1Control305932272230562427.09
1 Day276773491915251430.80
5 Day292143222146189226.54
Replicate 2Control302431182221245626.55
1 Day281234541925231431.54
5 Day288763222186354224.29

Differentially expressed genes (DEGs)

Differentially expressed genes analysis was performed for the pairwise comparisons of twelve libraries. The largest differences in expression occurred among three time points of resistant cultivar. When comparing the different time points for resistant cultivar, 274 differentially expressed genes were identified (S1 Table), almost the same number of DEGs for susceptible cultivar (270 DEGs, S2 Table). The number of up-regulated genes was higher than down-regulated genes in all different time point comparisons in both cultivars. To gain a better understanding, the overlap differentially expressed patterns of DEGs were analyzed between cultivars in each time point and across time points in each cultivars using Venn diagram. The comparison of cultivars in each time points revealed 48, 65 and 81 up-regulated genes along with 46, 59, 68 down-regulated genes in resistant cultivar for control samples and these infested at 1 and 5 days post-feeding, respectively (Fig 1, S3–S5 Tables). The number of DEGs showed a rising trend with the extension of infestation time, So that the smallest and largest differences were observed between resistant and susceptible plants at first and third time points, in which 94 and 146 DEGs were identified, respectively. This result indicates there are probably no significant differences in gene expression patterns during the first attempts of spider mite in both susceptible and resistant reactions. However, gene expression patterns were more different during the second phase of infestation depending on the resistance/susceptibility of the plant.
Fig 1

Venn diagram showing the number of specific and shared DEGs between pair time points in both cultivars.

Up_T0, genes up-regulated in resistant cultivar in comparison with susceptible cultivar at first time point. Down_T0, genes down-regulated in resistant cultivar or up-regulated in susceptible cultivar at first time point. T1 and T3 represent the second and third time points, respectively.

Venn diagram showing the number of specific and shared DEGs between pair time points in both cultivars.

Up_T0, genes up-regulated in resistant cultivar in comparison with susceptible cultivar at first time point. Down_T0, genes down-regulated in resistant cultivar or up-regulated in susceptible cultivar at first time point. T1 and T3 represent the second and third time points, respectively. Gene expression patterns were also different with the extension of infestation time depending on the resistance/susceptibility of common bean cultivars. Among DEGs, approximately 44% and 37% of up-regulated genes were common among three time points, while less than 7% of down-regulated genes were shared among times in both cultivars. Interestingly, there was no any common up or down regulated gene between T0T1 (comparison of first and second time points) and T1T3 (comparison of second and third time points) and also any unique gene for T0T3 (comparison of first and third time points). As shown in the Venn diagram in Fig 2, the number of up-regulated DEGs in T0T3 comparison was higher than T0T1 comparison in both cultivars. This analysis indicated that more than 70% and 85% of DEGs were common between T0T1 and T0T3 comparisons, respectively.
Fig 2

Venn diagram representing specific and shared up- and down-regulated genes between two sets in each cultivar.

Pink circle (first set) represents the comparison of first and second time points and green (second set) is the comparison of first and third time points. Up and Down represent up-regulated, down-regulated genes. Res and Sus represent resistant and susceptible cultivars.

Venn diagram representing specific and shared up- and down-regulated genes between two sets in each cultivar.

Pink circle (first set) represents the comparison of first and second time points and green (second set) is the comparison of first and third time points. Up and Down represent up-regulated, down-regulated genes. Res and Sus represent resistant and susceptible cultivars.

Functional classification and GO enrichment analysis of DEGs

To eliminate the effects of genetic differences, DEGs were compared between cultivars at the same time points. GO analysis detected 57, 39 and 46 categories, according to biological process (P), molecular function (F), and cellular component (C) among all up- and down-regulated genes at time 0, 1 and 3, respectively.

Secondary metabolism

The differences between control samples was determined by the metabolism of phenylpropanoid, a central to produce defense-related compounds [24-26], including anthocyanins and flavonoids (Fig 3). The two most induced genes involved in flavonoid biosynthesis process corresponded to dihydroflavonol reductase (DFR) and chalcone synthase (CHS). We found transcripts of DFR which were up-regulated in resistant cultivar (Fig 4). DFR has been previously reported as induced by Fusarium oxysporum inoculations on Linum usitatissimum [27]. Colletotrichum camelliae on Camellia sinensis [28] and Elsinoe ampelina in grapevine [29]. DFR is also a key regulatory gene belonging to the subgroup of late anthocyanin biosynthesis genes which can be activated by TFs such as MYBs [30, 31]. CHS showed more than 7-fold change increase in resistant cultivar. O-methyltransferases (OMTs), involved in phenylpropanoids, flavonoids, and anthocyanin methylation, was up-regulated in resistant cultivar and showed an 8-fold increase in expression level upon spider mite feeding. O-Methylation plays key roles in plant defense following pathogen attack [32]. Additionally, the interaction network suggests the possible involvement of Cytochrome P450 (CYP) genes (CYP72A7 and CYP71A26) in resistance, previously reported in several studies [33, 34]. In the susceptible genotype, CYP83B1 gene required for the synthesis of indole glucosinolates, was down-regulated during infestation which is not consistent with previous reports in a number of researches [27, 35]. This result demonstrates the role of spider mite effectors in suppressing the defence-related gene of common bean in compatible interaction (susceptible cultivar) but not in an incompatible interaction (resistant cultivar). Previous investigation indicate when a pathogen interacts with plant tissues, more intensive transcriptional changes are found in the compatible interaction and pathogens commonly develope effectors that interfere with signaling pathways to suppress resistance responses. Finally, other secondary metabolism gene (BAS: beta-amyrin synthase) with higher transcript abundance in resistant cultivar was related to sesquiterpenoid and triterpenoid biosynthesis.
Fig 3

