Literature DB >> 32666646

Value of circular RNA 0007385 in disease monitoring and prognosis estimation in non-small-cell lung cancer patients.

Yijian Lin1, Weiming Su2, Guocui Lan2.   

Abstract

OBJECTIVE: This study aimed to assess the circular RNA_0007385 (hsa_circ_0007385) expression in tumor/adjacent non-tumor tissues, and the correlation of its tumor expression with clinicopathological features as well as survival in non-small-cell lung cancer (NSCLC) patients.
METHODS: 210 NSCLC patients who underwent tumor resection were reviewed in this retrospective study. 210 tumor specimens and 81 paired adjacent specimens were collected, in which the hsa_circ_0007385 expression was detected by reverse transcription-quantitative polymerase chain reaction assay. Disease-free survival (DFS) and overall survival (OS) were recorded, and the last follow-up date was June 30, 2019.
RESULTS: Hsa_circ_0007385 was upregulated in tumor tissue compared with adjacent non-tumor tissue (P < .001), and ROC curve analysis revealed that hsa_circ_0007385 expression had an excellent value in distinguishing tumor tissue from adjacent non-tumor tissue with an area under curve of 0.922 (95% CI: 0.890-0.953). Tumor hsa_circ_0007385 high expression correlated with lymph node metastasis (P = .007) and higher TNM stage (P = .004). In addition, DFS (P = .028) and OS (P = .008) were both less favorable in patients with tumor hsa_circ_0007385 high expression compared to patients with tumor hsa_circ_0007385 low expression. Besides, the DFS (P = .008) and OS (P = .012) were also the worst in patients with tumor hsa_circ_0007385 high+++ expression, followed by patients with tumor hsa_circ_0007385 high++ expression and patients with tumor hsa_circ_0007385 high + expression, and the best in patients with tumor hsa_circ_0007385 low expression. Multivariate regression analysis elucidated that tumor hsa_circ_0007385 high expression independently predicted worse OS (P = .033).
CONCLUSION: Tumor hsa_circ_0007385 could be a novel biomarker for disease monitoring and prognosis prediction in NSCLC patients.
© 2020 The Authors. Journal of Clinical Laboratory Analysis Published by Wiley Periodicals, Inc.

Entities:  

Keywords:  hsa_circ_0007385; non-small-cell lung cancer; prognosis; tissue; tumor feature

Mesh:

Substances:

Year:  2020        PMID: 32666646      PMCID: PMC7439352          DOI: 10.1002/jcla.23338

Source DB:  PubMed          Journal:  J Clin Lab Anal        ISSN: 0887-8013            Impact factor:   2.352


INTRODUCTION

Lung cancer, the most lethal cancer in the world, mainly includes small‐cell lung cancer and non–small‐cell lung cancer (NSCLC), and the latter counts for more than three quarters in all lung cancer cases. , , The prognosis of NSCLC patients has been improved thanks to the development of targeted and immunosuppressive drugs in the last two decades; however, for advanced NSCLC patients who are not eligible for those drugs, the mainstay of treatment is still chemotherapy, for instance the platinum‐based chemotherapy, which is well known to cause multiple severe adverse events during treatment. , , Therefore, survival of NSCLC patients is favorable in localized patients while is poor for advanced patients, the survival of whom is reported to be ranging approximately from only several months to 2 years. , , Herein, the assistance of biomarkers in disease monitoring and prognosis is urgently required in NSCLC management, because they could probably detect the early‐stage disease or disease progression, when the curative intervention is available. Circular RNAs (circRNAs), a novel class of non‐coding RNAs with structure of closing loops, are implicated in augmenting diseases as a result of the booming of high‐throughput RNA sequencing technology and microarray technology. Also, the regulatory roles of circRNAs have been reported in many carcinomas in recent years, which include NSCLC as well. , , Interestingly, an earlier study conducted by our collaborate institution illustrates a novel circRNA, hsa_circ_0007385, to be aberrantly expressed in both NSCLC tumor tissue and cancer cells, and the downregulation of which reduces proliferation, invasion, migration via sponging miR‐181 in vitro, and inhibits tumor growth in vivo. This suggests a potential clinical value of hsa_circ_0007385 in the management of NSCLC patients; nevertheless, no study has been performed to confirm this hypothesis until now. Therefore, in the present study, we assessed the hsa_circ_0007385 expression in tumor/adjacent non‐tumor tissues and association of its tumor expression with clinicopathological features as well as survivals in NSCLC patients.

