Literature DB >> 31944395

Circular RNA SMARCA5 may serve as a tumor suppressor in non-small cell lung cancer.

Suiju Tong1.   

Abstract

BACKGROUND: This study aimed to investigate the correlation of circular RNA SMARCA5 (circ-SMARCA5) expression with clinicopathological characteristics and survival profiles, furthermore, to explore the function of circ-SMARCA5 on regulating cell proliferation and chemotherapy sensitivity in non-small cell lung cancer (NSCLC).
METHODS: A total of 460 NSCLC patients were retrospectively reviewed, and circ-SMARCA5 expressions in tumor tissue and adjacent tissue were detected by RT-qPCR. Clinical characteristics were collected. Disease-free survival (DFS) and overall survival (OS) were calculated. In vitro, circ-SMARCA5 overexpression and control overexpression plasmids were transfected into NCI-H1437 as well as NCI-H1299 cells, which were further treated with different concentrations of cisplatin and gemcitabine.
RESULTS: Circ-SMARCA5 expression was decreased in tumor tissues compared to adjacent tissues. Moreover, circ-SMARCA5 expression negatively correlated with tumor size, lymph node metastasis, and TNM stage, but positively correlated with DFS and OS. Subsequent analysis displayed that circ-SMARCA5 high expression independently predicted prolonged DFS and OS. In vitro, circ-SMARCA5 expression was reduced in NSCLC cell lines (NCI-H650, NCI-H1299, NCI-H1437, and A549) compared to human normal lung bronchus epithelial cell line (BEAS-2B). In NCI-H1437 and NCI-H1299 cells, cell proliferation was decreased by circ-SMARCA5 overexpression, furthermore, chemosensitivity to cisplatin and gemcitabine were enhanced in circ-SMARCA5 overexpression treated cells compared to the control cells.
CONCLUSION: Circ-SMARCA5 may serve as a tumor suppressor in NSCLC, which provides insight to the exploration of novel strategies in NSCLC management.
© 2020 The Authors. Journal of Clinical Laboratory Analysis Published by Wiley Periodicals, Inc.

Entities:  

Keywords:  cell proliferation; chemotherapy sensitivity; circular RNA SMARCA5; non-small cell lung cancer; survival

Mesh:

Substances:

Year:  2020        PMID: 31944395      PMCID: PMC7246390          DOI: 10.1002/jcla.23195

Source DB:  PubMed          Journal:  J Clin Lab Anal        ISSN: 0887-8013            Impact factor:   2.352


INTRODUCTION

Lung cancer ranks the leading cause of cancer‐related death around the world, which causes around 1.8 million deaths in 2018, and the World Health Organization (WHO) estimates that the lung cancer mortality will continue to rise, mainly as a result of some unfavorable environmental and lifestyle factors.1, 2, 3 Non‐small cell lung cancer (NSCLC), which involves 3 main types including adenocarcinoma, squamous cell carcinoma, and large‐cell carcinoma, represents 85% of new diagnosed lung cancers.2, 4, 5 Although there are various treatment modalities including surgery, chemotherapy, targeted therapies as well as immunotherapy are applied either alone or in combination for NSCLC treatment, the prognosis is still poor; the 5‐year overall survival (OS) rate ranges from 68% in patients with stage IB disease to 0% to 10% in patients with stage IVA‐IVB disease, which is quite unsatisfactory.1, 2 Thus, deeper understanding in the pathology of NSCLC and continued exploration into more effective screening for NSCLC progression are necessary, which may improve the treatment outcomes of NSCLC patients. Circular RNAs (circRNAs), the diverse class of RNA transcripts, possess limited protein‐coding function.1 Since high‐throughput sequencing and novel computational approaches achieve rapid developments, circRNAs have been known to be widely expressed in mammals, and they are implicated in numerous biological processes, including the tumorigenesis as well as cancer progression.6, 7, 8, 9, 10 Circular RNA SMARCA5 (circ‐SMARCA5), which locates on chr4: 143536451‐143543972, is a circRNA derived from the SMARCA5 gene and is also proved to be existed in lung cancer tissues and cell lines.11, 12 Circ‐SMARCA5 has been shown to be downregulated in cervical cancer cells, hepatocellular carcinoma cells as well as gastric cancer cells, and it inhibits the cell proliferation, migration as well as invasion in these cancers.11, 13, 14 Moreover, two clinical studies disclose that circ‐SMARCA5 expression is decreased in hepatocellular carcinoma tissues as well as gastric cancer tissues, and its low expression correlates with aggressive characteristics as well as worse prognosis in these patients.11, 13 These studies reveal that circ‐SMARCA5 has anti‐tumor effect in some specific cancers. For the role of circ‐SMARCA5 in NSCLC, just one study displays that circ‐SMARCA5 is downregulated in NSCLC tissues compared to the adjacent normal tissues and illustrates the tumor inhibitive effect of circ‐SMARCA5 in NSCLC cells.12 However, considering the relatively small sample size of the previous study that might cause poor statistical power, and the unclear influence of circ‐SMARCA5 on chemotherapy sensitivity in NSCLC cells, we enrolled 460 NSCLC patients to investigate the correlation of circ‐SMARCA5 expression with clinicopathological characteristics as well as survival profiles of NSCLC; furthermore, we explored the influence of circ‐SMARCA5 on regulating cell proliferation and chemotherapy sensitivity in NSCLC cells.