GO enrichment analysis for up-regulated genes in resistant cultivar as compared to susceptible cultivar at day 0 (control samples).

Boxes in the graph represent GO IDs, term definitions and statistical information. Significant GO terms (p ≤ 0.05) are marked with color. The degree of color saturation of a box is positively correlated to the enrichment level of the term.

Fig 4

Interaction networks of up-regulated genes identified in resistance cultivar as compared to susceptible cultivar at day 0 (control samples).

GO enrichment analysis for up-regulated genes in resistant cultivar as compared to susceptible cultivar at day 0 (control samples).

Boxes in the graph represent GO IDs, term definitions and statistical information. Significant GO terms (p ≤ 0.05) are marked with color. The degree of color saturation of a box is positively correlated to the enrichment level of the term.

Transcriptional regulation

TF families found in our study are widely reported to be involved in plant defense responses, including MYB, WRKY, ethylene responsive factors (ERFs), zinc finger domain proteins and basic helix-loop-helix (bHLH). A key TF that currently appears in the studies of plant-pathogen interactions [27, 36] and had a significant expression in resistant cultivar of our study is MYB113. TRANSPARENT TESTA4 (TT4), a chalcone and stilbene synthase family protein, is a key enzyme involved in the biosynthesis of flavonoids to encode chalcone synthase (CHS), and is required for the accumulation of purple anthocyanins in leaves and stems [37]. TT4 along with TRANSPARENT TESTA8 (TT8), a bHLH DNA-binding superfamily protein which is required for normal expression of DFR [38] associated with MYB113 in the interaction network. An important candidate TF for spider mite resistance is WD40 protein, which was expressed only during mite infestation in the resistant cultivar. Many studies have shown that a conserved MYB-bHLH-WD40 (MBW) regulatory complex control the expression of anthocyanin biosynthesis genes [39]. So, we deduced that MBW regulatory complex has the same function in common bean and is involved in resistance. In addition, another TF for spider mite resistance may be TCP protein, whose expression was increased during spider mite infestation in the resistant cultivar. Recent studies suggested that TCP proteins play an important role in systemic acquired resistance (SAR) which is induced plant immunity, activated by pathogen infection [40-42]. Additionally, we identified a gene encoding WRKY50 which was significantly up-regulated in resistant cultivar during the middle-to-late stages (at day 5) of spider mite feeding. The spider mite infestation also affected the expression levels of Cys2/His2-type and C2H2-type zinc finger proteins as up-regulated genes in resistance and susceptible cultivars at day 5 post-infestation, respectively. The Cys2/His2-type zinc finger proteins are not only related to plant stress responses, but also enhance the resistance against pathogen infection [43]. ERFs, another important group of TFs, which play roles in integrating ET/JA signals [31, 44], activating the phenylpropanoid biosynthetic pathway and expression of resistance genes [45, 46], were activated in resistance cultivar at day 5 post-infestation. We observed increased transcript abundance of two key ERFs, including ERF1 and ERF9. The role of ERF1 as a regulator of ethylene responses after pathogen attack has been documented in Arabidopsis [47] but ERF9 has not proven to be relevant in the defense responses.

Hormone regulation

GO enrichment analysis showed other GO terms that significantly overrepresented among up-regulated genes of resistant cultivar, including “response to stress”, “response to stimulus” and “response to jasmonic acid”. JA signaling has closely been associated with defense mechanisms against pathogens and insects [48, 49]. In our study, 13S-lipoxygenase 2 (LOX2), a JA signaling and biogenesis gene, was detected as up-regulated gene in resistant cultivar, where it had a low transcript abundance in susceptible cultivar. Up-regulation of allene oxide synthase (AOS), needed to JA production, at day 1 post-feeding suggests that common bean resistance to the disease is enhanced by the activation of JA signaling pathways. Our result is corroborated with the previous studies where the expression levels of LOX and AOS significantly increased after infestation [27, 50, 51]. In addition, the expression of two auxin signaling pathway genes, SAUR (small auxin-up RNA) and ARF5 (Auxin response factor 5), were down- and up-regulated in resistant cultivar, respectively. SAUR genes are related to cell division[52, 53] and reportedly regulated by the auxin level, indicating that this process could be impaired by spider mite feeding. The down-regulation of SAUR gene is in agreement with the previous studies on A. thaliana [54] and soybean [55].

