Murine Surf4 is essential for early embryonic development.

Newly synthesized proteins co-translationally inserted into the endoplasmic reticulum (ER) lumen may be recruited into anterograde transport vesicles by their association with specific cargo receptors. We recently identified a role for the cargo receptor SURF4 in facilitating the secretion of PCSK9 in cultured cells. To examine the function of SURF4 in vivo, we used CRISPR/Cas9-mediated gene editing to generate mice with germline loss-of-function mutations in Surf4. Heterozygous Surf4+/- mice exhibit grossly normal appearance, behavior, body weight, fecundity, and organ development, with no significant alterations in circulating plasma levels of PCSK9, apolipoprotein B, or total cholesterol, and a detectable accumulation of intrahepatic apoliprotein B. Homozygous Surf4-/- mice exhibit embryonic lethality, with complete loss of all Surf4-/- offspring between embryonic days 3.5 and 9.5. In contrast to the milder murine phenotypes associated with deficiency of known SURF4 cargoes, the embryonic lethality of Surf4-/- mice implies the existence of additional SURF4 cargoes or functions that are essential for murine early embryonic development.

Introduction

The coatomer protein complex II (COPII) coat assembles on the cytoplasmic surface of endoplasmic reticulum (ER) exit sites to drive the formation of membrane-bound transport vesicles. Efficient recruitment of proteins and lipids into these vesicles occurs via physical interaction with the COPII coat[1]. For cargoes accessible on the cytoplasmic surface of the ER membrane, this interaction may be direct. For soluble cargoes in the ER lumen, however, transmembrane cargo receptors serve as intermediaries for this interaction[2]. Although thousands of human proteins traffic through the secretory pathway, a corresponding cargo receptor has been identified for only a few, and the size and identity of the cargo repertoire for each individual cargo receptor remains largely unknown.

Through unbiased genome-scale CRISPR screening, we recently discovered a role for the ER cargo receptor Surfeit locus protein 4 (SURF4) in the secretion of Proprotein convertase subtilisin/kexin type 9 (PCSK9)[3], a protein that modulates mammalian cholesterol homeostasis through its negative regulation of the Low-density lipoprotein receptor (LDLR)[4]. Consistent with a role as a PCSK9 cargo receptor, SURF4 was found to localize to the ER and the ER-Golgi intermediate compartment, to physically associate with PCSK9, and to promote the ER exit and extracellular secretion of PCSK9. These experiments relied on heterologous expression of PCSK9 in HEK293T cells, however, and the physiologic relevance of this interaction in vivo remains uncertain. Additionally, although SURF4 deletion did not affect the secretion of a control protein, alpha-1 antitrypsin, a broader role for SURF4 in protein secretion remains possible and is supported by the recent identification of other potential cargoes including apolipoprotein B, growth hormone, dentin sialophosphoprotein, and amelogenin[5, 6].

To investigate the physiologic functions of SURF4, we generated mice with targeted disruption of the Surf4 gene. We found that partial loss of SURF4 in heterozygous mice led to a modest accumulation of intrahepatic apolipoprotein B, with no effect on steady state plasma levels. However, complete genetic deletion of Surf4 resulted in early embryonic lethality.

Results

Generation of mice with germline deletion of Surf4

The Mus musculus Surf4 gene is composed of 6 exons and 5 introns spanning approximately 14 kb in the tightly clustered surfeit gene locus on chromosome 2[7, 8]. We targeted exon 2 of Surf4 for CRISPR/Cas-mediated mutagenesis (Fig 1A), verified sgRNA efficiency in embryonic stem (ES) cells (Fig 1B and 1C), and generated mice from microinjected zygotes. Sanger sequencing identified 4 of 57 mice with disruption of the target site (Fig 1D). These mice were then mated to C57BL/6J wild-type mice and their progeny genotyped, confirming germline transmission for each of the 4 alleles (Fig 1E). Two alleles introduced frameshift deletions both leading to early termination codons, with the other alleles containing in-frame deletions of 3 and 6 DNA base pairs, respectively.

Fig 1

Generation of Surf4 mutant alleles.