MATERIALS AND METHODS

Patients

From July 2014 to June 2019, 210 NSCLC patients who underwent tumor resection in our hospitals were reviewed in this retrospective study. Patients were included in the study if they met following criteria: (a) diagnosed as primary NSCLC with TNM stage I‐IIIA; (b) aged 18‐80 years old; (c) underwent surgical resection without previous radiotherapy, chemotherapy, or other systematic treatments; (d) fresh‐frozen tumor specimens removed from surgical resection were accessible and available. While patients were excluded if they had any of the following conditions: (a) preoperative clinical data or follow‐up data were unavailable or missing; (b) relapsed NSCLC before surgery; (c) secondary NSCLC; (d) no fresh‐frozen tumor specimens; (e) history of other tumors; (f) hemogram, liver, or kidney function was seriously abnormal before surgery. The Institutional Review Board of our hospitals approved this study, and patients or their family members provided the written informed consents. In addition, the ethical approval number of this study was Ethics Committee of Quanzhou First Hospital [2019] No. 56.

Clinical data collection

Preoperative clinical data including demographics (age, sex, history of smoke, and history of drink), commonly chronic complications (hypertension, hyperlipidemia, and diabetes), and tumor features (differentiation status, tumor size, lymph node (LYN) status, TNM stage, and carcinoembryonic antigen (CEA) level) were collected from patients' medical records.

Hsa_circ_0007385 detection

A total of 210 fresh‐frozen tumor specimens were obtained from the Pathology Department of our hospital. Meanwhile, among 210 patients, 81 patients' fresh‐frozen adjacent specimens were available and collected as well. The relative expressions of hsa_circ_0007385 in the tumor tissues and adjacent tissues were determined by the reverse transcription‐quantitative polymerase chain reaction (RT‐qPCR) assay. To start with, the total RNA was enriched from tissues using TRIzol™ Reagent (Thermo Fisher Scientific) followed by the digestion of linear RNA with RNase R (Epicentre). Then, the total RNA was reversely transcribed with iScript™ cDNA Synthesis Kit (with redon primer) (Bio‐Rad). Last, qPCR was performed by the TB Green™ Fast qPCR Mix (Takara). In addition, the primers used in the qPCR procedure were designed according to a previous study : hsa_circ_0007385, forward, 5′‐ CGTGACCCAGAAGTGCGTTCACA‐3′, reverse, 5′‐ TGGGGGTGTATCAGTCTTTGGTT‐3′; GAPDH, forward, 5′‐ CCACATCGCTCAGACACCAT‐3′, reverse, 5′‐ ACCAGGCGCCCAATACG‐3′.

Grouping by hsa_circ_0007385 expression

According to the percentile in the hsa_circ_0007385 relative expression in all tumor specimens, patients in the 0th to 50th percentile were divided into hsa_circ_0007385 low expression group, and patients in the 50th to 100th percentile were divided into hsa_circ_0007385 high expression group. Moreover, hsa_circ_0007385 high expression patients were further classified as hsa_circ_0007385 high+ expression patients (in the 50th to 75th percentile), hsa_circ_0007385 high++ expression patients (in the 75th to 90th percentile), and hsa_circ_0007385 high+++ expression patients (in the 90th to 100th percentile) according to a previous study.

Follow‐up

Patients were followed up to the date of June 30, 2019. Survival data were extracted from follow‐up records for the analysis of disease‐free survival (DFS) and overall survival (OS). The DFS was calculated from the date of tumor resection to the date of disease relapse, disease progression, or death. And OS was calculated from the date of tumor resection to the date of death.

Statistical analysis

Continuous data were described as mean and standard deviation (SD) or median and interquartile (IQR). Categorical data were described as number (percentage). Wilcoxon signed rank sum test was used to determine the hsa_circ_0007385 expression difference between tumor tissue and adjacent tissue. Chi‐square test or Wilcoxon rank sum test was used to determine the clinical feature difference between tumor hsa_circ_0007385 high expression patients and tumor hsa_circ_0007385 low expression patients. Receiver operating characteristic (ROC) curve analysis and the area under curve (AUC) statistic were applied to assess the accuracy of tumor hsa_circ_0007385 as a tumor marker for NSCLC. Kaplan‐Meier (K‐M) curves were plotted to display the DFS and OS, and the log‐rank test was used to determine the difference of DFS and OS between or among groups. Univariate and forward stepwise multivariate Cox's proportional hazard regression model analyses were performed to assess the factors related to DFS and OS P value <.05 was considered significant. Statistical analysis and graph plotting were carried out on SPSS 24.0 software (IBM) and GraphPad Prism 6.01 software (GraphPad Software).