MATERIALS AND METHODS

Patients

Four hundred and sixty NSCLC patients who underwent resection in People's Hospital of Dongxihu District Wuhan City were reviewed in this retrospective study, between January 2011 and December 2014. The inclusion criteria of this study were as follows: (a) newly histologically diagnosed as primary NSCLC; (b) age above 18 years old; (c) underwent resection; (d) fresh tumor tissue and adjacent tissue preserved in liquid nitrogen were available; (e) medical records and follow‐up records were complete and available; and (f) without other malignancies. Meanwhile, the patients who received neoadjuvant chemotherapy or radiotherapy were excluded. This study was approved by the Institutional Review Board of People's Hospital of Dongxihu District Wuhan City, and the written informed consents were provided by patients or their legal guardians (or family members).

Data and sample collection

The clinical data at initial diagnosis were collected from medical records, which included (a) demographic characteristics (such as age, gender, history of smoke, and history of drink); (b) common chronic complications (hypertension, hyperlipidemia, and diabetes); (c) tumor features (such as pathological differentiation, tumor size, lymph node [LYN] metastasis, and TNM stage); (d) tumor markers (eg, carcinoembryonic antigen [CEA]). The fresh tumor tissue and adjacent tissue preserved in liquid nitrogen were acquired from the Pathology Department in People's Hospital of Dongxihu District Wuhan City. And the level of circ‐SMARCA5 in tumor tissue and adjacent tissue was detected by reverse transcription quantitative polymerase chain reaction (RT‐qPCR).

Grouping by circ‐SMARCA5 level in tumor tissue

According to the relative expression of circ‐SMARCA5 in tumor tissue, all patients were divided into circ‐SMARCA5 high expression group (50%‐100% quantile of circ‐SMARCA5 relative expression in tumor tissue, n = 230) and circ‐SMARCA5 low expression group (0%‐50% quantile of circ‐SMARCA5 relative expression in tumor tissue, n = 230). And the patients in circ‐SMARCA5 low expression group were further classified as low‐ (patients with 25%‐50% quantile of circ‐SMARCA5 relative expression in tumor tissue, n = 115), low‐‐ (patients with 10%‐25% quantile of circ‐SMARCA5 relative expression in tumor tissue, n = 68), and low‐‐‐ (patients with 0%‐10% quantile of circ‐SMARCA5 relative expression in tumor tissue, n = 47).

Treatment and follow‐up

After resection, all patients received appropriate adjuvant treatments according to NCCN guideline of NSCLC15 as follows: (a) for the patients in TNM stage I, observation, reresection, chemotherapy, chemoradiation, or radiotherapy was given to them based on margins status; (b) for the patients in TNM stage II, observation, chemotherapy, or chemoradiation was carried out for them based on margins status; (c) for the patients in TNM stage III, chemotherapy, radiotherapy, or chemoradiation was conducted for them based on margins status. Survival data were collected from follow‐up records, and the last follow‐up date was June 30, 2019, the median follow‐up duration was 55.0 months (ranges 2.0‐98.0 months). Disease‐free survival (DFS) was calculated from the date of resection to the date of disease recurrence, disease progression or death, and overall survival (OS) was calculated from the date of resection to the date of death.

Cell culture

Human NSCLC cell lines (NCI‐H650, NCI‐H1299, NCI‐H1437, and A549) and human normal lung bronchus epithelial cell line BEAS‐2B were purchased from American Typical Cell Collection. The NCI‐H650, NCI‐H1299, and NCI‐H1437 cells were maintained in 90% Roswell Park Memorial Institute (RPMI) 1640 Medium (Gibco) supplemented with 10% fetal bovine serum (FBS) (Gibco); the A549 cells were cultured in 90% Ham's F‐12K (Kaighn's) Medium (Gibco) supplemented with 10% FBS (Gibco). And the BEAS‐2B cells were cultured in Bronchial Epithelial Cell Growth Basal Medium (Clonetics). All cells were incubated in a humidified atmosphere at the condition of 95% air, 5% CO2 and 37°C. After culture, circ‐SMARCA5 expression in the cells was detected by RT‐qPCR where BEAS‐2B cells were served as control.

Transfection

The circ‐SMARCA5 overexpression (OE) plasmid and the control OE plasmid were constructed using pCDNA 3.1 vector (Invitrogen). Then, the plasmids were transfected into NCI‐H1437 and NCI‐H1299 cells using HilyMax (Dojindo). The cells transfected with circ‐SMARCA5 OE plasmid or control OE plasmid were respectively termed as OE‐Circ group or OE‐Control group. At 0, 24, 48, and 72 hours after transfection, the cell proliferation in two groups was detected by Cell Counting Kit‐8 (Dojindo) according to the instruction manual.

Drug‐sensitivity

Both OE‐Circ cells and OE‐Control cells were plated in 96‐well after transfection then treated with cisplatin (Sigma) and gemcitabine (Sigma) in different concentration for 24 hours. Cell viability of treated OE‐Circ cells and OE‐Control cells at different drug concentration was determined using Cell Counting Kit‐8 (Dojindo) according to manufacturer's manual. The relative cell viability was calculated with reference to the cells treated by 0 μmol/L drug in each group. And the drug concentration required to inhibit growth by 50% (IC50) was calculated for all treated cells using Probit regression analysis.

