| Literature DB >> 25042988 |
Takayuki Sakurai1, Satoshi Watanabe, Akiko Kamiyoshi, Masahiro Sato, Takayuki Shindo.
Abstract
BACKGROUND: Microinjection of clustered regulatory interspaced short palindromic repeat (CRISPR)/CRISPR-associated protein 9 (Cas9)-related RNA and DNA into fertilized eggs is a novel approach for creating gene-modified mice. Blastocysts obtained just before implantation may be appropriate for testing the fidelity of CRIPSR/Cas9-mediated genome editing because they can be individually handled in vitro and obtained 3days after microinjection, thus allowing researchers to check mutations rapidly. However, it is not known whether indel mutations caused by the CRISPR/Cas9 system can be reproducibly detected in embryos. In this study, we assessed the detection of CRISPR/Cas9-induced mutations in embryos.Entities:
Mesh:
Substances:
Year: 2014 PMID: 25042988 PMCID: PMC4118159 DOI: 10.1186/1472-6750-14-69
Source DB: PubMed Journal: BMC Biotechnol ISSN: 1472-6750 Impact factor: 2.563
Figure 1Comparison of assays using Surveyor nuclease and T7 endonuclease I. A: P1 and P2 polymerase chain reaction (PCR) products (approximately 800 bp) were used as template to evaluate which nuclease provide clearer and more reproducible results. The P1 and P2 PCR products were generated by PCR of pC2EpA or pCEpA, respectively, using the 3525A and bGpA2 primer set. Both 800-bp products re-annealed were expected to cleavage into two fragments (525 and 275 bp in size) by Surveyor nuclease or T7 endonuclease I. B: Agarose gel electrophoresis of nuclease-treated PCR products. A mixture containing P1 (100 ng) and P1 (100 ng) (lane 1), P2 (100 ng) and P2 (100 ng) (lane 2), or P1 (100 ng) and P2 (100 ng) (lane 3) was re-annealed and treated with each nuclease. In addition, a mixture containing P1 (100 ng) and P2 (100 ng) was directly treated with nuclease without re-annealing (lane 4). The 2 asterisks indicate the expected 525- and 275-bp cleavage bands. The experiments were carried out 3 times. The representative results were shown here.
Figure 2Detection of CRISPR/Cas9-induced indel mutations in the murine gene at the single blastocyst level. A: Schema of the Ramp2 guide RNA (R2gRNA) targeting exon 1 in the murine Ramp2 gene. The R2gRNA-coding sequence is shown in blue. The protospacer-adjacent motif (PAM) sequence is shown in red. The arrows indicate the locations of the PCR primers (see Table 3). B: Agarose gel electrophoresis of T7 endonuclease I-treated PCR products and surveyor-treated PCR products derived from 8 individual blastocysts (see Table 1, experiment 3). Lanes 1–8: PCR products amplified from the crude DNA solution of each blastocyst. Lane NIC (no injection control): PCR product amplified from the crude DNA of a single uninjected control blastocyst. M: lambda HindIII + 100-bp ladder markers. C: Sequencing results for the PCR products shown in lanes 1–8 and NIC of (B). The result of each sample was summarized as the two Ramp2 alleles. “wt” indicates the wild-type sequence. “-” indicates base deletion. D: Gel electrophoretic pattern of DNA products after whole genome amplification (WGA) of the crude DNA shown in lanes 1–8 and NIC of (B) (top panel) and after subsequent PCR amplification (middle panel) and T7 endonuclease I digestion (bottom panel). Note that the band pattern is similar to that shown in (B). NTC (no template control) indicates the WGA product obtained using water in place of template as a negative control (top panel); no PCR products were amplified by PCR (middle panel).