Pathogen elicitor perception

In our study, only one disease resistance protein from TIR-NBS-LRRs class (Phvul.005G093400.1) had higher transcript abundance in resistance cultivar, while one TIR-NBS-LRR (Phvul.010G029800.1), two NB-ARC domains-containing (Phvul.002G130666.1, Phvul.010G064700.1), and one CC-NBS-LRR (Phvul.003G247601.1) showed a high level of expression in susceptible cultivar before infestation. During the first stage of mite infestation, five TIR-NBS-LRRs (Phvul.002G323100.1, Phvul.002G323400.2, Phvul.004G046400.1, Phvul.011G140300.1 and Phvul.010G132433.1), three NB-ARC (Phvul.003G002926.1, Phvul.004G013300.1 and Phvul.008G071300.3) and one leucine-rich repeat (LRR) protein kinase (Phvul.007G087550.1) were highly expressed in resistance cultivar, whereas one TIR-NBS-LRR (Phvul.004G058700.1) and three NB-ARC (Phvul.008G031200.10, Phvul.010G064700.1, Phvul.011G195400.1) were found to be up-regulated in susceptible common bean cultivar. But these genes could not fully exert their expression with the extension of infestation time except one NB-ARC (Phvul.010G064700.1) in susceptible cultivar. At the first glance, it seems that the susceptible cultivar has a higher number of up-regulated disease resistance genes than the resistant one before mite infestation. But our results indicated that the response of the resistant plants was more robust than that of the susceptible cultivar upon pathogen attack. This can be elucidated by the role of miRNAs in down-regulating defense-related genes expression in susceptible cultivar [56, 57]. The non-specific defense responses to deter the pathogen can also explain loss of defense-related genes expression at fifth day. In addition, one gene encoding the Cysteine-rich RLK (CRK10) was highly expressed upon spider feeding. This highly up-regulated CRK gene seems to indicate its potential role in resistance against spider mite. We also observed receptor-like proteins (RLPs) and receptor-like kinase (RLK) genes that have a direct effect on the pathogen in the both cultivars [58].

Antioxidant and detoxification processes

Reactive oxygen species (ROS) are involved in various processes along the plant life, but are best known as a key component of the signaling events involved in abiotic and biotic stress responses, so that are rapidly induced and accumulated after pathogen attack [51, 59]. An important response to control ROS is the induction of scavenging genes. In this respect, heat shock proteins (HSPs) play an important role in supporting ROS scavenging activity and stress tolerance [60]. In our study, HSP 70 was found to be up-regulated during spider mite feeding only in resistant cultivar, which highlight the function of HSPs in plant defense against pathogenic infection and reduce accumulation of ROS. This notion can be supported by the P. vulgaris-Colletotrichum interaction study [61], that HSPs are highly expressed against Colletotrichum lindemuthianum infection. Among detoxification genes, UDP-glycosyltransferase significantly up-regulated in resistant cultivar at all-time points, suggesting this gene may play an important role in the common bean resistance to spider mite feeding. The previous studies conducted on nematode attack in wheat [62] and Fusarium in Brachypodium distachyon [63] reinforces our argument about UDP-glycosyltransferase function.

Cell wall

Xyloglucan endotransglucosylase/hydrolases (XTHs) are a family of enzymes that facilitate cell wall expansion [64] and also have the functions, probably associated with resistance mechanism [65]. In current study, we observed two XTHs (XTH22: Phvul.003G147700 and XTH9: Phvul.005G111300) in resistant cultivar significantly expressed at day 1 post infestation. Another important candidate gene for spider mite resistance may be the malectin-like receptor kinase FERONIA (FER), which was up-regulated and showed increase abundance during mite infestation, although there is no significant information on the role of this gene in response to feeding.

Other genes

There are substantial reports regarding expression of pathogenesis-related (PR) genes under numerous stresses in common bean [61, 66]. Our transcriptome study successfully identified one PR-5 like receptor kinase (Phvul.004G155500) as up-regulated gene in resistant cultivar at day 5, which has been implicated in plant disease resistance, induced by different pathgens and share significant sequence similarity in many species [61, 66] 2-oxoglutarate (2OG) and Fe (II)-dependent oxygenase is another up-regulated gene in resistance cultivar under infestation which make it a potential candidate gene for resistance against spider mite and probably suitable for breeding programs. This gene has been previously described as responsive to pathogens [27].

KEGG pathway functional enrichment analysis of the DEGs

Based on the KEGG pathway enrichment analysis, flavonoid biosynthesis, biosynthesis of secondary metabolites, metabolic pathways, phenylpropanoid biosynthesis and Linoleic acid metabolism were found to be the most changed pathways (S6–S8 Tables). In this assay it was demonstrated that the metabolic pathway biosynthesis of secondary metabolites contained the largest number of DEGs. From the results, we found that KEGG pathways, such as plant–pathogen interaction, plant hormone signaling transduction, and glucosinolate biosynthesis pathways play important roles in defence responses of common bean to spider mite.