RT‐qPCR

Detection of cric‐SMARCA5 was performed by RT‐qPCR with following steps: firstly, total RNA was extracted with RNeasy Protect Mini Kit (Qiagen); Secondly, the linear RNA was digested with RNase R (Epicentre); Thirdly, iScript™ cDNA Synthesis Kit (Bio‐Rad) was used to perform the reverse transcription to cDNA; Then, qPCR was conducted by QuantiNova SYBR Green PCR Kit (Qiagen). Besides, glyceraldehyde‐3‐phosphate dehydrogenase (GAPDH) was used as the internal reference, and the procedures to detect GAPDH expression were similar with the procedures detecting circ‐SMARCA5, except the digestion of linear RNA. Sequences of RT‐qPCR primers were as follows: circ‐SMARCA5, forward primer: AGATGGGCGAAAGTTCACTTAGAAA, reverse primer: TCTTGCCTGCTGAGTTGAGTATATC; GAPDH, forward primer: CAGGAGGCATTGCTGATGAT, reverse primer: GAAGGCTGG GGCTCATTT.

Statistical analysis

Statistical analysis was performed using SPSS 24.0 software (IBM), and figure was made using GraphPad Prism 7.00 software (GraphPad Software). Data were expressed as mean ± standard deviation (SD), median and interquartile range (IQR) or count and percentage. Comparisons of paired data between two groups were determined by Wilcoxon signed‐rank test. Comparisons of unpaired data between two groups were determined by Student's t test, chi‐square test or Wilcoxon rank sum test. Multiple comparisons of unpaired data between two groups were determined by the Dunnett t test. Kaplan‐Meier curves were plotted to illustrate DFS and OS, and the differences of DFS and OS between/among groups were determined by log‐rank test. Factors predicting DFS or OS were analyzed by univariate and multivariate Cox's proportional hazard regression model. IC50 was calculated by probit regression analysis. P value <.05 was considered as significant. *** represented P < .001; ** represented P < .01; * represented P < .05; NS represented no significance.

RESULTS

Clinical characteristics of NSCLC patients

Data of 460 NSCLC patients including 102 (22.2%) females and 358 (77.8%) males were reviewed (Table 1). The mean age was 61.9 ± 9.7 years, besides, 250 (54.3%) and 178 (38.7%) patients had history of smoke and history of drink, respectively, meanwhile, 174 (37.8%), 143 (31.1%), and 81 (17.6%) patients had hypertension, hyperlipidemia, and diabetes, respectively. Regarding the tumor features: there were 68 (14.8%), 298 (64.8%), and 94 (20.4%) patients showed well, moderate, and poor pathological differentiation, respectively; mean tumor size was 5.1 ± 2.1 cm; 123 (26.7%) patients presented with LYN metastasis; 193 (42.0%), 167 (36.3%), and 100 (21.7%) patients were at TNM stage Ⅰ, Ⅱ and III, respectively. Additionally, the median CEA level was 6.5 (2.9‐23.4) ng/mL.
Table 1

Clinical characteristics of NSCLC patients

ItemsTotal patients (N = 460)
Age (y), mean ± SD61.9 ± 9.7
Gender, No. (%)
Female102 (22.2)
Male358 (77.8)
History of smoke, No. (%)250 (54.3)
History of drink, No. (%)178 (38.7)
Hypertension, No. (%)174 (37.8)
Hyperlipidemia, No. (%)143 (31.1)
Diabetes, No. (%)81 (17.6)
Pathological differentiation, No. (%)
Well68 (14.8)
Moderate298 (64.8)
Poor94 (20.4)
Tumor size (cm), mean ± SD5.1 ± 2.1
LYN metastasis, No. (%)123 (26.7)
TNM stage, No. (%)
I193 (42.0)
II167 (36.3)
III100 (21.7)
CEA (ng/mL), median (IQR)6.5 (2.9‐23.4)

Abbreviations: CEA, carcinoembryonic antigen; IQR, interquartile range; LYN, lymph node; NSCLC, non‐small cell lung cancer; SD, standard deviation.

Clinical characteristics of NSCLC patients Abbreviations: CEA, carcinoembryonic antigen; IQR, interquartile range; LYN, lymph node; NSCLC, non‐small cell lung cancer; SD, standard deviation.

Comparison of circ‐SMARCA5 expression between tumor tissue and adjacent tissue

Expressions of circ‐SMARCA5 in tumor tissue as well as in adjacent tissue were detected by RT‐qPCR assay (Figure 1), which showed that circ‐SMARCA5 expression was decreased in tumor tissues than that in adjacent tissues (P < .001).
Figure 1

circ‐SMARCA5 expression in tumor and adjacent tissues. Circ‐SMARCA5, circular RNA SMARCA5

circ‐SMARCA5 expression in tumor and adjacent tissues. Circ‐SMARCA5, circular RNA SMARCA5

Comparison of clinical characteristics between patients with circ‐SMARCA5 high expression and patients with circ‐SMARCA5 low expression

Patients were segmented into circ‐SMARCA5 high expression (n = 230) and circ‐SMARCA5 low expression (n = 230) basing on the medium value of circ‐SMARCA5 expression in tumor tissues. Compared to circ‐SMARCA5 low expression group, smaller tumor size (P = .001), less LYN metastasis (P = .004), and lower TNM stage (P = .001) were found in circ‐SMARCA5 high expression group (Table 2). No other difference of clinical characteristics including age (P = .209), gender (P = .178), history of smoke (P = .190), history of drink (P = .338), hypertension (P = .442), hyperlipidemia (P = .920), diabetes (P = .271), pathological differentiation (P = .260), and CEA (P = .135) was found between patients with circ‐SMARCA5 high expression and patients with circ‐SMARCA5 low expression.
Table 2

Comparison of clinical characteristics between circ‐SMARCA5 high and low expression patients