(A) Surf4 gene structure. Exons are shaded light blue for untranslated regions or dark blue for coding sequence. The target site for the sgRNA used for oocyte editing is indicated by the black triangle. (B) Mouse ES cells were either untreated or electroporated with plasmids for CRISPR/Cas9 disruption of the Surf4 target site. PCR amplification of genomic DNA or water control across the Surf4 target site revealed higher and lower molecular weight DNA fragments suggestive of nonhomologous endjoining repair of Surf4 indels. (C) The major PCR product was gel purified and subjected to T7 endonuclease I digestion. T7E1 digestion produced novel DNA fragments (arrows) indicating the presence of insertions/deletions in Surf4 exon 2. Wild type DNA was resistant to T7E1 digestion. (D) Sanger sequencing chromatograms of Surf4 target site amplicons of progeny from matings between Surf4-targeted founder mice and wild-type C57BL6/J mice. (E) DNA and predicted protein sequences for the 4 individual allele generated by CRISPR/Cas9 gene-editing of Surf4.

Effect of SURF4 haploinsufficiency on cholesterol regulation

Surf4+/- mice were observed at expected Mendelian ratios at weaning (Table 1) and exhibited grossly normal appearance, behavior, and organ development by necropsy. Analysis of mRNA from Surf4+/- mouse liver tissue confirmed a reduction in total Surf4 transcripts with a relative decrease in the mutant allele, consistent with nonsense-mediated decay (Fig 2). Surf4+/- mice heterozygous for the del(1) allele also showed no significant differences in plasma PCSK9, cholesterol, and apolipoprotein B levels compared to Surf4+/+ litter-mate controls (Fig 3). Similarly, no differences were seen in the intrahepatic accumulation of the putative SURF4 cargo, PCSK9, or its downstream target, LDL receptor. In contrast, despite its normal steady state levels in plasma, an approximately 3-fold increase in intrahepatic apolipoprotein B was observed in Surf4+/- mice (Fig 4), consistent with selective retention of this putative SURF4 cargo in the setting of Surf4 haploinsufficiency.

Table 1

Mice heterozygous for each of 3 independent Surf4 targeted alleles are observed at expected Mendelian ratios at weaning.

Mice heterozygous for the indicated Surf4 allele were crossed with wild-type C57BL/6J mice and the resulting litters genotyped for the corresponding Surf4 alleles at approximately 2 weeks of age. The proportion of mice with the heterozygous mutant genotype was compared to expected Mendelian ratios by the chi-square test.

Surf4+/- x Surf4+/+
Allele	Progeny		p (Χ2)
	+/+	+/-
del (3)	36	39	0.81
del (6)	22	15	0.41
del (1)	19	18	0.91

Fig 2

Surf4+/- mice exhibit partial reduction of Surf4 transcripts with preferential loss of the mutant allele.

Sanger sequencing of the Surf4 target site was performed on PCR amplicons derived from genomic DNA (A) or reverse-transcribed cDNA (B) prepared from liver tissue of 3 Surf4+/- mice. Decomposition of chromatograms was performed to quantify the relative proportion of each allele in each sample. (C) Total Surf4 transcript levels in liver tissue from 4 Surf4+/+ and 4 Surf4+/- mice were quantified and normalized to a panel of housekeeping genes by qRT-PCR.

Fig 3

Surf4 haploinsufficiency does not affect baseline plasma levels for PCSK9, ApoB, or cholesterol levels.

Plasma samples collected from 10 Surf4 mice (heterozygous for the del(1) allele) and 6 wild-type littermate controls were assayed for plasma levels of total cholesterol (A), PCSK9 (B), and ApoB (C). Values were measured and averaged for each of two independent phlebotomies from each mouse. Both male and female mice were tested for each genotype. Significance testing was calculated by Student’s t-test between genotype groups.

Fig 4

Surf4 haploinsufficiency causes hepatic accumulation of apolipoprotein B but not PCSK9.

Liver lysates from 3 male Surf4 mice harboring the del(1) allele and 3 male Surf4 littermate controls were immunoblotted for PCSK9, LDL receptor, apolipoprotein B, and alpha-tubulin. Densitometry values for PCSK9, LDLR, and apolipoprotein B were normalized to alpha-tubulin. Significance testing was performed by Student’s t-test between genotype groups.