Validation of DEGs by using qRT-PCR

In order to verify gene expression results of transcriptome data analysis, six DEGs having annotations were selected for qRT-PCR analysis. They include the genes encoding pathogenesis-related proteins PR5, heat shock protein, leucine rich repeat, MYB113, XTH and a WRKY50 (Fig 5). Quantitative RT-PCR analysis was conducted on 12 RNA samples that were used in the preparation of sequencing libraries. Relative expression profiles of DEGs in the both resistant and susceptible evaluated using qRT-PCR were in complete agreement with the RNA-Seq data. This is in line with other studies, which showed almost the same level of fold changes between RNA-Seq data and qPCR [67, 68].
Fig 5

qRT-PCR results of genes selected from the RNA-Seq analysis of common bean–spider mite interaction.

Expression levels of tested genes were normalized based on of Actin gene and then compared to relative expression values determined by RNA-Seq. Relative expression values of samples were determined by using the average expression value of all replicates of a particular group. Standard deviation among replicates is represented by error bars. Res and Sus represent resistant and susceptible cultivars. TP0, TP1 and TP5 represent first, second and third time points. RT ans RS in parentheses represent qRT-PCR and RNA-Seq.

qRT-PCR results of genes selected from the RNA-Seq analysis of common bean–spider mite interaction.

Expression levels of tested genes were normalized based on of Actin gene and then compared to relative expression values determined by RNA-Seq. Relative expression values of samples were determined by using the average expression value of all replicates of a particular group. Standard deviation among replicates is represented by error bars. Res and Sus represent resistant and susceptible cultivars. TP0, TP1 and TP5 represent first, second and third time points. RT ans RS in parentheses represent qRT-PCR and RNA-Seq.

Conclusion

To our knowledge, this investigation is the first study to identify molecular mechanisms involved in the common bean resistance to spider mite feeding by using RNA sequencing technology. In summary, DEGs were identified for control samples,1 and 5 days after infestation of spider mite in resistant and susceptible cultivars of common bean. Importantly, we identified secondary metabolism, multiple disease resistance proteins, TFs and genes involved in cell wall expansion and antioxidant processes that were modulated by spider mite attack. Overall, this study extended our understanding of the defense molecular mechanisms of two common bean cultivars with different genetic backgrounds during spider mite infestation. We came to the conclusion that these data provide important and valuable information for future research in common bean.

List of DEGs among time points in resistant cultivar.

(XLSX) Click here for additional data file.

List of DEGs among time points in susceptible cultivar.

(XLSX) Click here for additional data file.

List of DEGs between cultivars at first time point.

(XLSX) Click here for additional data file.

List of DEGs between cultivars at second time point.

(XLSX) Click here for additional data file.

List of DEGs between cultivars at third time point.

(XLSX) Click here for additional data file.

Distribution of KEGG enriched pathways for DEGs between cultivars at first time point.

(XLSX) Click here for additional data file.

Distribution of KEGG enriched pathways for DEGs between cultivars at second time point.

(XLSX) Click here for additional data file.

Distribution of KEGG enriched pathways for DEGs between cultivars at third time point.