ItemsCirc‐SMARCA5 P value
Low (n = 230)High (n = 230)
Age (years), mean ± SD61.3 ± 10.062.4 ± 9.4.209
Gender, No. (%)
Female45 (19.6)57 (24.8).178
Male185 (80.4)173 (75.2)
History of smoke, No. (%)118 (51.3)132 (57.4).190
History of drink, No. (%)94 (40.9)84 (36.5).338
Hypertension, No. (%)91 (39.6)83 (36.1).442
Hyperlipidemia, No. (%)71 (30.9)72 (31.3).920
Diabetes, No. (%)45 (19.6)36 (15.7).271
Pathological differentiation, No. (%)
Well33 (14.3)35 (15.2).260
Moderate144 (62.6)154 (67.0)
Poor53 (23.1)41 (17.8)
Tumor size (cm), mean ± SD5.4 ± 2.14.7 ± 2.0.001
LYN metastasis, No. (%)75 (32.6)48 (20.9).004
TNM stage, No. (%)
I82 (35.7)111 (48.3).001
II84 (36.5)83 (36.1)
III64 (27.8)36 (15.6)
CEA (ng/mL), median (IQR)7.0 (3.1‐30.0)5.8 (2.6‐19.7).135

Comparison was determined by Student's t test, chi‐square test or Wilcoxon rank sum test.

Abbreviations: CEA, carcinoembryonic antigen; IQR, interquartile range; LYN, lymph node; NSCLC, non‐small cell lung cancer; SD, standard deviation.

Comparison of clinical characteristics between circ‐SMARCA5 high and low expression patients Comparison was determined by Student's t test, chi‐square test or Wilcoxon rank sum test. Abbreviations: CEA, carcinoembryonic antigen; IQR, interquartile range; LYN, lymph node; NSCLC, non‐small cell lung cancer; SD, standard deviation.

Comparison of DFS and OS between patients with circ‐SMARCA5 high expression and patients with circ‐SMARCA5 low expression

DFS in circ‐SMARCA5 high expression group was longer compared to circ‐SMARCA5 low expression group (P < .001) (Figure 2A). Moreover, patients in circ‐SMARCA5 low expression group were further classified as low‐, low‐‐, and low‐‐‐ patients. Regarding the DFS in patients circ‐SMARCA5 high expression and patients with different degrees of circ‐SMARCA5 low expression, circ‐SMARCA5 expression positively correlated with DFS (P < .001) (Figure 2B). Additionally, OS in patients with circ‐SMARCA5 high expression was better than that in patients with circ‐SMARCA5 low expression (P < .001) (Figure 2C). As to the OS in circ‐SMARCA5 high expression patients and patients with different degrees of circ‐SMARCA5 low expression, circ‐SMARCA5 expression positively correlated with OS as well (P < .001) (Figure 2D).
Figure 2

Correlation of circ‐SMARCA5 expression with DFS and OS. Comparison of DFS between patients with circ‐SMARCA5 high expression and patients with circ‐SMARCA5 low expression (A), as well as among circ‐SMARCA5 high expression, circ‐SMARCA5 low‐ expression, circ‐SMARCA5 low‐‐ expression and circ‐SMARCA5 low‐‐‐ expression patients (B). Comparison of OS between patients with circ‐SMARCA5 high expression and patients with circ‐SMARCA5 low expression (C), as well as among circ‐SMARCA5 high expression, circ‐SMARCA5 low‐ expression, circ‐SMARCA5 low‐‐ expression and circ‐SMARCA5 low‐‐‐ expression patients (D). Circ‐SMARCA5, circular RNA SMARCA5; DFS, disease‐free survival; OS, overall survival

Correlation of circ‐SMARCA5 expression with DFS and OS. Comparison of DFS between patients with circ‐SMARCA5 high expression and patients with circ‐SMARCA5 low expression (A), as well as among circ‐SMARCA5 high expression, circ‐SMARCA5 low‐ expression, circ‐SMARCA5 low‐‐ expression and circ‐SMARCA5 low‐‐‐ expression patients (B). Comparison of OS between patients with circ‐SMARCA5 high expression and patients with circ‐SMARCA5 low expression (C), as well as among circ‐SMARCA5 high expression, circ‐SMARCA5 low‐ expression, circ‐SMARCA5 low‐‐ expression and circ‐SMARCA5 low‐‐‐ expression patients (D). Circ‐SMARCA5, circular RNA SMARCA5; DFS, disease‐free survival; OS, overall survival

Assessment of factors that affect DFS

According to univariate analysis, circ‐SMARCA5 high expression associated with increased DFS (P < .001, HR = 0.608), while pathological differentiation (poor) (P = .002, HR = 1.303), tumor size (>5 cm) (P = .001, HR = 1.454), LYN metastasis (P < .001, HR = 2.644), higher TNM stage (P < .001, HR = 1.496), and CEA (>5 ng/mL) (P = .026, HR = 1.273) were associated with decreased DFS in NSCLC patients (Table 3). As displayed by multivariate analysis, high expression of circ‐SMARCA5 independently predicted prolonged DFS (P = .001, HR = 0.684), meanwhile, pathological differentiation (poor) (P = .010, HR = 1.269), LYN metastasis (P < .001, HR = 2.261), and CEA (>5 ng/mL) (P = .025, HR = 1.282) could independently predict unfavorable DFS in NSCLC patients.
Table 3

Univariate and multivariate Cox's proportional hazard regression model analyses of factors predicting DFS in NSCLC patients