Surf4 function is required for embryonic development

Intercrosses were performed for Surf4+/- mice carrying each of the 3 independent Surf4 deletion alleles described above. Genotyping at the time of weaning demonstrated the expected number of heterozygous progeny, with complete absence of homozygous Surf4-/- pups (Table 2). Timed matings of mice heterozygous for the del(1) allele were performed, with no Surf4-/- embryos identified at E9.5 or later (Table 3). However, analysis of E3.5 blastocysts generated by in vitro fertilization revealed the expected proportion of Surf4-/- genotypes with no gross morphologic abnormalities on visual assessment by an experienced expert in murine embryology Thus, complete genetic deficiency of Surf4 results in embryonic lethality occurring sometime between E3.5 and E9.5.

Table 2

Germline deletion of Surf4 causes embryonic lethality.

Mice heterozygous for the indicated Surf4 alleles were intercrossed and progeny genotyped for Surf4 at weaning. The proportion of mice with the homozygous null genotype was compared to expected Mendelian ratios by the chi-square test.

Surf4+/- x Surf4+/-
Allele	Stage	Progeny			p (Χ2)
		+/+	+/-	-/-
del (3)	weaning	9	22	0	<0.01
del (6)	weaning	12	32	0	<0.01
del (1)	weaning	40	72	0	<0.01

Table 3

Germline deletion of Surf4 results in lethality between embryonic day 3.5 and 9.5.

Timed matings were performed between Surf4+/- mice carrying the del(1) allele and embryos harvested at E9.5, E12.5, E.14.5 or at the time of weaning. For analysis at E3.5, blastocysts were collected following in vitro fertilization of oocytes from Surf4+/- females with sperm from Surf4+/- males. The proportion of mice with the homozygous null genotype was compared to expected Mendelian ratios by the chi-square test.

Surf4+/- x Surf4+/-
Allele	Stage	Progeny			p (Χ2)
		+/+	+/-	-/-
del (1)	weaning	40	72	0	<0.01
	E14.5	2	3	0	>0.99
	E12.5	3	12	0	0.100
	E9.5	5	15	0	0.047
	E3.5	1	7	4	>0.99

Discussion

Identification of the molecular machinery underlying eukaryotic protein secretion has been elucidated by elegant work in model systems including yeast and cultured mammalian cells. Recent characterizations of mice with genetic deficiency of COPII components have extended these findings to mammalian physiology, revealing a variety of complex phenotypes[9-18]. Comparatively little is known about the physiologic role of mammalian cargo receptors in vivo. In humans, genetic deletion of either subunit of a cargo receptor complex, LMAN1/MCFD2, results in a rare bleeding disorder due to the impaired secretion of coagulation factors V and VIII[19, 20], with a similar phenotype in Lman1 and MCFD2 mice[21, 22].

We set out to investigate the physiologic function of murine SURF4 in vivo, with a particular focus on its putative function in the secretion of PCSK9[3] and apolipoprotein B[6], both of which play central roles in mammalian cholesterol regulation. We generated multiple independent gene targeted Surf4 alleles, with heterozygous Surf4+/- mice exhibiting no gross developmental abnormalities and normal circulating levels of cholesterol, PCSK9, and apolipoprotein B. Consistent with our observations that SURF4 haploinsufficiency is well-tolerated in mice, a number of loss-of-function variants have been observed in human SURF4, including a p.Gln185Ter nonsense variant with an allele frequency of 0.1%[23]. Of note, previous human genome-wide association studies for lipid traits have not detected a significant signal near the SURF4 gene[24].

To assess the impact of Surf4 haploinsufficiency on the physiologic secretion of putative cargoes, we measured the levels of PCSK9 and apolipoprotein B in circulation and in the liver.

We found that plasma and intrahepatic levels of PCSK9 were unaffected by partial SURF4 reduction in Surf4 mice. The Surf4 exon targeted by our gene editing approach is expressed in all currently annotated mouse Surf4 splice variants (Ensembl release 98[25]). Analysis of liver mRNA from Surf4+/- mice confirmed a reduction in total Surf4 transcript levels, with reduced levels of the mutant allele relative to the wild-type allele consistent with nonsense-mediated decay (Fig 2). This observation is similar to the normal plasma levels of LMAN1 cargo proteins reported in heterozygous Lman1+/- mice[21]. In contrast, we found that apolipoprotein B accumulated approximately 3-fold in liver cell lysates prepared from Surf4+/- mice compared to controls, suggesting greater sensitivity of apolipoprotein B than PCSK9 to partial SURF4 depletion. Nonetheless, plasma levels of apolipoprotein B and total cholesterol were unaffected by haploinsufficiency for Surf4, possibly due to downstream effects on complex cholesterol regulatory pathways which could alter the rate of clearance and/or expression of ApoB or other related components of this network. Together, these observations indicate a complexity in the degree of dependence of different cargoes on the partial or complete reduction of their corresponding cargo receptor. The mechanistic basis for this variability remains unknown but may be related to different stoichiometries or cargo receptor binding affinities.