(XLSX) Click here for additional data file. 2 Dec 2019 PONE-D-19-29263 Comparative transcriptome provides molecular insight into defense-associated mechanisms against spider mite in resistant and susceptible common bean cultivars PLOS ONE Dear Dr Soorni, Thank you for submitting your manuscript to PLOS ONE. After careful consideration, we feel that it has merit but does not fully meet PLOS ONE’s publication criteria as it currently stands. Therefore, we invite you to submit a revised version of the manuscript that addresses the points raised during the review process. We would appreciate receiving your revised manuscript by Jan 16 2020 11:59PM. When you are ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file. If you would like to make changes to your financial disclosure, please include your updated statement in your cover letter. To enhance the reproducibility of your results, we recommend that if applicable you deposit your laboratory protocols in protocols.io, where a protocol can be assigned its own identifier (DOI) such that it can be cited independently in the future. For instructions see: http://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocols Please include the following items when submitting your revised manuscript: A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). This letter should be uploaded as separate file and labeled 'Response to Reviewers'. A marked-up copy of your manuscript that highlights changes made to the original version. This file should be uploaded as separate file and labeled 'Revised Manuscript with Track Changes'. An unmarked version of your revised paper without tracked changes. This file should be uploaded as separate file and labeled 'Manuscript'. Please note while forming your response, if your article is accepted, you may have the opportunity to make the peer review history publicly available. The record will include editor decision letters (with reviews) and your responses to reviewer comments. If eligible, we will contact you to opt in or out. We look forward to receiving your revised manuscript. Kind regards, Kandasamy Ulaganathan Academic Editor PLOS ONE Journal Requirements: When submitting your revision, we need you to address these additional requirements. 1. Please ensure that your manuscript meets PLOS ONE's style requirements, including those for file naming. The PLOS ONE style templates can be found at http://www.journals.plos.org/plosone/s/file?id=wjVg/PLOSOne_formatting_sample_main_body.pdf and http://www.journals.plos.org/plosone/s/file?id=ba62/PLOSOne_formatting_sample_title_authors_affiliations.pdf 2. Please include captions for your Supporting Information files at the end of your manuscript, and update any in-text citations to match accordingly. Please see our Supporting Information guidelines for more information: http://journals.plos.org/plosone/s/supporting-information. Additional Editor Comments (if provided): Completely revise the manuscript by taking into considerations all the points raised by the reviewers and incorporate all corrections pointed out by the reviewers. [Note: HTML markup is below. Please do not edit.] Reviewers' comments: Reviewer's Responses to Questions Comments to the Author 1. Is the manuscript technically sound, and do the data support the conclusions? The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented. Reviewer #1: Partly Reviewer #2: Yes Reviewer #3: Yes ********** 2. Has the statistical analysis been performed appropriately and rigorously? Reviewer #1: No Reviewer #2: Yes Reviewer #3: Yes ********** 3. Have the authors made all data underlying the findings in their manuscript fully available? The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified. Reviewer #1: No Reviewer #2: Yes Reviewer #3: Yes ********** 4. Is the manuscript presented in an intelligible fashion and written in standard English? PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here. Reviewer #1: No Reviewer #2: Yes Reviewer #3: Yes ********** 5. Review Comments to the Author Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters) Reviewer #1: It’s known that the two-spotted spider mite Tetranychus urticae Koch is one of the economically most important pests in a wide range of outdoor and protected crops worldwide. To identify the resistant mechanism against spider mite of host plant will greatly improve the crops breeding. Authors used RNA-seq to investigate the candidate resistant related genes that’s a good idea to get the whole deferential expression genes (DEGs) between resistant and susceptible cultivars. However this manuscript lacks a systematic statement, reader hardly to read and to get the useful information. Authors may include some articles which addressed on the study on resistant mechanism of spider mite to explain the relationship of DEGs and resistant mechanism. (such as: (1) Can Plant Defence Mechanisms Provide New Approaches for the Sustainable Control of the Two-Spotted Spider Mite Tetranychus urticae?. Int J Mol Sci. 2018;19(2):614. (2) Acaricide resistance mechanisms in the two-spotted spider mite Tetranychus urticae and other important Acari: a review. Insect Biochem Mol Biol. 2010 Aug;40(8):563-72.) For major part: 1. P7, Line 167: The data was not consistent to Table S3. In the manuscript the DFEs are 48 for up-regulation and 46 for down-regulation, while only 93 DFEs were included in Table S3. 2. From P8, Line 204 to P12, Line 318: There was no related data to show the expression level of DFEs. Such as “The two most induced genes involved in flavonoid….” (Line 204), “CHS showed more than 7-fold change increase in resistant cultivar. O-methyltransferases (OMTs), involved in phenylpropanoids, flavonoids, and anthocyanin methylation, was up-regulated in resistant cultivar and showed an 8-fold increase in expression level upon spider mite feeding.” and so on. Authors need to construct some tables to indicate the expression profiles of DGEs. 3. The results of Figure 5 were not consistent to Table S4 and Table S5. In Figure 5 the fold change of heat shock protein@TP1, Leucine Rich Protein@TP1, PR5@TP5, WRKY50@TP1 were significantly up-regulated in resistant cultivar (fold change >4) in RNA-seq analysis. The Table S3 and S5 collected the DFEs with Log2 FPKM (fold change) ≥1.0. However, they did not present in the Table S4 (@TP1) or Table S5 (@TP5). 4. P4, Line 101, Authors need to explain why they set the time point as 0, 1, and 5 day after infection? 5. The Figure 2 presents the comparison of Up_Res_T0T1 vs. Up_Sus_T0T5, and Down_Res_T0T1 vs. Down_Sus_T0T5. There are two variants: cultivar and treatment time. That cause the comparison none senesce. 6. P12, Line 332: Please explain why authors select these 6 genes for validation, especially some were not included in the previous parts of Result and Discussion. 7. There is rare discussion on the defense-associated mechanisms against spider mite in resistant and susceptible common bean cultivars. The Minor Part: 1. P2, Line 41: It should be “spider mite”. 2. P3, Line 73: TSSM is not the abbreviation of “Tetranychus urticae Koch”, put the correct one. 3. P4, Line 100: What does “In six-leaf stage of Meier” mean? 4. P5, Table 5: Since there are many Gene ID related to same functional annotation, please clarify, such as “Pathogenesis-related protein, PR5” for the first item. 5. P6. Line 147: This part is not important. Please move it to supplemental information. 6. The full name should be showed at its first present, such as CYP at P8, Line 215. 7. P8, Line 216: Authors mentioned “In the susceptible genotype, CYP83B1 gene required for the synthesis of indole glucosinolates, was down regulated during infestation which is not consistent with previous reports in a number of researches”. Please explain your opinion. 8. P12, Line 312: “The previous studies conducted on nematode attack in wheat (Qiao et al, 2018) and Fusarium in Brachypodium distachyon (Schweiger et al, 2013) reinforces our argument about UDP-glycosyltransferase function.” These two references were cited in a wrong format and were not included in reference list. Reviewer #2: I think this can be an informative manuscript after adding more data to it. I added some of my recommendations as comments in the manuscript and have some more recommendations as follows: first of all, you need to perform pathway analysis and add the results to the manuscript, I recommend using KOBAS 3.0. The second thing, I already added comments on Venn diagrams, just wanted to emphasis it more here, you want to follow that and revise the manuscript accordingly. I don't see a table or graph showing the number of DEGs that you find from the comparisons that you made, you need to add it to the manuscript. I don't know if it is problem with the system that I don't see all supportive information, or something else, you do have referred to tables such as "S3-5" in the manuscript that I cannot find them. The ones that I have access to them, Table S1-S5, I don't see any column labels and title, these tables are really confusing, you need to fix it. You also want to check all gene names in the manuscript, the all need to be italicized. Your figures text is not very clear, especially Fig 5, you need to revise all of the figures and be sure that quality matches journal requirements. Reviewer #3: The authors compared the transcriptome of resistant and susceptible common bean cultivars after infection of spider mite, aiming at shed light into the understanding of mechanisms and biological pathways of resistance. Materials and methods are not sufficiently detailed to understand the experimental design. English grammar, as it stands, needs to be improved; and some sentences are wordy and need to be shorted. Authors need to answer to the queries below, in order to resubmit to PLOS ONE for a final round and acceptance. For detailed comments, see below: Page 4: 1.Lines 96-97: Information of specimen collection and rearing method of insect should be described in more detail. 