ItemsUnivariate Cox's regressionMultivariate Cox's regression
P valueHR (95%CI) P valueHR (95%CI)
Circ‐SMARCA5 high expression<.0010.608 (0.492‐0.751).0010.684 (0.549‐0.852)
Age (>60 years).0971.196 (0.968‐1.478).5021.079 (0.865‐1.346)
Gender (male).1751.199 (0.922‐1.558).1561.220 (0.927‐1.607)
History of smoke.4130.916 (0.743‐1.130).2480.881 (0.711‐1.092)
History of drink.7980.972 (0.784‐1.206).9481.007 (0.810‐1.252)
Hypertension.4341.090 (0.879‐1.352).6061.065 (0.837‐1.356)
Hyperlipidemia.8441.023 (0.816‐1.282).5521.080 (0.838‐1.392)
Diabetes.2920.859 (0.648‐1.139).2270.832 (0.618‐1.121)
Pathological differentiation (poor).0021.303 (1.098‐1.547).0101.269 (1.059‐1.521)
Tumor size (>5 cm).0011.454 (1.169‐1.808).2150.823 (0.605‐1.120)
LYN metastasis<.0012.644 (2.101‐3.327)<.0012.261 (1.674‐3.054)
Higher TNM stage<.0011.496 (1.306‐1.713).1341.178 (0.951‐1.460)
CEA (>5 ng/mL).0261.273 (1.029‐1.575).0251.282 (1.031‐1.593)

Abbreviations: CEA, carcinoembryonic antigen; CI, confidence interval; DFS, disease‐free survival; HR, hazard ratio; LYN, lymph node.

Univariate and multivariate Cox's proportional hazard regression model analyses of factors predicting DFS in NSCLC patients Abbreviations: CEA, carcinoembryonic antigen; CI, confidence interval; DFS, disease‐free survival; HR, hazard ratio; LYN, lymph node.

Assessment of factors that affect OS

Based on univariate analysis, higher circ‐SMARCA5 expression correlated with better OS (P < .001, HR = 0.604), while pathological differentiation (poor) (P < .001, HR = 1.549), tumor size (>5 cm) (P < .001, HR = 1.663), LYN metastasis (P < .001, HR = 2.934), higher TNM stage (P < .001, HR = 1.534), and CEA (>5 ng/mL) (P < .001, HR = 1.555) were associated with worse OS (Table 4). By multivariate analysis, circ‐ higher SMARCA5 expression (P = .001, HR = 0.678) was disclosed as an independent factor that predicted prolonged OS, and pathological differentiation (poor) (P < .001, HR = 1.470), LYN metastasis (P < .001, HR = 2.666), and CEA (>5 ng/mL) (P < .001, HR = 1.580) were independent factors predicting reduced OS in NSCLC patients.
Table 4

Univariate and multivariate Cox's proportional hazard regression model analyses of factors predicting OS in NSCLC patients

ItemsUnivariate Cox's regressionMultivariate Cox's regression
P valueHR (95%CI) P valueHR (95%CI)
Circ‐SMARCA5 high expression<.0010.604 (0.479‐0.763).0010.678 (0.534‐0.861)
Age (>60 y).8480.978 (0.777‐1.230).3120.882 (0.691‐1.125)
Gender (male).7821.040 (0.788‐1.372).5071.104 (0.825‐1.476)
History of smoke.4010.906 (0.721‐1.140).1430.840 (0.665‐1.061)
History of drink.6781.051 (0.832‐1.328).5021.085 (0.856‐1.375)
Hypertension.4791.089 (0.860‐1.378).1811.197 (0.920‐1.556)
Hyperlipidemia.4210.902 (0.701‐1.160).7930.963 (0.726‐1.277)
Diabetes.1460.791 (0.578‐1.084).2310.815 (0.583‐1.139)
Pathological differentiation (poor)<.0011.549 (1.285‐1.868)<.0011.470 (1.202‐1.796)
Tumor size (>5 cm)<.0011.663 (1.317‐2.101).9711.006 (0.718‐1.410)
LYN metastasis<.0012.934 (2.301‐3.742)<.0012.666 (1.913‐3.713)
Higher TNM stage<.0011.534 (1.323‐1.778).7461.041 (0.817‐1.326)
CEA (>5 ng/mL)<.0011.555 (1.227‐1.972)<.0011.580 (1.238‐2.015)

Abbreviations: CEA, carcinoembryonic antigen; CI, confidence interval; HR, hazard ratio; LYN, lymph node; OS, overall survival.

Univariate and multivariate Cox's proportional hazard regression model analyses of factors predicting OS in NSCLC patients Abbreviations: CEA, carcinoembryonic antigen; CI, confidence interval; HR, hazard ratio; LYN, lymph node; OS, overall survival.

