Shuangshuang Zheng1, Melanie Sieder1,2, Michael Mitterer3, Michael Reth1,3, Marco Cavallari1,3, Jianying Yang1,3. 1. BIOSS Centre For Biological Signaling Studies and Department of Molecular Immunology, Biology III, Faculty of Biology, University of Freiburg, Freiburg, Germany. 2. Spemann Graduate School for Biology and Medicine (SGBM), Freiburg, Germany. 3. Max Planck Institute of Immunobiology and Epigenetics, Freiburg, Germany.
Abstract
Membrane proteins are organized in nanoscale compartments. Their reorganization plays a crucial role in receptor activation and cell signaling. To monitor the organization and reorganization of membrane proteins, we developed a new branched proximity hybridization assay (bPHA) allowing better quantification of the nanoscale protein-protein proximity. In this assay, oligo-coupled binding probes, such as aptamer, nanobody, and antibodies, are used to translate the proximity of target proteins to the proximity of oligos. The closely positioned oligos then serve as a template for a maximum of 400-fold branched DNA (bDNA) signal amplification. The amplified bPHA signal is recorded by flow cytometer, thus enabling proximity studies with high throughput, multiplexing, and single-cell resolution. To demonstrate the potential of the bPHA method, we measured the reorganization of the immunoglobulin M (IgM)- and immunoglobulin D (IgD)-class B cell antigen receptor (BCR) on the plasma membrane and the recruitment of spleen tyrosine kinase (Syk) to the BCR upon B lymphocyte activation.
Membrane proteins are organized in nanoscale compartments. Their reorganization plays a crucial role in receptor activation and cell signaling. To monitor the organization and reorganization of membrane proteins, we developed a new branched proximity hybridization assay (bPHA) allowing better quantification of the nanoscale protein-protein proximity. In this assay, oligo-coupled binding probes, such as aptamer, nanobody, and antibodies, are used to translate the proximity of target proteins to the proximity of oligos. The closely positioned oligos then serve as a template for a maximum of 400-fold branched DNA (bDNA) signal amplification. The amplified bPHA signal is recorded by flow cytometer, thus enabling proximity studies with high throughput, multiplexing, and single-cell resolution. To demonstrate the potential of the bPHA method, we measured the reorganization of the immunoglobulin M (IgM)- and immunoglobulin D (IgD)-class B cell antigen receptor (BCR) on the plasma membrane and the recruitment of spleen tyrosine kinase (Syk) to the BCR upon B lymphocyte activation.
Previously, it was thought that most receptors are freely diffusing monomers that are activated by ligand binding and cross-linking [1,2]. Recent studies suggest, however, that membrane proteins are confined in nanoscale compartments that are reorganized upon cellular activation [3,4]. This reorganization involves nanometer changes of the proximity of membrane receptors, and proficient methods measuring receptor proximity would be essential to understand better these cellular processes. However, methods to quantify nanoscale protein–protein proximity in an efficient manner are still in their infancy.Because of the 250-nm diffraction limit of the light, the light microscope cannot monitor nanoscale membrane processes, and this limitation has resulted in the development of several different superresolution microscopy methods. However, these techniques require careful calibration and sophisticated data processing. In addition, data interpretation for superresolution microscopy can be tricky because of overcounting and underlabeling problems [5]. Traditional proximity-dependent assays to visualize protein interactions in living cells, such as bimolecular fluorescence complementation (BiFC) [6], Förster resonance energy transfer (FRET) [7]–based interaction assays including bioluminescence resonance energy transfer (BRET) [8], and proximity-dependent enzyme labeling techniques like ascorbic acid peroxidase (APEX) tagging [9], all rely on the expression of modified proteins and thus do not allow the study of the interaction and proximity of endogenous proteins. These can be monitored by an in situ proximity ligation assay (PLA) employing two oligo-coupled antibodies that, depending on their distance, direct the ligation of a DNA circle as a substrate for a nonlinear rolling circle amplification (RCA) process [10].In contrast to RCA, the branched DNA (bDNA) method amplifies signals linearly through a sequential hybridization process [11]. This amplification procedure allows the detection of a single molecular target per cell with a broad detection range. The bDNA method has been extensively used in a microwell format to detect and quantify specific nucleic acid sequences, providing sensitive, specific, and reliable tools in the diagnosis of viral and bacterial infections [12]. More recently, bDNA has been combined with other technologies to allow the quantification of DNA or RNA targets in suspension cells or samples mounted on slides [13,14].Based on the bDNA method, we developed a new branched proximity hybridization assay (bPHA), which allows one to monitor the proximity between target proteins by flow cytometer, thereby combining single-cell resolution with high throughput. We show that bPHA provides quantitative measurement of protein proximity in a large dynamic range. In addition, bPHA can be combined together with fluorescent staining in mixed cell populations. Employing bPHA, we studied the organization of the B cell antigen receptor (BCR), comprising a homodimeric membrane-bound immunoglobulin (mIg) molecule and the CD79a/CD79b heterodimer. We confirm the reorganization of different classes of the BCR upon B cell stimulation and demonstrate the potential of this new assay in cell signaling studies.