In cultured cells, secretion defects of PCSK9[3] and apolipoprotein B[6] are observed upon complete deletion of SURF4. Our attempts to generate adult mice with complete loss of Surf4 were precluded by the embryonic lethality caused by Surf4 deletion. A loss of Surf4-/- mice at weaning was unlikely to have been caused by a linked spontaneous or off-target CRISPR-generated passenger mutation[26] as this phenotype was observed for each of 3 independent alleles. Timed matings revealed that loss of Surf4-/- embryos occurs between E3.5 and E9.5. The mechanism for this observation is unclear. Deficiency of the SURF4 homologue SFT-4 is similarly associated with embryonic lethality in C. elegans[6], but SURF4 is not essential for cellular viability in cultured HEK293T cells[3, 5] and its homologue, Erv29p, is dispensable in yeast[27, 28]. Deficiencies of PCSK9 or apoliporotein B alone cannot account for this developmental phenotype, given that PCSK9-/- mice are viable[29] and that ApoB-/- mice survive past E9.5[30]. Likewise, mice with genetic deletion of 3 other putative SURF4 cargoes, growth hormone[31], amelogenin[32], and dental sialophosphoprotein[33], are viable. The embryonic lethality of SURF4 deficiency may therefore result from additive effects of disrupted secretion of known cargoes, or the presence of additional unknown SURF4 cargoes or functions that are essential for early embryonic development. A role for SURF4 in global protein secretion is unlikely, as previous studies demonstrated no effect of SURF4 deletion on the secretion of a number of other proteins[3, 5]. A broader role for SURF4 in the secretion of additional unknown cargoes however is suggested by the observation that SURF4 has been evolutionarily conserved in yeast and other organisms lacking homologues of PCSK9. An N-terminal tripeptide “ER-ESCAPE motif”, present on a large number of potential cargoes, has recently been proposed to mediate cargo recruitment by SURF4[5]. A comprehensive identification of SURF4 cargoes and the nature of their interaction with SURF4 should clarify the function of SURF4 in cholesterol regulation and in mammalian development.

Materials and methods

Generation of Surf4 mutant mice

All animal protocols used in this study were approved by the University of Michigan Committee on the Use and Care of Animals. We used CRISPR/Cas9 technology[34, 35] to generate a new genetically modified mouse strain with a Surf4 gene knockout. The presence of a premature termination codon in exon 2 is predicted to result in loss of protein expression due to nonsense mediated decay of mRNA[36]. A single guide RNA (sgRNA) target and protospacer adjacent motif was identified in exon 2 (ENSMUSE00000232711.1) with CRISPOR[37]. The sgRNA is 5’ CTGCCTGATCAGCACCTTCC TGG 3’ on the non-coding strand (chromosome 2; coordinates 26926892–26926911) with a predicted cut site 47 bp downstream of the first exon 2 codon. The sgRNA target was cloned into plasmid pX330 (Addgene.org plasmid #42230, a kind gift of Feng Zhang) as described[38]. The sgRNA was validated in mouse JM8.A3 ES cells[39] prior to use for mouse zygote microinjection. The sgRNA plasmid (15 μg) was electroporated into 8 X 10E6 ES cells. To the electroporation, 5 μg of a PGK1-puromycin resistance plasmid[40] was added for transient puromycin selection (2 μg/ml puromycin applied 48–72 hours after electroporation). ES cell culture and electroporation was carried out as described[41]. After selection, DNA was extracted from surviving cells, PCR was used to amplify the sequences across the sgRNA cut site, and T7 endonuclease 1 assays were used to detect small deletions/insertions at the predicted Cas9 DNA cut site[42]. The circular sgRNA plasmid was resuspended in microinjection buffer as described[43]. The plasmid mixture was used for pronuclear microinjection of zygotes obtained from the mating of superovulated C57BL/6J female mice (The Jackson Laboratory Stock No. 0006640) and C57BL/6J male mice as described[44]. A total of 305 zygotes were microinjected and 285 zygotes were transferred to pseudopregnant B6D2F1 female mice (The Jackson Laboratory Stock No. 100006). 18 mouse pups were born and four of them transmitted gene edited Surf4 alleles.