RESULTS

NSCLC patients' baseline features

With regard to demographics of the total 210 NSCLC patients in our study, they had a mean age of 61.6 ± 10.0 years, females of 40 (19.0%) and males of 170 (81.0%) (Table 1). In addition, the numbers of patients with well, moderation, and poor differentiation were 39 (18.6%), 122 (58.1%), and 49 (23.3%), respectively. Besides, the mean tumor size was 5.3 ± 2.1 cm, and there were 66 (31.4%) patients who had LYN metastasis. The numbers of patients in TNM stage I, II, and III were 72 (34.3%), 74 (35.2%), and 64 (30.5%), respectively. And the median level of CEA was 5.8 (2.7‐28.0) ng/mL. Besides, the other information of patients' baseline features could be seen in Table 1.
TABLE 1

Baseline features

ItemsNSCLC patients (N = 210)
Demographics
Age (y), mean ± SD61.6 ± 10.0
Gender, No. (%)
Female40 (19.0)
Male170 (81.0)
History of smoke, No. (%)115 (54.8)
History of drink, No. (%)83 (39.5)
Commonly chronic complications
Hypertension, No. (%)75 (35.7)
Hyperlipidemia, No. (%)67 (31.9)
Diabetes, No. (%)33 (15.7)
Tumor features
Differentiation
Well39 (18.6)
Moderate122 (58.1)
Poor49 (23.3)
Tumor size (cm), mean ± SD5.3 ± 2.1
LYN metastasis, No. (%)66 (31.4)
TNM stage, No. (%)
I72 (34.3)
II74 (35.2)
III64 (30.5)
CEA (ng/mL), median (IQR)5.8 (2.7‐28.0)

Abbreviations: CEA, carcinoembryonic antigen; IQR, interquartile range; LYN, lymph node; NSCLC, non–small‐cell lung carcinoma; SD, standard deviation.

Baseline features Abbreviations: CEA, carcinoembryonic antigen; IQR, interquartile range; LYN, lymph node; NSCLC, non–small‐cell lung carcinoma; SD, standard deviation.

Hsa_circ_0007385 expression in tumor and adjacent non‐tumor tissues

Hsa_circ_0007385 was upregulated in tumor tissue (N = 210) compared with adjacent non‐tumor tissue (N = 81) (P < .001) (Figure 1A), and ROC curve analysis revealed that hsa_circ_0007385 expression had a great value in distinguishing tumor tissue from adjacent non‐tumor tissue in NSCLC patients, and the AUC was 0.922 (95%CI: 0.890‐0.953) (Figure 1B).
FIGURE 1

Value of hsa_circ_0007385 for differentiating tumor tissue from non‐tumor tissue. The comparison of hsa_circ_0007385 expression in tumor tissue and adjacent non‐tumor tissue (A), and the ROC curve analysis revealing value of hsa_circ_0007385 for distinguishing tumor tissue from paired adjacent non‐tumor tissue (B). AUC, area under curve; CI, confidence interval; Circ, circular RNA; ROC, receiver operating characteristic

Value of hsa_circ_0007385 for differentiating tumor tissue from non‐tumor tissue. The comparison of hsa_circ_0007385 expression in tumor tissue and adjacent non‐tumor tissue (A), and the ROC curve analysis revealing value of hsa_circ_0007385 for distinguishing tumor tissue from paired adjacent non‐tumor tissue (B). AUC, area under curve; CI, confidence interval; Circ, circular RNA; ROC, receiver operating characteristic

Difference of baseline features between patients with tumor hsa_circ_0007385 high expression and patients with tumor hsa_circ_0007385 low expression

With regard to demographics and commonly chronic complications, no correlation of tumor hsa_circ_0007385 expression with age (P = .268), gender (P = .482), history of smoke (P = .677), history of drink (P = .121), hypertension (P = .195), hyperlipidemia (P = .882), or diabetes (P = .569) was found in NSCLC patients (Table 2). As for tumor features, tumor hsa_circ_0007385 expression was positively correlated with LYN metastasis (P = .007) (Figure 2C) and TNM stage (P = .004) (Figure 2D), while was not associated with differentiation (P = .391) (Figure 2A), tumor size (P = .159) (Figure 2B), or CEA level (P = .352) (Figure 2E).
TABLE 2

Correlation of hsa_circ_0007385 expression with demographic features and commonly chronic complications