Effect of circ‐SMARCA5 on the cell proliferation as well as the sensitivity to chemotherapy

To explore the underlying mechanisms of circ‐SMARCA5 in NSCLC cells, we conducted some in vitro experiments. Lower expression of circ‐SMARCA5 was observed in various NSCLC cell lines including NCI‐H650 (P < .01), NCI‐H1299 (P < .001), NCI‐H1437 (P < .001), and A549 (P < .001) compared to human normal lung bronchus epithelial cell line BEAS‐2B (Figure 3A). Besides, we chose the NCI‐H1437 as well as NCI‐H1299 cell lines for further experiments. Cell proliferation (Figure 3B) was decreased, and chemosensitivity to cisplatin and gemcitabine (Figure 3C‐E) were enhanced in circ‐SMARCA5 upregulation treated NCI‐H1437 cells compared to the corresponding control cells. Meanwhile, similar results were observed in NCI‐H1299 cell line (Figure 3F‐I). These data suggested that circ‐SMARCA5 was downregulated in NSCLC cell lines, and its upregulation repressed NSCLC cell proliferation as well as enhanced the chemotherapy sensitivity.
Figure 3

In vitro experiments. Circ‐SMARCA5 expression in NSCLC cell lines and normal lung bronchus epithelial cell line (A). Cell proliferation (B), cell viability under cisplatin treatment (C), cell viability under gemcitabine treatment (D), and IC50 value (E) in circ‐SMARCA5 upregulation treated NCI‐H1437 cells and control NCI‐H1437 cells. Cell proliferation (F), cell viability under cisplatin treatment (G), cell viability under gemcitabine treatment (H), and IC50 value (I) in circ‐SMARCA5 upregulation treated NCI‐H1299 cells and control NCI‐H1299 cells. Circ‐SMARCA5, circular RNA SMARCA5; IC50, drug concentration required to inhibit growth by 50%

In vitro experiments. Circ‐SMARCA5 expression in NSCLC cell lines and normal lung bronchus epithelial cell line (A). Cell proliferation (B), cell viability under cisplatin treatment (C), cell viability under gemcitabine treatment (D), and IC50 value (E) in circ‐SMARCA5 upregulation treated NCI‐H1437 cells and control NCI‐H1437 cells. Cell proliferation (F), cell viability under cisplatin treatment (G), cell viability under gemcitabine treatment (H), and IC50 value (I) in circ‐SMARCA5 upregulation treated NCI‐H1299 cells and control NCI‐H1299 cells. Circ‐SMARCA5, circular RNA SMARCA5; IC50, drug concentration required to inhibit growth by 50%

DISCUSSION

Previous studies have demonstrated that circRNAs may be closely connected with the development cancers.16, 17, 18, 19 Among them, circ‐SMARCA5, the circRNA derives from exons 15 and 16 of SMARCA5 gene, is found to be related to the disease progression in a few cancers.11, 13 For instance, a study shows a decreased circ‐SMARCA5 expression in tissues of hepatocellular carcinoma compared to healthy liver tissues, meanwhile, its low expression correlates with aggressive characteristics including higher Edmondson's grade, larger tumor size, increased microvascular invasion, higher TNM stage, and raised BCLC stage in hepatocellular carcinoma patients.11 Also, another study displays that circ‐SMARCA5 expression is decreased in tumor tissues compared to adjacent noncancerous tissues, and it negatively correlates with American Joint Committee on Cancer (AJCC) stage as well as LYN metastasis in gastric cancer patients.13 Although these studies display downregulated expressions of circ‐SMARCA5 in some cancers, the involvement of circ‐SMARCA5 in lung cancer has not been clearly clarified, and only one study shows that circ‐SMARCA5 is downregulated in NSCLC tissues compared to the adjacent normal tissues, and it inhibits cell proliferation, migration as well as invasion in NSCLC cell lines.12 Some recent studies have implied that non‐coding RNAs, especially circRNAs, play crucial roles in pathology and progression of NSCLC.19, 20, 21, 22 For example, long non‐coding RNA KDM5B anti‐sense RNA 1 enhances tumor progression in NSCLC; circular RNA F‐circSR derived from SLC34A2ROS1 fusion gene enhances cell migration in NSCLC; overexpression of circular RNA FARSA promotes NSCLC cell migration and invasion.17, 18, 23 According to these indications, we speculated that circ‐SMARCA5 might also have suppressive effect in NSCLC. To validate our hypothesis, we enrolled 460 NSCLC patients and investigated the circ‐SMARCA5 expression in tumor tissues and adjacent tissues. The results showed that circ‐SMARCA5 expression was decreased in tumor tissues compared to adjacent tissues in NSCLC patients. Furthermore, we investigated the association of circ‐SMARCA5 expression with clinical characteristics, and we found that circ‐SMARCA5 expression negatively correlated with tumor size, LYN metastasis and TNM stage in NSCLC patients. These results might be on account of that circ‐SMARCA5 functioned as a tumor‐suppressor through sponging some oncogenic miRNAs to suppress cell proliferation, migration as well as invasion, which resulted in decreased tumor growth and attenuated tumor metastasis, thus its expression was negatively correlated with tumor size, LYN metastasis as well as TNM stage in NSCLC patients.11, 13, 14 A few studies indicate the role of circ‐SMARCA5 in predicting prognosis in some cancers.11, 13 For example, a study displays that circ‐SMARCA5 expression positively correlates with recurrence‐free survival and OS in hepatocellular carcinoma patients.11 Additionally, another study shows that circ‐SMARCA5 expression independently predicts better survival profiles in patients with gastric cancer,13 whereas the influence of circ‐SMARCA5 for prognosis in NSCLC has not yet been documented. Our study revealed that circ‐SMARCA5 expression positively associated with DFS as well as OS in NSCLC patients, and higher circ‐SMARCA5 expression could independently predict these survival profiles. The reasons for these results might be: (a) circ‐SMARCA5 might inhibit NSCLC cell proliferation, migration, and invasion to retard the disease progression, which provided more chances to achieve longer survival time in NSCLC patients, thus circ‐SMARCA5 high expression predicted better DFS and OS 11, 13, 14; (b) circ‐SMARCA5 might promote the chemotherapy sensitivity in NSCLC cells, thereby resulted in better treatment efficacy as well as eventually led to better survival profiles, more importantly, this potential mechanism had been proved by our results. Additionally, our study had some limitations: (a) this was a single‐center study, thus there might be some selective bias; (b) 55 months might be a relatively short median follow‐up duration, and correlation of circ‐SMARCA5 expression with prognosis in long term was not investigated; this was a retrospective study, more details about follow‐up process was not available. Further prospective study is needed to validate our findings, and more factors that may affect the prognosis (such as the interventions during follow‐up) are needed to be included in further study. Apart from the clinical practices, some studies have implied the importance of exploring mechanisms underlying the suppression of tumor occurrence by tumor‐suppressive circRNAs.16 Some in vitro experiments are conducted with the aim to explore the function of circ‐SMARCA5 in pathology of cancers.11, 13, 14 One study shows that circ‐SMARCA5 is downregulated in cervical cancer cells, while its overexpression inhibits cell proliferation, migration as well as invasion, and results in cell cycle arrest via sponging miR‐620.14 Besides, a study displays that circ‐SMARCA5 is downregulated in various cell lines of gastric cancer compared to nonmalignant cells, and it dampens cell proliferation, migration and invasions in gastric cancer cells.13 Also, an interesting study discloses that circ‐SMARCA5 promotes the expression of TIMP3 (which is a tumor suppressor) through sponging miR‐17‐3p as well as miR‐181b‐5p, and further represses hepatocellular carcinoma cell proliferation and migration.11 Given that circ‐SMARCA5 acted as a crucial regulator in the pathology of these cancers, we hypothesized it also affected cell proliferation in NSCLC; however, limited evidence revealed the function of circ‐SMARCA5 in NSCLC cells. We firstly explored the circ‐SMARCA5 expression in NSCLC cell lines and how cric‐SMARCA5 upregulation regulated the cell proliferation. We discovered that circ‐SMARCA5 expression was lower in several NSCLC cell lines compared to the normal cell line, and circ‐SMARCA5 upregulation repressed NSCLC cell proliferation. Furthermore, we treated NSCLC cells with different concentrations of chemotherapy drugs (cisplatin and gemcitabine), and we found that circ‐SMARCA5 upregulation aggravated the decrease of cell viability and reduced the IC50 values of chemotherapy drugs, indicating that circ‐SMARCA5 upregulation enhanced the chemotherapy sensitivity in NSCLC cells. The possible reasons for these results might be (a) circ‐SMARCA5 might sponge some target miRNAs (such as miR‐620, miR‐181b‐5p and miR‐17‐3p) to suppress NSCLC cell proliferation 11, 13, 14; (b) circ‐SMARCA5 might regulate SMARCA5, which could mediate DNA replication and affect chemotherapy sensitivity, thus circ‐SMARCA5 enhanced chemotherapy sensitivity in NSCLC cells, whereas the detailed mechanisms of circ‐SMARCA5 in the promotion of chemotherapy sensitivity needed to be further explored.24 These findings enriched the understanding about the function of circ‐SMARCA5 in NSCLC and might provide an insight to the exploration of novel strategies in NSCLC treatment. In conclusion, circ‐SMARCA5 expression is downregulated, and negatively correlates with disease progression but positively correlates with survival profiles in NSCLC patients. Moreover, circ‐SMARCA5 inhibits cell proliferation and enhances the chemotherapy sensitivity in NSCLC cells. Our data indicate that circ‐SMARCA5 not only functions as a biomarker for monitoring disease progression and prognosis of NSCLC, but also provides support for seeking novel strategies in NSCLC treatment.
  24 in total