Mouse genotyping

Surf4 genotyping was performed by PCR of genomic DNA with primers mSurf4-ex2-for [TGCTGAGGGCCTCTCTGTCT] and mSurf4-ex2-rev [CAGGTAGCCACAGCTCCAGG]. Sanger sequencing was performed with the same genotyping primers and chromatograms were inspected both manually and by automated deconvolution[45] to determine the presence or absence of target site indels.

Analysis of Surf4+/- mice

Mice were housed and monitored in accordance with University of Michigan Unit of Laboratory Animal Medicine (ULAM) guidelines. Blood was collected at 6–12 weeks of age by retro-orbital bleeding into heparin-coated collection tubes from mice anesthetized with isoflurane. Plasma was prepared by centrifugation at 2,000 g for 10 min at 4°C. A second blood collection was performed 1 week following the initial collection. Plasma samples were analyzed by total cholesterol colorimetric assay (SB-1010-225, Fisher Scientific, Hampton NH) and ELISAs for PCSK9 (MPC900, R&D Systems, Minneapolis MN) and apolipoprotein B (ab230932, Abcam, Cambridge UK). Liver tissue was perfused with PBS and harvested from mice at the time of sacrifice. Liver mRNA was prepared with RNeasy Plus Mini Kit (Qiagen, Hilden, Germany) and oligo(dT)-primed first strand cDNA generated with Superscript III reverse transcriptase (Invitrogen, Carlsbad CA) according to manufacturer’s instructions. Quantitative PCR was performed using 20 ng of cDNA per reaction with PowerSYBR Green PCR Master Mix (Applied Biosystems, Foster City CA). Normalization of qPCR data was performed using a panel of 4 selected housekeeping genes[46]. The relative proportion of each Surf4 allele was quantified by decomposition of Sanger sequencing chromatograms with TIDE indel analysis[45]. The primer sequences for qRT-PCR were: Surf4-forward [CTGTTGGCCTCATCCTTCGT], Surf4-reverse [GGCAATTGTCTGCAGTGCG], Actb-forward [CCACTGCCGCATCCTCTTCC], Actb-reverse [CTCGTTGCCAATAGTGATGACCTG], B2m-forward [CATGGCTCGCTCGGTGACC], B2m-reverse [AATGTGAGGCGGGTGGAACTG], Tbp-forward [CCCCACAACTCTTCCATTCT], Tbp-reverse [GCAGGAGTGATAGGGGTCAT], Ppia-forward [CAAATGCTGGACCAAACACAAACG], Ppia-reverse [GTTCATGCCTTCTTTCACCTTCCC].

Protein lysates were prepared from liver tissue by mechanical homogenization, resuspension in RIPA lysis buffer (Pierce Manufacturing, Appleton WI), and collection of supernatant after centrifugation for 15 minutes at 21,000xg. Protein concentrations of lysates were measured by DC Protein Assay (5000111, Bio-Rad Laboratories, Hercules CA). Equal amounts of lysate were analyzed by immunoblotting with antibodies against Apolipoprotein B (70R-15771, 1:1000, Fitzgerald Industries International, Acton MA), PCSK9 (ab31762, 1:1000, Abcam), LDLR (ab52818, 1:1000, Abcam), and alpha-tubulin (ab176560, 1:2000, Abcam) and densitometry analysis performed with ImageJ[47].

Timed matings and in vitro fertilization

For analysis of embryonic day 9.5 and later, Surf4+/- male and female mice were co-housed overnight and females with copulatory vaginal plugs the following morning were assigned embryonic day 0.5. Pregnant females were then sacrificed at indicated time points and genomic DNA prepared from isolated embryos. For analysis of embryonic day 3.5, Surf4+/- females were superovulated with anti-inhibin serum as described[48]. The collected oocytes were fertilized with sperm from Surf4+/- males as described[49]. Resulting fertilized eggs were maintained in cell culture in KSOM medium (Zenith Biotech) until visual inspection, harvesting, and genomic DNA preparation from blastocysts at embryonic day 3.5.

22 Aug 2019

PONE-D-19-17413

Murine Surf4 is essential for early embryonic development

PLOS ONE

Dear Dr. Emmer,

Thank you for submitting your manuscript to PLOS ONE. After careful consideration, we feel that it has merit but does not fully meet PLOS ONE’s publication criteria as it currently stands. Therefore, we invite you to submit a revised version of the manuscript that addresses the points raised during the review process.