ItemsHsa_circ_0007385 expression P value
LowHigh
Age, No. (%)
≤60 y52 (49.5)44 (41.9).268
>60 y53 (50.5)61 (58.1)
Gender, No. (%)
Female22 (21.0)18 (17.1).482
Male83 (79.0)87 (82.9)
History of smoke, No. (%)
No46 (43.8)49 (46.7).677
Yes59 (56.2)56 (53.3)
History of drink, No. (%)
No69 (65.7)58 (55.2).121
Yes36 (34.3)47 (44.8)
Hypertension, No. (%)
No72 (68.6)63 (60.0).195
Yes33 (31.4)42 (40.0)
Hyperlipidemia, No. (%)
No72 (68.6)71 (67.6).882
Yes33 (31.4)34 (32.4)
Diabetes, No. (%)
No90 (85.7)87 (82.9).569
Yes15 (14.3)18 (17.1)

Comparison was determined by chi‐square test.

FIGURE 2

Correlation of tumor hsa_circ_0007385 expression with tumor features. The association of tumor hsa_circ_0007385 expression with differentiation (A), tumor size (B), LYN metastasis (C), TNM stage (D) and CEA level (E) in NSCLC patients who underwent tumor resection. CEA, carcinoembryonic antigen; Circ, circular RNA; LYN, lymph node; NSCLC, non–small‐cell lung cancer

Correlation of hsa_circ_0007385 expression with demographic features and commonly chronic complications Comparison was determined by chi‐square test. Correlation of tumor hsa_circ_0007385 expression with tumor features. The association of tumor hsa_circ_0007385 expression with differentiation (A), tumor size (B), LYN metastasis (C), TNM stage (D) and CEA level (E) in NSCLC patients who underwent tumor resection. CEA, carcinoembryonic antigen; Circ, circular RNA; LYN, lymph node; NSCLC, non–small‐cell lung cancer

Difference of DFS and OS between patients with tumor hsa_circ_0007385 high expression and patients with tumor hsa_circ_0007385 low expression

The DFS was decreased in patients who had tumor hsa_circ_0007385 high expression compared to patients with tumor hsa_circ_0007385 low expression (P = .028) (Figure 3A). Moreover, the DFS was the most unfavorable in patients with tumor hsa_circ_0007385 high+++ expression followed by patients with tumor hsa_circ_0007385 high++ expression and patients with tumor hsa_circ_0007385 high+ expression, while was the most favorable in patients with tumor hsa_circ_0007385 low expression (P = .008) (Figure 3B). Additionally, the OS was also declined in patients with tumor hsa_circ_0007385 high expression compared to patients with tumor hsa_circ_0007385 low expression (P = .008) (Figure 4A). Besides, the OS was the worst in patients with tumor hsa_circ_0007385 high+++ expression, which was followed by patients who had tumor hsa_circ_0007385 high++ expression and patients with tumor hsa_circ_0007385 high+ expression, while was the best in patients with tumor hsa_circ_0007385 low expression (P = .012) (Figure 4B).
FIGURE 3

Correlation of tumor hsa_circ_0007385 with DFS. The difference of DFS between patients with tumor hsa_circ_0007385 high expression and patients with tumor hsa_circ_0007385 low expression (A), and among patients with tumor hsa_circ_0007385 high+++ expression, patients with tumor hsa_circ_0007385 high++ expression, patients with tumor hsa_circ_0007385 high+ expression and patients who had tumor hsa_circ_0007385 low expression (B). Circ, circular RNA; DFS, disease‐free survival

FIGURE 4

Correlation of tumor hsa_circ_0007385 with OS. The difference of OS between patients with tumor hsa_circ_0007385 high and patients with tumor hsa_circ_0007385 low expression (A), and among patients with tumor hsa_circ_0007385 high+++ expression, patients with tumor hsa_circ_0007385 high++ expression, patients with tumor hsa_circ_0007385 high+ expression and patients with tumor hsa_circ_0007385 low expression (B). Circ, circular RNA; OS, overall survival

Correlation of tumor hsa_circ_0007385 with DFS. The difference of DFS between patients with tumor hsa_circ_0007385 high expression and patients with tumor hsa_circ_0007385 low expression (A), and among patients with tumor hsa_circ_0007385 high+++ expression, patients with tumor hsa_circ_0007385 high++ expression, patients with tumor hsa_circ_0007385 high+ expression and patients who had tumor hsa_circ_0007385 low expression (B). Circ, circular RNA; DFS, disease‐free survival Correlation of tumor hsa_circ_0007385 with OS. The difference of OS between patients with tumor hsa_circ_0007385 high and patients with tumor hsa_circ_0007385 low expression (A), and among patients with tumor hsa_circ_0007385 high+++ expression, patients with tumor hsa_circ_0007385 high++ expression, patients with tumor hsa_circ_0007385 high+ expression and patients with tumor hsa_circ_0007385 low expression (B). Circ, circular RNA; OS, overall survival