2.Lines 97-100: Plant growth information of two cultivars should be described in more detail. 3.Line 100: In six-leaf stage of Meier [13], is this phrase right? I noticed that the “Meier” is a surname. 4.Line 100: Why only the female mites were selected? Whether these female mites were mated or not? 5.Line 100: The common bean cultivars growing to “six-leaf stage”, the common bean cultivars need to take how many days to grow to this stage? And I think this would be added in the text. 6.Line 101: As spider mite is very small, how many individuals were used as each replicate? 7.Line 101: Why the authors set three time points (0, 1and 5 days)? As I known, in some studies about defense-associated mechanisms against insect infestation, more time points (0, 12, 24, 48, and 72 h or more hours) are set after insects’ infection. 8.Lines 100-101: What the meaning of “the same-aged”? Did the mites possess the same time span of ecdysis, forexample, 24 hours after ecdysis of these mites? 9.Lines 100-101: The sentences “45 same-aged adult female mites were placed on sixth leaf of cultivars.” Should be described in more detail. Because I was not clear how many inviduduals placed on each leaf of each cultivar per replicate. 10.Lines 100-101: This sentence is too long, and the grammar needs to be improved. 11.Lines 105: The authors mentioned in line 98 “The experiment was conducted using a factorial experiment based on completely randomized design with three replicates”, however in line 105, they mentioned that “Total RNA was extracted from two biological replicates”. Generally, three replicates are taken for each cultivar. Page 5: 1.Lines 134: the authors only six DEGs for validating candidate DEGs, I suggest that more related DEGs are need to validate. 2.Lines 141: The 2-ΔΔCt should correct to be 2-ΔΔCT. ********** 6. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files. If you choose “no”, your identity will remain anonymous but your review may still be made public. Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy. Reviewer #1: No Reviewer #2: No Reviewer #3: No [NOTE: If reviewer comments were submitted as an attachment file, they will be attached to this email and accessible via the submission site. Please log into your account, locate the manuscript record, and check for the action link "View Attachments". If this link does not appear, there are no attachment files to be viewed.] While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com/. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Registration is free. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email us at figures@plos.org. Please note that Supporting Information files do not need this step. Submitted filename: PONE-D-19-29263_reviewer (1).pdf Click here for additional data file. Submitted filename: Reviewer comments.doc Click here for additional data file. 5 Jan 2020 First of all, I would like to thank your editorial work over our manuscript. We also would like to thank the reviewers for their work and for some of the suggestions that they made. We think that the incorporation of these suggestions have increased the quality of the manuscript. We are pleased with the revision. We have addressed the concerns presented by the reviewers in the new version of the manuscript. We also have answered their questions and clarify their points in rebuttal letter. If you have any new comment or question, please do not hesitate to contact me. Submitted filename: Response to Reviewers.docx Click here for additional data file. 22 Jan 2020 Comparative transcriptome provides molecular insight into defense-associated mechanisms against spider mite in resistant and susceptible common bean cultivars PONE-D-19-29263R1 Dear Dr. Soorni, We are pleased to inform you that your manuscript has been judged scientifically suitable for publication and will be formally accepted for publication once it complies with all outstanding technical requirements. Within one week, you will receive an e-mail containing information on the amendments required prior to publication. When all required modifications have been addressed, you will receive a formal acceptance letter and your manuscript will proceed to our production department and be scheduled for publication. Shortly after the formal acceptance letter is sent, an invoice for payment will follow. To ensure an efficient production and billing process, please log into Editorial Manager at https://www.editorialmanager.com/pone/, click the "Update My Information" link at the top of the page, and update your user information. If you have any billing related questions, please contact our Author Billing department directly at authorbilling@plos.org. If your institution or institutions have a press office, please notify them about your upcoming paper to enable them to help maximize its impact. If they will be preparing press materials for this manuscript, you must inform our press team as soon as possible and no later than 48 hours after receiving the formal acceptance. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information, please contact onepress@plos.org. With kind regards, Kandasamy Ulaganathan Academic Editor PLOS ONE Additional Editor Comments (optional): Reviewers' comments: Reviewer's Responses to Questions Comments to the Author 1. If the authors have adequately addressed your comments raised in a previous round of review and you feel that this manuscript is now acceptable for publication, you may indicate that here to bypass the “Comments to the Author” section, enter your conflict of interest statement in the “Confidential to Editor” section, and submit your "Accept" recommendation. Reviewer #1: All comments have been addressed Reviewer #2: All comments have been addressed ********** 2. Is the manuscript technically sound, and do the data support the conclusions? The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented. Reviewer #1: Partly Reviewer #2: Yes ********** 3. Has the statistical analysis been performed appropriately and rigorously? Reviewer #1: Yes Reviewer #2: (No Response) ********** 4. Have the authors made all data underlying the findings in their manuscript fully available? The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified. Reviewer #1: Yes Reviewer #2: (No Response) ********** 5. Is the manuscript presented in an intelligible fashion and written in standard English? PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here. Reviewer #1: Yes Reviewer #2: Yes ********** 6. Review Comments to the Author Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters) Reviewer #1: Your manuscript entitled "Comparative transcriptome provides molecular insight into defense-associated mechanisms against spider mite in resistant and susceptible common bean cultivars" was accepted. Reviewer #2: (No Response) ********** 7. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files. If you choose “no”, your identity will remain anonymous but your review may still be made public. Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy. Reviewer #1: No Reviewer #2: No 27 Jan 2020 PONE-D-19-29263R1 Comparative transcriptome provides molecular insight into defense-associated mechanisms against spider mite in resistant and susceptible common bean cultivars Dear Dr. Soorni: I am pleased to inform you that your manuscript has been deemed suitable for publication in PLOS ONE. Congratulations! Your manuscript is now with our production department. If your institution or institutions have a press office, please notify them about your upcoming paper at this point, to enable them to help maximize its impact. If they will be preparing press materials for this manuscript, please inform our press team within the next 48 hours. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information please contact onepress@plos.org. For any other questions or concerns, please email plosone@plos.org. Thank you for submitting your work to PLOS ONE. With kind regards, PLOS ONE Editorial Office Staff on behalf of Dr. Kandasamy Ulaganathan Academic Editor PLOS ONE
  56 in total