As you will read, both reviewer point the same critique: to show the effect of the heterozygous condition of Surf4 at the protein level to support your analysis. It is not clear to me if you have observed this early homozygote lethality with another clone of Surf4 inactivation or in another genetic background.It would be nice to indicate this information clearly.

We would appreciate receiving your revised manuscript by Oct 06 2019 11:59PM. When you are ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file.

If you would like to make changes to your financial disclosure, please include your updated statement in your cover letter.

To enhance the reproducibility of your results, we recommend that if applicable you deposit your laboratory protocols in protocols.io, where a protocol can be assigned its own identifier (DOI) such that it can be cited independently in the future. For instructions see: http://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocols

Please include the following items when submitting your revised manuscript:

A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). This letter should be uploaded as separate file and labeled 'Response to Reviewers'.

A marked-up copy of your manuscript that highlights changes made to the original version. This file should be uploaded as separate file and labeled 'Revised Manuscript with Track Changes'.

An unmarked version of your revised paper without tracked changes. This file should be uploaded as separate file and labeled 'Manuscript'.

Please note while forming your response, if your article is accepted, you may have the opportunity to make the peer review history publicly available. The record will include editor decision letters (with reviews) and your responses to reviewer comments. If eligible, we will contact you to opt in or out.

We look forward to receiving your revised manuscript.

Kind regards,

Yann Herault

Academic Editor

PLOS ONE

Journal Requirements:

When submitting your revision, we need you to address these additional requirements.

Please ensure that your manuscript meets PLOS ONE's style requirements, including those for file naming. The PLOS ONE style templates can be found at

http://www.journals.plos.org/plosone/s/file?id=wjVg/PLOSOne_formatting_sample_main_body.pdf and http://www.journals.plos.org/plosone/s/file?id=ba62/PLOSOne_formatting_sample_title_authors_affiliations.pdf

1. Please include your tables as part of your main manuscript and remove the individual files. Please note that supplementary tables (should remain/ be uploaded) as separate "supporting information" files

[Note: HTML markup is below. Please do not edit.]

Reviewers' comments:

Reviewer's Responses to Questions

Comments to the Author

1. Is the manuscript technically sound, and do the data support the conclusions?

The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented.

Reviewer #1: Partly

Reviewer #2: Partly

**********

2. Has the statistical analysis been performed appropriately and rigorously?

Reviewer #1: Yes

Reviewer #2: Yes

**********

3. Have the authors made all data underlying the findings in their manuscript fully available?

The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified.

Reviewer #1: Yes

Reviewer #2: Yes

**********

4. Is the manuscript presented in an intelligible fashion and written in standard English?

PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here.

Reviewer #1: Yes

Reviewer #2: Yes

**********

5. Review Comments to the Author

Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters)

Reviewer #1: PLoS One Review of Murine Surf4 is essential for early embryonic development (Emmer et al)

In this manuscript the authors generate a null allele of Surf2, an ER cargo receptor and one they previously identified as interacting with PCSK9 and thus one that may have important roles in cholesterol homeostasis. Overexpression and deletion of Surf2 in cell lines were supportive of this role and they sought to determine if this role was recapitulated in the mouse. They generated 4 lines via a Crispr strategy including 4 putative null lines. Heterozygous animals were generated at expected frequencies but null mice were early embryonic lethal. They find that hets have no changes in plasma levels of cholesterol, PCSK9 or ApoB but do observe significant changes in the abundance of ApoB in the livers of het mice.

This paper represents a natural extension of their previous findings and should be of interest to the same audience.

Several Major issues include:

1) The authors do not present evidence SURF4 is reduced in hets. They do, however repeatedly state that SURF4 (protein) is reduced in heterozygous animals. This information is critical to support the conclusions made herein.

2) To make definitive conclusions, the heterozygote data presented with a single line should be performed with more than one of the founder lines. The sex and number of animals used in Figs 2 and 3 should also be provided.

3) No methodology is provide for the data presented in Figure 3. The authors state that liver cell lysates were produced in the text but no information on the antibodies or assays used were provided. It would be important to include a blot demonstrating a reduction in SURF4 in Hets in this figure.

4) Images of the mutant blastocysts that were created via IVF should be provided in order for experts to decide if there are obvious defects.