Cox's proportional hazard regression model analyses of factors that predicted DFS and OS

Univariate Cox's proportional hazard regression model analysis illustrated that tumor hsa_circ_0007385 high expression (P = .031) could predict worse DFS, and LYN metastasis (P < .001), TNM stage III (vs II/I) (P < .001) and CEA abnormal (P = .016) also predicted shorter DFS (Table 3). Then, the multivariate Cox's proportional hazard regression model analysis was conducted using forward stepwise method, which revealed that LYN metastasis (P < .001) and CEA abnormal (P = .019) independently predicted worse DFS. As to OS, the univariate Cox's proportional hazard regression model analysis disclosed that tumor hsa_circ_0007385 high expression (P = .010) was a predictive factor for unfavorable OS, and the other predictive factors for worse OS were poor differentiation (vs. moderate/well) (P = .010), tumor size >5 cm (P = .035), LYN metastasis (P < .001), TNM stage III (vs. II/I) (P = .005), and CEA abnormal (P = .007) (Table 4). Afterward, the forward stepwise multivariate Cox's proportional hazard regression model analysis displayed that tumor hsa_circ_0007385 high expression (P = .033) was an independent predictive factor for shorter OS; besides, hyperlipidemia (P = .016), poor differentiation (vs. moderate/well) (P = .016), LYN metastasis (P < .001), and CEA abnormal (P = .009) were also pejorative predictors for worse OS.
TABLE 3

Univariate and forward stepwise multivariate Cox's proportional hazard regression model analyses of factors affecting DFS

ItemsCox's proportional hazard regression model
P valueHR95% CI
LowerHigher
Univariate Cox's regression
Hsa_circ_0007385 high.0311.4561.0342.049
Age (>60 y).3780.8580.6101.207
Male.1270.7230.4761.097
History of smoke.8671.0290.7331.447
History of drink.5991.0970.7771.549
Hypertension.7610.9470.6651.348
Hyperlipidemia.4101.1640.8111.670
Diabetes.5230.8540.5251.387
Differentiation (Poor vs moderate/well).0601.4500.9842.136
Tumor size (>5 cm).0521.4010.9971.967
LYN metastasis<.0012.1781.5413.079
TNM stage (III vs II/I)<.0012.0261.4312.868
CEA abnormal a .0161.5321.0842.165
CEA, carcinoembryonic antigen
LYN metastasis<.0012.1621.5293.058
CEA abnormal a .0191.5131.0702.139

Abbreviations: CEA, carcinoembryonic antigen; CI, confidence interval; DFS, disease‐free survival; HR, hazard ratio; LYN, lymph node.

CEA abnormal level >5.0 ng/mL, CEA normal level ≤5.0 ng/mL.

TABLE 4

Univariate and forward stepwise multivariate Cox's proportional hazard regression model analyses of factors affecting OS

ItemsCox's proportional hazard regression model
P valueHR95% CI
LowerHigher
Univariate Cox's regression
Hsa_circ_0007385 high.0101.6961.1362.532
Age (>60 y).4630.8640.5841.277
Male.3400.7880.4821.286
History of smoke.9201.0200.6901.510
History of drink.4561.1620.7831.723
Hypertension.5510.8820.5831.333
Hyperlipidemia.4211.1870.7821.801
Diabetes.4490.8040.4571.414
Differentiation (Poor vs moderate/well).0101.7411.1432.651
Tumor size (>5 cm).0351.5221.0292.250
LYN metastasis<.0012.7751.8714.116
TNM stage (III vs II/I).0051.7751.1852.659
CEA abnormal a .0071.7511.1682.626
Forward stepwise multivariate Cox's regression
Hsa_circ_0007385 high.0331.5541.0362.332
Hyperlipidemia.0161.7271.1092.691
Differentiation (Poor vs moderate/well).0161.6991.1032.616
LYN metastasis<.0012.8001.8724.189
CEA abnormal a .0091.7361.1482.626

Abbreviations: CEA, carcinoembryonic antigen; CI, confidence interval; HR, hazard ratio; LYN, lymph node; OS, overall survival.

CEA abnormal level >5.0 ng/mL, CEA normal level ≤5.0 ng/mL.