Primer sequences used in this study
| 3525A | CCGAAGGTAACTGGCTTCAGCAGAGCGCAG | Optimized nuclease treatment (Figure |
| bGpA2 | AACATATGCCATATGCTGGCTGCCATGAAC | Optimized nuclease treatment (Figure |
| 5S | GCCCGAGCTGGAAGCGAGAG | CRISPR/Cas9-mediated mutation (Figure |
| 6A | AAGTAGGAAGCAGCATTAAGT | CRLSPR/Cas9-mediated mutation (Figure |
| 1S | CTGAGTTGTGATAGCTGGCA | CRISPR/Cas9-mediated HR (Figure |
| 3S | AACGTGACCTTAGCCAAGTC | CRISPR/Cas9-niediated HR (Figure |
| 2A | AGTCCAGTTGCACCAGTCCTTG | CRISPR/Cas9-mediated HR (Figure |
| 4A | GTACTCATACCAGCAAGGTAG | CRISPR/Cas9-mediated HR (Figure |
| PGKL1 | GTTGGCGCCTACCGGTGGATGTGGAATGTG | CRISPR/Cas9-mediated HR (Figure |
| PGKL2 | TGTGQGAGGCCAGAGGCCACTIGTGTAG | CRISPR/Cas9-mediated HR (Figure |
| RbGA472S | TTCCTCCTCTCCTGACTACTCCCAGTCATA | CRISPR/Cas9-mediated FIR (Figure |
| RbGA504S | CTGTCCCTCTTCTCTTATGAAGATCCCTC | CRISPR/Cas9-mediated HR (Figure |
Detection and efficiency of CRISPR/Cas9-mediated indel mutation at Ramp2 locus at blastocyst stage
| 1 | cyto | 100:50 | 25 | 19/21 (90) | 6/21 (32) |
| 2 | pn/cyto | 100:50 | 15 | 8/10 (80) | 2/8 (25) |
| 3 | pn/cyto | 200:50 | 24 | 8/17 (47) | 8/8 (100)3 |
1Injection was performed toward cyto: cytoplasm; pn/cyto pronuclei and cytoplasm.
2Mutated blastocysts were identified by both T7EndonucleaseI digestion and sequencing.
3Representative results from experiment 3 are shown in Figure 2B and C.
Dectection and efficiency of CRISPR/Cas9-mediated homologous recombination at Ramp2 locus at blastocyst stage
| 1 | pn | 100:50:10 | 22 | 15/22 (68) | 1/15 (7) |
| 2 | cyto | 100:50:10 | 20 | 8/16 (50) | 2/8 (25) |
| 3 | pn/cyto | 200:50:10 | 25 | 7/20 (35) | 4/7 (57)2 |
1Injection was performed toward pn: pronuclei; cyto: cytoplasm; pn/cyto: pronuclei and cytopalsm.
2Representative results from experiment 3 are shown in Figure 4B and C.
Figure 4Detection of CRISPR/Cas9-induced homologous recombination in murine at the single blastocyst level. A: Schema of the R2gRNA and R2HR DNA donor targeting sites in exon 1 of the murine Ramp2 gene. The R2gRNA-coding sequence is shown in blue. The PAM sequence is shown in red. The R2HR DNA donor comprises 1-kb 5′ and 3′ arms corresponding to exon 1 in the Ramp2 gene and an EGFP expression cassette. Arrows indicate the locations of the PCR primers (see Table 3). B: Fluorescence and bright-field photography of blastocysts developed from fertilized eggs after microinjection (Table 2, experiment 3). C: Gel electrophoretic pattern of PCR products corresponding to the junctional region between the 5′ (or 3′) arm and the host genome. Lanes 1–7: PCR products derived from the crude DNA of individual blastocysts. Lane NC: PCR products derived from the crude DNA of a single uninjected control blastocyst. + and –: EGFP-positive and EGFP-negative blastocysts, respectively. Note that PCR products (approximately 1.1 kb) were successfully amplified only in samples from the 4 EGFP-positive blastocysts.
Figure 3Overview of the nuclease assay for the detection of indel mutations in a single blastocyst.