1.  Relative expression software tool (REST) for group-wise comparison and statistical analysis of relative expression results in real-time PCR.

Authors:  Michael W Pfaffl; Graham W Horgan; Leo Dempfle
Journal:  Nucleic Acids Res       Date:  2002-05-01       Impact factor: 16.971

2.  Evaluation of the role of CYP6B cytochrome P450s in pyrethroid resistant Australian Helicoverpa armigera.

Authors:  Vladimir D Grubor; David G Heckel
Journal:  Insect Mol Biol       Date:  2007-02       Impact factor: 3.585

3.  Nitrogen deficiency enhances expression of specific MYB and bHLH transcription factors and accumulation of end products in the flavonoid pathway.

Authors:  Unni S Lea; Rune Slimestad; Pål Smedvig; Cathrine Lillo
Journal:  Planta       Date:  2006-10-20       Impact factor: 4.116

4.  Antixenosis and antibiosis response of common bean (Phaseolus vulgaris) to two-spotted spider mite (Tetranychus urticae).

Authors:  Marie Shoorooei; Abdul Hadi Hoseinzadeh; Reza Maali-Amiri; Hossein Allahyari; Masoud Torkzadeh-Mahani
Journal:  Exp Appl Acarol       Date:  2018-03-09       Impact factor: 2.132

5.  Independently evolved virulence effectors converge onto hubs in a plant immune system network.

Authors:  M Shahid Mukhtar; Anne-Ruxandra Carvunis; Matija Dreze; Petra Epple; Jens Steinbrenner; Jonathan Moore; Murat Tasan; Mary Galli; Tong Hao; Marc T Nishimura; Samuel J Pevzner; Susan E Donovan; Lila Ghamsari; Balaji Santhanam; Viviana Romero; Matthew M Poulin; Fana Gebreab; Bryan J Gutierrez; Stanley Tam; Dario Monachello; Mike Boxem; Christopher J Harbort; Nathan McDonald; Lantian Gai; Huaming Chen; Yijian He; Jean Vandenhaute; Frederick P Roth; David E Hill; Joseph R Ecker; Marc Vidal; Jim Beynon; Pascal Braun; Jeffery L Dangl
Journal:  Science       Date:  2011-07-29       Impact factor: 47.728

6.  Transcriptome analysis of the Brassica napus-Leptosphaeria maculans pathosystem identifies receptor, signaling and structural genes underlying plant resistance.