Univariate and forward stepwise multivariate Cox's proportional hazard regression model analyses of factors affecting DFS Abbreviations: CEA, carcinoembryonic antigen; CI, confidence interval; DFS, disease‐free survival; HR, hazard ratio; LYN, lymph node. CEA abnormal level >5.0 ng/mL, CEA normal level ≤5.0 ng/mL. Univariate and forward stepwise multivariate Cox's proportional hazard regression model analyses of factors affecting OS Abbreviations: CEA, carcinoembryonic antigen; CI, confidence interval; HR, hazard ratio; LYN, lymph node; OS, overall survival. CEA abnormal level >5.0 ng/mL, CEA normal level ≤5.0 ng/mL.

DISCUSSION

Through the growing knowledge in molecular and genetic characteristics of NSCLC, the treatment of patients has evolved from traditional cytotoxic chemotherapy to molecular targeted/immunosuppressive therapy, which largely contributes to the development of precision medicine in NSCLC patients. , Furthermore, multiple biomarkers have been discovered to be useful in NSCLC management, such as the biomarkers for guiding the molecular treatment, programmed cell death 1 (PD‐1), and programmed death ligand 1 (PD‐L1). , However, the biomarkers for keeping track of disease progression and prognosis are extremely lacking. Fortunately, rapid progress of RNA sequencing has preliminarily introduced circRNAs to the arena of NSCLC management. In this study, we found that in NSCLC patients who underwent tumor resection: (a) hsa_circ_0007385 was upregulated in tumor tissue compared with adjacent non‐tumor tissue and apparently distinguished tumor tissue from adjacent non‐tumor tissue; (b) tumor hsa_circ_0007385 high expression associated with LYN metastasis and higher TNM stage; (c) tumor hsa_circ_0007385 high expression correlated with worse DFS and shorter OS, and was an independent predictive factor for unfavorable OS. In the last two decades, there have been more and more mode‐of‐action studies revealing the functions of circRNAs in NSCLC. A recent study shows that circ‐CMPK1 promotes NSCLC cancer cell proliferation through increasing cyclin D1 expression by acting as a sponge of miR‐302e. Another study reports that circ‐FGFR1 overexpression enhances migration, invasion, proliferation and immune evasion in vitro as well as promotes resistance to anti‐PD‐1 treatment in vivo in NSCLC. In addition, circ‐ZNF124 provokes growth, the arrest in sub‐G1 phase of cell cycle, migration, and colony formation of NSCLC cells through abrogating the decrease of Janus tyrosine kinase‐2/signal transducer and activator of transcription 3 (JAK2/STAT3) signaling pathway regulated by miR‐337‐3p. And circ‐PIP5K1A enhances proliferation and metastasis in mice model of NSCLC by mediating miR‐600/HIF‐1α signaling. Circ‐ZFR enhances NSCLC progression by increasing cancer cell proliferation, migration, and invasion through sponging miR‐101‐3p to elevate the Cullin 4B (CUL4B) expression. As for hsa_circ_0007385, a collaborate institution of ours finds that it is a dysregulated circRNA in tumor tissue of NSCLC by microarray, and it is overexpressed in both tumor tissue and cancer cells of NSCLC according to RT‐qPCR validation; moreover, hsa_circ_0007385 knockdown reduces proliferation, invasion, and migration through functioning as a sponge of miR‐181 in vitro and restricts tumor growth in vivo. Thus, we hypothesized that hsa_circ_0007385 may also have clinical value in NSCLC patients and conducted the present study. Our results showed that hsa_circ_0007385 was upregulated in tumor tissue compared to adjacent non‐tumor tissue, and its high expression in tumor tissue correlated with LYN metastasis and higher TNM stage in NSCLC patients. These results could be explained by that hsa_circ_0007385 was able to promote disease progression via enhancing cancer cell proliferation, invasion, and migration via sponging miR‐181; thus, it was upregulated in tumor tissue compared to non‐tumor tissue and was associated with more severe tumor feature. Besides, we would like to discuss more about the mechanistic findings of hsa_circ_0007385 in NSCLC or in other carcinomas. Nonetheless, since circRNA is still a relatively novel area in the research of oncology, and hsa_circ_0007385 is a newly discovered circRNA in 2018, we did not find more studies about the role of hsa_circ_0007385 in NSCLC or in other disease. In addition, the molecular mechanisms about the regulatory role of hsa_circ_0007385 in NSCLC were not investigated in this study, which was due to that there has been a previous study illustrating the effect of hsa_circ_0007385 on NSCLC cell functions, and the major aim of this study was to assess the clinical value of hsa_circ_0007385 in NSCLC. However, the mechanism of hsa_circ_0007385 in regulating the pathogenesis of NSCLC should be evaluated by more experimental studies in the future. With regard to the prognostic roles of circRNAs in NSCLC, there is a previous study illustrating that hsa_circ_0020123 is elevated in tumor tissue compared with non‐tumor tissue, and an elevated tumor hsa_circ_0020123 expression is associated with lymph node metastasis, increased TNM stage, and poor prognosis in NSCLC patients. And a study reports that hsa_circ_000984 is upregulated in tumor tissue than non‐tumor tissue and its expression in tumor tissue positively correlates with higher TNM stage as well as lymph node metastasis in NSCLC patients. Circ‐VANGL1 is upregulated in tumor tissue of NSCLC and positively correlates with tumor size and TNM stage while negatively associates with OS in NSCLC patients. In addition, a prior study elucidates that circ‐P4HB expression is increased in tumor tissue compared to healthy tissue and its tumor high expression associates with metastasis and worse survival in NSCLC patients. And hsa_circ_0003998 elevated expression in NSCLC tissue is correlated with larger tumor size, lymph node metastasis, and unfavorable OS in NSCLC patients. In our study, we found that tumor hsa_circ_0007385 high expression associated with worse DFS and OS, and was an independent predictive factor for shorter OS in NSCLC patients, and here are some interpretations to these results: hsa_circ_0007385 possibly promoted progression and induced worse survival of NSCLC via modulating NSCLC cell functions by targeting miR‐181, such as increasing tumor growth by promoting cancer cell proliferation, and also increasing the metastasis of tumor via enhancing cancer cell migration and invasion by targeting miR‐181. Besides, there were a few limitations in our study. Firstly, we included 210 NSCLC patients in this study, which was a sample size needed to be enlarged. Secondly, the clinical value of tumor hsa_circ_0007385 in more advanced NSCLC patients was not investigated in this study. Thirdly, the patients who were lost to follow‐up were excluded from our study, which might contribute to the small sample size and the existence of bias in this study. Last, the follow‐up duration could be more prolonged. Taken together, our data illustrate for the first time that tumor hsa_circ_0007385 has the potential to serve as a biomarker assisting in disease monitoring and prognosis in NSCLC patients.