Review 1.  Circular RNAs function as ceRNAs to regulate and control human cancer progression.

Authors:  Yaxian Zhong; Yajun Du; Xue Yang; Yongzhen Mo; Chunmei Fan; Fang Xiong; Daixi Ren; Xin Ye; Chunwei Li; Yumin Wang; Fang Wei; Can Guo; Xu Wu; Xiaoling Li; Yong Li; Guiyuan Li; Zhaoyang Zeng; Wei Xiong
Journal:  Mol Cancer       Date:  2018-04-07       Impact factor: 27.401

Review 2.  Lung cancer: epidemiology, etiology, and prevention.

Authors:  Charles S Dela Cruz; Lynn T Tanoue; Richard A Matthay
Journal:  Clin Chest Med       Date:  2011-12       Impact factor: 2.878

Review 3.  Circular RNA and its mechanisms in disease: From the bench to the clinic.

Authors:  Bing Han; Jie Chao; Honghong Yao
Journal:  Pharmacol Ther       Date:  2018-02-14       Impact factor: 12.310

Review 4.  circRNAs in Cancer.

Authors:  Ines Lucia Patop; Sebastian Kadener
Journal:  Curr Opin Genet Dev       Date:  2017-12-12       Impact factor: 5.578

5.  NuMA promotes homologous recombination repair by regulating the accumulation of the ISWI ATPase SNF2h at DNA breaks.

Authors:  Pierre-Alexandre Vidi; Jing Liu; Daniela Salles; Swaathi Jayaraman; George Dorfman; Matthew Gray; Patricia Abad; Prabhas V Moghe; Joseph M Irudayaraj; Lisa Wiesmüller; Sophie A Lelièvre
Journal:  Nucleic Acids Res       Date:  2014-04-20       Impact factor: 16.971

6.  Circular RNA F-circSR derived from SLC34A2-ROS1 fusion gene promotes cell migration in non-small cell lung cancer.

Authors:  Ke Wu; Xun Liao; Youling Gong; Juan He; Jian-Kang Zhou; Shuangyan Tan; Wenchen Pu; Canhua Huang; Yu-Quan Wei; Yong Peng
Journal:  Mol Cancer       Date:  2019-05-22       Impact factor: 27.401

7.  SNPs in LncRNA genes are associated with non-small cell lung cancer in a Chinese population.

Authors:  Ruoyang Wang; Nannan Feng; Yu Wang; Sumeng Gao; Fangfang Zhang; Ying Qian; Ming Gao; Herbert Yu; Baosen Zhou; Biyun Qian
Journal:  J Clin Lab Anal       Date:  2019-04-13       Impact factor: 2.352

8.  Circular RNA SMARCA5 inhibits the proliferation, migration, and invasion of non-small cell lung cancer by miR-19b-3p/HOXA9 axis.