Authors:  Michael G Becker; Xuehua Zhang; Philip L Walker; Joey C Wan; Jenna L Millar; Deirdre Khan; Matthew J Granger; Jacob D Cavers; Ainsley C Chan; Dilantha W G Fernando; Mark F Belmonte
Journal:  Plant J       Date:  2017-03-27       Impact factor: 6.417

7.  Characterization of the defense transcriptome responsive to Fusarium oxysporum-infection in Arabidopsis using RNA-seq.

Authors:  Qian-Hao Zhu; Stuart Stephen; Kemal Kazan; Gulei Jin; Longjiang Fan; Jennifer Taylor; Elizabeth S Dennis; Chris A Helliwell; Ming-Bo Wang
Journal:  Gene       Date:  2012-10-27       Impact factor: 3.688

8.  Characterization of a small auxin-up RNA (SAUR)-like gene involved in Arabidopsis thaliana development.

Authors:  Marios Nektarios Markakis; Agnieszka Karolina Boron; Bram Van Loock; Kumud Saini; Susanna Cirera; Jean-Pierre Verbelen; Kris Vissenberg
Journal:  PLoS One       Date:  2013-11-27       Impact factor: 3.240

9.  The genome of Tetranychus urticae reveals herbivorous pest adaptations.

Authors:  Miodrag Grbić; Thomas Van Leeuwen; Richard M Clark; Stephane Rombauts; Pierre Rouzé; Vojislava Grbić; Edward J Osborne; Wannes Dermauw; Phuong Cao Thi Ngoc; Félix Ortego; Pedro Hernández-Crespo; Isabel Diaz; Manuel Martinez; Maria Navajas; Élio Sucena; Sara Magalhães; Lisa Nagy; Ryan M Pace; Sergej Djuranović; Guy Smagghe; Masatoshi Iga; Olivier Christiaens; Jan A Veenstra; John Ewer; Rodrigo Mancilla Villalobos; Jeffrey L Hutter; Stephen D Hudson; Marisela Velez; Soojin V Yi; Jia Zeng; Andre Pires-daSilva; Fernando Roch; Marc Cazaux; Marie Navarro; Vladimir Zhurov; Gustavo Acevedo; Anica Bjelica; Jeffrey A Fawcett; Eric Bonnet; Cindy Martens; Guy Baele; Lothar Wissler; Aminael Sanchez-Rodriguez; Luc Tirry; Catherine Blais; Kristof Demeestere; Stefan R Henz; T Ryan Gregory; Johannes Mathieu; Lou Verdon; Laurent Farinelli; Jeremy Schmutz; Erika Lindquist; René Feyereisen; Yves Van de Peer
Journal:  Nature       Date:  2011-11-23       Impact factor: 49.962

10.  Unravelling the Complexity of Plant Defense Induced by a Simultaneous and Sequential Mite and Aphid Infestation.

Authors:  Małgorzata Kiełkiewicz; Anna Barczak-Brzyżek; Barbara Karpińska; Marcin Filipecki
Journal:  Int J Mol Sci       Date:  2019-02-13       Impact factor: 5.923

View more
  5 in total

1.  Transcriptome Analysis of Fusarium Root-Rot-Resistant and -Susceptible Alfalfa (Medicago sativa L.) Plants during Plant-Pathogen Interactions.

Authors:  Wenyu Zhang; Zicheng Wang; Zhencuo Dan; Lixia Zhang; Ming Xu; Guofeng Yang; Maofeng Chai; Zhenyi Li; Hongli Xie; Lili Cong
Journal:  Genes (Basel)       Date:  2022-04-28       Impact factor: 4.141

Review 2.  Plant Defenses Against Tetranychus urticae: Mind the Gaps.

Authors:  M Estrella Santamaria; Ana Arnaiz; Irene Rosa-Diaz; Pablo González-Melendi; Gara Romero-Hernandez; Dairon A Ojeda-Martinez; Alejandro Garcia; Estefania Contreras; Manuel Martinez; Isabel Diaz
Journal:  Plants (Basel)       Date:  2020-04-07

3.  Comparative Analysis Delineates the Transcriptional Resistance Mechanisms for Pod Borer Resistance in the Pigeonpea Wild Relative Cajanus scarabaeoides (L.) Thouars.

Authors:  Isaac Njaci; Abigail Ngugi-Dawit; Richard O Oduor; Leah Kago; Brett Williams; Linh Thi My Hoang; Sagadevan G Mundree; Sita R Ghimire
Journal:  Int J Mol Sci       Date:  2020-12-30       Impact factor: 5.923

4.  Editorial: Plant-Pest Interactions Volume I: Acari and Thrips.

Authors:  George Broufas; Felix Ortego; Takeshi Suzuki; Guy Smagghe; Colette Broekgaarden; Isabel Diaz
Journal:  Front Plant Sci       Date:  2022-01-12       Impact factor: 5.753

5.  Mycorrhizal Symbiosis Triggers Local Resistance in Citrus Plants Against Spider Mites.

Authors:  María Manresa-Grao; Julia Pastor-Fernández; Paloma Sanchez-Bel; Josep A Jaques; Victoria Pastor; Víctor Flors
Journal:  Front Plant Sci       Date:  2022-07-01       Impact factor: 6.627

  5 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.