CONFLICT OF INTEREST

No potential conflict of interest was reported by the authors.
  28 in total

1.  Nivolumab plus Ipilimumab in Lung Cancer with a High Tumor Mutational Burden.

Authors:  Matthew D Hellmann; Tudor-Eliade Ciuleanu; Adam Pluzanski; Jong Seok Lee; Gregory A Otterson; Clarisse Audigier-Valette; Elisa Minenza; Helena Linardou; Sjaak Burgers; Pamela Salman; Hossein Borghaei; Suresh S Ramalingam; Julie Brahmer; Martin Reck; Kenneth J O'Byrne; William J Geese; George Green; Han Chang; Joseph Szustakowski; Prabhu Bhagavatheeswaran; Diane Healey; Yali Fu; Faith Nathan; Luis Paz-Ares
Journal:  N Engl J Med       Date:  2018-04-16       Impact factor: 91.245

2.  Circular RNA circ_0020123 promotes non-small cell lung cancer progression by acting as a ceRNA for miR-488-3p to regulate ADAM9 expression.

Authors:  Jingru Wan; Liguo Hao; Xiaoyang Zheng; Zheng Li
Journal:  Biochem Biophys Res Commun       Date:  2019-05-29       Impact factor: 3.575

Review 3.  The biology and management of non-small cell lung cancer.

Authors:  Roy S Herbst; Daniel Morgensztern; Chris Boshoff
Journal:  Nature       Date:  2018-01-24       Impact factor: 49.962

4.  Circular RNA ZFR accelerates non-small cell lung cancer progression by acting as a miR-101-3p sponge to enhance CUL4B expression.

Authors:  Haifeng Zhang; Xiaolong Wang; Baoli Hu; Feng Zhang; Haitao Wei; Li Li
Journal:  Artif Cells Nanomed Biotechnol       Date:  2019-12       Impact factor: 5.678

Review 5.  Systemic Therapy for Locally Advanced and Metastatic Non-Small Cell Lung Cancer: A Review.