Other

Abbreviations should be named prior to use: SURF2, ERGIC, LDLR, PCSK9 etc are never defined.

Reviewer #2: The manuscript “Murine Surf4 is essential for early embryonic development” by Emmer et al describes the generation of a new mouse knockout model for the anterograde cargo receptor SURF4. The authors used CRISPR/Cas-mediated mutagenesis to target exon2 of the Surf4 gene, generating 4 gene-edited lines (Fig. 1). They then analyzed one of those lines in heterozygous adult mice, by assessing plasma samples for total cholesterol, PCSK9, and ApoB (Fig. 2). PCSK9 and ApoB are two candidate proteins that are predicted to be trafficked by SURF4 from the ER to Golgi based on published literature, and total cholesterol could have been impacted if PCSK9 and ApoB were not synthesized and secreted properly by SURF4-mutant cells. Seeing no effects on Surf4+/- plasma, they analyzed total liver lysates for ApoB, PCSK9, and LDLR (which is regulated by PCSK9) by western blotting (Fig. 3). They found an aberrant accumulation of ApoB in the liver lysates, although this did not affect circulating ApoB levels, as demonstrated by the plasma ELISAs. The authors could not analyze Surf4-/- mice because they were not recovered at weaning from three of their mutant lines (Table 2). They analyzed one of the lines with timed matings to assess when the Surf4-/- embryos died but could not recover live or partially resorbed Surf4-/- embryos at E9.5—the earliest timepoint they analyzed. They also performed in vitro fertilization with Surf4+/- oocytes and sperm and cultured fertilized eggs for 3 days until the blastocyst stage. This approach did generate Surf4-/- blastocysts, so the authors concluded that Surf4-/- embryos died en utero between E3.5 and E9.5 from unknown causes.

This manuscript provides the first description of a Surf4-deficient mouse, which is a critical reagent for interpreting the in vitro data that has been generated on SURF4 and its function in different cell types. The authors particularly hoped to validate that the PCSK9 protein—which they had described as being trafficked by SURF4 in vitro (Emmer et al, Elife, 2018)—would also be found to be trafficked in vivo, with possible implications for LDLR surface expression and plasma cholesterol levels. However, the Surf4+/- mice they analyzed did not support a critical role for SURF4 in this capacity. They did, however, find accumulation of ApoB in the livers of Surf4+/- mice, which supports published evidence that SURF4 helps to traffic ApoB for proper secretion from hepatocytes (Saegusa et al, J Cell Biol, 2018). Curiously, this did not alter circulating ApoB plasma levels or cholesterol levels, which the authors could not explain. Altogether, the conclusion from these analyses is that Surf4 haploinsufficiency does not impact total cholesterol levels in circulation.

While I appreciate the importance of the new Surf4-mutant lines that this manuscript describes, I would have liked to have seen a better analysis of those lines. Specifically, I wish the authors had made some effort to confirm the reduction of SURF4 in their heterozygous adult mice—either by immunoblotting or qPCR. The Surf4-/- blastocysts they generated also could have been analyzed by qPCR. I believe that more careful validation of the mutant lines and of Surf4 reduction is important because Surf4 is known to be subject to alternative splicing (Garson et al, Gene Expr, 1996). In addition, I found the developmental analysis of Surf4-/- embryos to be perfunctory. The fact that no partially resorbed Surf4-/- embryos could be recovered at E9.5 suggests that the embryos die much earlier—potentially around implantation. I found the in vitro generation of Surf4-/- blastocysts to be an interesting approach to assessing survivability of Surf4-/- embryos at early stages of development, although the artificiality of this approach could be misleading in interpreting early Surf4-/- embryonic development. Instead, I would have preferred to see the authors flush blastocysts from pregnant mice at E3.5 to assess the feasibility of early Surf4-/- development. Furthermore, analysis of embryos at peri-implantation (E5.5-6.5) would be a significant improvement to this study, since it would clarify whether Surf4-/- embryos can implant. Methods for dissecting peri-implantation mouse embryos are well described (Shea and Geijsen, JoVE, 2007). Altogether, better analysis of the timepoint at which Surf4-/- embryos die would assist in future studies that will elucidate SURF4 cargo proteins that are critical for early development.

**********

6. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.

If you choose “no”, your identity will remain anonymous but your review may still be made public.

Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.