Authors:  Yaqiu Wang; Huiping Li; Hong Lu; Yaguang Qin
Journal:  Onco Targets Ther       Date:  2019-08-30       Impact factor: 4.147

9.  The biogenesis and biological functions of circular RNAs and their molecular diagnostic values in cancers.

Authors:  Haiyan Zhang; Yijing Shen; Zhe Li; Yao Ruan; Tianwen Li; Bingxiu Xiao; Weiliang Sun
Journal:  J Clin Lab Anal       Date:  2019-09-25       Impact factor: 2.352

10.  A novel plasma circular RNA circFARSA is a potential biomarker for non-small cell lung cancer.

Authors:  Dong Hang; Jing Zhou; Na Qin; Wen Zhou; Hongxia Ma; Guangfu Jin; Zhibin Hu; Juncheng Dai; Hongbing Shen
Journal:  Cancer Med       Date:  2018-05-02       Impact factor: 4.452

View more
  18 in total

1.  Circular RNA MYLK Promotes Glycolysis and Proliferation of Non-Small Cell Lung Cancer Cells by Sponging miR-195-5p and Increasing Glucose Transporter Member 3 Expression.

Authors:  Shuanglong Xiong; Dairong Li; Donglin Wang; Lumi Huang; Guanzhong Liang; Zhijuan Wu; Jianlin Long; Dan Yang; Yan Teng; Shuangyi Lei; Yan Li
Journal:  Cancer Manag Res       Date:  2020-07-07       Impact factor: 3.989

2.  Clinical Significance of Has_circ_0060937 in Bone Metastasis of NSCLC.

Authors:  Jiangnan Zhang; Wenwei Mao; Zhe Chen; Haiting Gu; Chan Lian
Journal:  Int J Gen Med       Date:  2020-11-12

3.  Circular RNA circSMARCA5 is a prognostic biomarker in patients with malignant tumor: a meta-analysis.

Authors:  Fan Chao; Shiyu Wang; Cong Zhang; Dunsheng Han; Zhe Ma; Gang Chen
Journal:  BMC Cancer       Date:  2021-05-25       Impact factor: 4.430

Review 4.  Insights Into circRNAs: Functional Roles in Lung Cancer Management and the Potential Mechanisms.

Authors:  Bing Feng; Hao Zhou; Ting Wang; Xinrong Lin; Yongting Lai; Xiaoyuan Chu; Rui Wang
Journal:  Front Cell Dev Biol       Date:  2021-02-09

5.  Value of circular RNA 0007385 in disease monitoring and prognosis estimation in non-small-cell lung cancer patients.

Authors:  Yijian Lin; Weiming Su; Guocui Lan
Journal:  J Clin Lab Anal       Date:  2020-07-14       Impact factor: 2.352

6.  The GAUGAA Motif Is Responsible for the Binding between circSMARCA5 and SRSF1 and Related Downstream Effects on Glioblastoma Multiforme Cell Migration and Angiogenic Potential.

Authors:  Davide Barbagallo; Angela Caponnetto; Cristina Barbagallo; Rosalia Battaglia; Federica Mirabella; Duilia Brex; Michele Stella; Giuseppe Broggi; Roberto Altieri; Francesco Certo; Rosario Caltabiano; Giuseppe Maria Vincenzo Barbagallo; Carmelina Daniela Anfuso; Gabriella Lupo; Marco Ragusa; Cinzia Di Pietro; Thomas Birkballe Hansen; Michele Purrello
Journal:  Int J Mol Sci       Date:  2021-02-07       Impact factor: 5.923

7.  [Research Progress of Circular RNA in Lung Cancer].

Authors:  Xiangwei Ge; Zhibo Zhang; Xiaoyu Zhi; Jinliang Wang
Journal:  Zhongguo Fei Ai Za Zhi       Date:  2020-12-20

Review 8.  Circular RNAs in Lung Cancer: Recent Advances and Future Perspectives.

Authors:  Huan-Huan Chen; Tie-Ning Zhang; Qi-Jun Wu; Xin-Mei Huang; Yu-Hong Zhao
Journal:  Front Oncol       Date:  2021-07-06       Impact factor: 6.244

9.  Circular RNA SMARCA5 may serve as a tumor suppressor in non-small cell lung cancer.

Authors:  Suiju Tong
Journal:  J Clin Lab Anal       Date:  2020-01-16       Impact factor: 2.352

10.  CircRNA WHSC1 promotes non-small cell lung cancer progression via sponging microRNA-296-3p and up-regulating expression of AKT serine/threonine kinase 3.

Authors:  Fengfeng Shi; Qin Yang; Dongdong Shen; Jianwei Chen
Journal:  J Clin Lab Anal       Date:  2021-07-27       Impact factor: 2.352

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.