Authors:  Kathryn C Arbour; Gregory J Riely
Journal:  JAMA       Date:  2019-08-27       Impact factor: 56.272

6.  Circular RNA circPIP5K1A promotes non-small cell lung cancer proliferation and metastasis through miR-600/HIF-1α regulation.

Authors:  Yongbing Chi; Qiancheng Luo; Yuting Song; Fangsong Yang; Ying Wang; Mingming Jin; Denghai Zhang
Journal:  J Cell Biochem       Date:  2019-06-26       Impact factor: 4.429

7.  The circRNA circP4HB promotes NSCLC aggressiveness and metastasis by sponging miR-133a-5p.

Authors:  Tao Wang; Xiaoxu Wang; Qianyu Du; Nan Wu; Xincheng Liu; Yuqing Chen; Xiaojing Wang
Journal:  Biochem Biophys Res Commun       Date:  2019-04-17       Impact factor: 3.575

8.  Cancer immunology. Mutational landscape determines sensitivity to PD-1 blockade in non-small cell lung cancer.

Authors:  Naiyer A Rizvi; Matthew D Hellmann; Alexandra Snyder; Pia Kvistborg; Vladimir Makarov; Jonathan J Havel; William Lee; Jianda Yuan; Phillip Wong; Teresa S Ho; Martin L Miller; Natasha Rekhtman; Andre L Moreira; Fawzia Ibrahim; Cameron Bruggeman; Billel Gasmi; Roberta Zappasodi; Yuka Maeda; Chris Sander; Edward B Garon; Taha Merghoub; Jedd D Wolchok; Ton N Schumacher; Timothy A Chan
Journal:  Science       Date:  2015-03-12       Impact factor: 47.728

9.  Pemetrexed Plus Platinum for Patients With Advanced Non-small Cell Lung Cancer and Interstitial Lung Disease.

Authors:  Tetsuo Fujita; Tsuguko Kuroki; Nami Hayama; Yuka Shiraishi; Hiroyuki Amano; Makoto Nakamura; Satoshi Hirano; Hiroshi Tabeta; Sukeyuki Nakamura
Journal:  In Vivo       Date:  2019 Nov-Dec       Impact factor: 2.155

10.  Circular RNA CpG island hypermethylation-associated silencing in human cancer.

Authors:  Humberto J Ferreira; Veronica Davalos; Manuel Castro de Moura; Marta Soler; Montserrat Perez-Salvia; Alberto Bueno-Costa; Fernando Setien; Sebastian Moran; Alberto Villanueva; Manel Esteller
Journal:  Oncotarget       Date:  2018-06-26
View more
  6 in total

1.  Value of circular RNA 0007385 in disease monitoring and prognosis estimation in non-small-cell lung cancer patients.

Authors:  Yijian Lin; Weiming Su; Guocui Lan
Journal:  J Clin Lab Anal       Date:  2020-07-14       Impact factor: 2.352

2.  The roles and mechanisms of the circular RNA circ_104640 in early-stage lung adenocarcinoma: a potential diagnostic and therapeutic target.

Authors:  Wei Jiang; Chengpeng Zhang; Yunteng Kang; Guangbin Li; Yu Feng; Haitao Ma
Journal:  Ann Transl Med       Date:  2021-01

Review 3.  Biogenesis, functions, and clinical implications of circular RNAs in non-small cell lung cancer.

Authors:  Ying Liu; Xiang Ao; Wanpeng Yu; Yuan Zhang; Jianxun Wang
Journal:  Mol Ther Nucleic Acids       Date:  2021-11-19       Impact factor: 8.886

Review 4.  Role of circular RNAs in the diagnosis, regulation of drug resistance and prognosis of lung cancer.

Authors:  Chengpeng Sang; Dingyu Rao; Caixia Wu; Yao Xia; Maoyan Si; Zhixian Tang
Journal:  Oncol Lett       Date:  2022-07-07       Impact factor: 3.111

Review 5.  Circular RNAs in Lung Cancer: Recent Advances and Future Perspectives.

Authors:  Huan-Huan Chen; Tie-Ning Zhang; Qi-Jun Wu; Xin-Mei Huang; Yu-Hong Zhao
Journal:  Front Oncol       Date:  2021-07-06       Impact factor: 6.244

6.  CircRNA WHSC1 promotes non-small cell lung cancer progression via sponging microRNA-296-3p and up-regulating expression of AKT serine/threonine kinase 3.

Authors:  Fengfeng Shi; Qin Yang; Dongdong Shen; Jianwei Chen
Journal:  J Clin Lab Anal       Date:  2021-07-27       Impact factor: 2.352

  6 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.