Reviewer #1: No

Reviewer #2: No

[NOTE: If reviewer comments were submitted as an attachment file, they will be attached to this email and accessible via the submission site. Please log into your account, locate the manuscript record, and check for the action link "View Attachments". If this link does not appear, there are no attachment files to be viewed.]

While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com/. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Registration is free. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email us at figures@plos.org. Please note that Supporting Information files do not need this step.

14 Nov 2019

A full point-by-point response to editor and reviewer comments has been uploaded as a separate file.

Submitted filename: 2019_emmer_PLOS_ONE_response_to_reviewers.docx

Click here for additional data file.

19 Dec 2019

Murine Surf4 is essential for early embryonic development

PONE-D-19-17413R1

Dear Dr. Emmer,

We are pleased to inform you that your manuscript has been judged scientifically suitable for publication and will be formally accepted for publication once it complies with all outstanding technical requirements.

Within one week, you will receive an e-mail containing information on the amendments required prior to publication. When all required modifications have been addressed, you will receive a formal acceptance letter and your manuscript will proceed to our production department and be scheduled for publication.

Shortly after the formal acceptance letter is sent, an invoice for payment will follow. To ensure an efficient production and billing process, please log into Editorial Manager at https://www.editorialmanager.com/pone/, click the "Update My Information" link at the top of the page, and update your user information. If you have any billing related questions, please contact our Author Billing department directly at authorbilling@plos.org.

If your institution or institutions have a press office, please notify them about your upcoming paper to enable them to help maximize its impact. If they will be preparing press materials for this manuscript, you must inform our press team as soon as possible and no later than 48 hours after receiving the formal acceptance. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information, please contact onepress@plos.org.

With kind regards,

Yann Herault

Academic Editor

PLOS ONE

Additional Editor Comments (optional):

Please be sure to include all the methodology and technical details needed for the publication.

Reviewers' comments:

Reviewer's Responses to Questions

Comments to the Author

1. If the authors have adequately addressed your comments raised in a previous round of review and you feel that this manuscript is now acceptable for publication, you may indicate that here to bypass the “Comments to the Author” section, enter your conflict of interest statement in the “Confidential to Editor” section, and submit your "Accept" recommendation.

Reviewer #1: (No Response)

Reviewer #2: All comments have been addressed

**********

2. Is the manuscript technically sound, and do the data support the conclusions?

The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented.

Reviewer #1: Yes

Reviewer #2: Yes

**********

3. Has the statistical analysis been performed appropriately and rigorously?

Reviewer #1: Yes

Reviewer #2: Yes

**********

4. Have the authors made all data underlying the findings in their manuscript fully available?

The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified.

Reviewer #1: Yes

Reviewer #2: Yes

**********

5. Is the manuscript presented in an intelligible fashion and written in standard English?

PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here.

Reviewer #1: Yes

Reviewer #2: Yes

**********

6. Review Comments to the Author

Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters)

Reviewer #1: The authors have adequately revised the MS. Given the amount of key information that was missing from the initial submission I suggest that the authors make sure that they are providing all key methodology and reagents for the final paper.

Reviewer #2: The revised manuscript now confirms reduction of transcripts in heterozygous mice and embryonic lethality in 3 separate homozygous lines. Although the timing and cause of the embryonic lethality is still unclear, the manuscript represents a sufficient initial description of the importance of SURF4 for embryonic development. Subsequent studies with a floxed Surf4 allele will presumably clarify the cargo and role of SURF4 in development and in specific cell types.

**********

7. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.

If you choose “no”, your identity will remain anonymous but your review may still be made public.

Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.

Reviewer #1: No

Reviewer #2: No

14 Jan 2020

PONE-D-19-17413R1

Murine Surf4 is essential for early embryonic development

Dear Dr. Emmer:

I am pleased to inform you that your manuscript has been deemed suitable for publication in PLOS ONE. Congratulations! Your manuscript is now with our production department.

If your institution or institutions have a press office, please notify them about your upcoming paper at this point, to enable them to help maximize its impact. If they will be preparing press materials for this manuscript, please inform our press team within the next 48 hours. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information please contact onepress@plos.org.

For any other questions or concerns, please email plosone@plos.org.

Thank you for submitting your work to PLOS ONE.

With kind regards,

PLOS ONE Editorial Office Staff

on behalf of

Dr Yann Herault

Academic Editor

PLOS ONE