Results
The bPHA detects the dimeric organization of mIgM on the B cell surface
Similar to PLA, the bPHA employs a pair of oligos (plus and minus) that are coupled to target-binding probes such as nanobody, aptamer, or antibody (Fig 1A). If the two target proteins are proximal to each other, the specific binding probes are placing the two oligos close to each other so that they can serve as templates for a bDNA signal amplification [11]. Through a sequential hybridization to a pair of Z-DNA, preamplifier, amplifier, and finally, fluorescent label probes (Fig 1B–1D), theoretically, the bDNA method linearly amplifies the proximity signal 400 times [12,15]. Importantly, our design of bPHA does not use directly the proximity between the plus and minus oligos for signal amplification but, rather, through a pair of Z-DNA molecules as a bridge. Therefore, by simply changing one part of the Z-DNA sequence, a different set of preamplifier, amplifier, and fluorescent label probes can be used for bDNA signal amplification (Fig 1E). This allows one to switch the fluorescence of bPHA signals to adapt different experimental settings without making target protein-binding probes with another pair of oligos.
Fig 1
The bPHA specifically detects the proximal localization of BCRs on Ramos cell surface.
(A-D) Schematic presentation of bPHA. The proximity of protein A and protein B is converted to the proximity of plus and minus oligos. The oligos are then hybridized to Z-DNA, followed by preamplifier, amplifier, and finally, fluorescent label probes. (E) Diagram showing that changing a part of the Z-DNA allows the change of fluorescence of bPHA signal. (F) Schematic presentation of TD05 aptamer and the TD05− and TD05+ derivatives. (G) Flow cytometry results showing similar staining of Ramos cells with Cy5-labeled TD05, TD05+, and TD05−. Cells stained with Cy5-coupled unrelated aptamer functioned as negative control. (H) TD05+:TD05− bPHA signal measured by flow cytometry for Ramos cells treated with the indicated probes. (I) Confocal microscopic images of Ramos cells after bPHA and anti-IgM staining. (G-I) Data represent at least three independent experiments. (J) Schematic drawing explaining what could be measured by the TD05+:TD05− bPHA. BCR, B cell antigen receptor; bPHA, branched proximity hybridization assay; Cy5, cyanine 5; HC, heavy chain; IgM, immunoglobulin M; LC, light chain; MFI, mean fluorescence intensity.
The bPHA specifically detects the proximal localization of BCRs on Ramos cell surface.
(A-D) Schematic presentation of bPHA. The proximity of protein A and protein B is converted to the proximity of plus and minus oligos. The oligos are then hybridized to Z-DNA, followed by preamplifier, amplifier, and finally, fluorescent label probes. (E) Diagram showing that changing a part of the Z-DNA allows the change of fluorescence of bPHA signal. (F) Schematic presentation of TD05 aptamer and the TD05− and TD05+ derivatives. (G) Flow cytometry results showing similar staining of Ramos cells with Cy5-labeled TD05, TD05+, and TD05−. Cells stained with Cy5-coupled unrelated aptamer functioned as negative control. (H) TD05+:TD05− bPHA signal measured by flow cytometry for Ramos cells treated with the indicated probes. (I) Confocal microscopic images of Ramos cells after bPHA and anti-IgM staining. (G-I) Data represent at least three independent experiments. (J) Schematic drawing explaining what could be measured by the TD05+:TD05− bPHA. BCR, B cell antigen receptor; bPHA, branched proximity hybridization assay; Cy5, cyanine 5; HC, heavy chain; IgM, immunoglobulin M; LC, light chain; MFI, mean fluorescence intensity.As a proof of concept, we employed bPHA to measure the proximity of BCR complexes on the surface of the human B cell line Ramos. The BCR on Ramos cells is a binding target of the DNA aptamer TD05 [16]. Secondary structure analysis predicts that the 5′ and 3′ ends of TD05 form a stable stem, which is unlikely to be involved in epitope binding (Fig 1F). Therefore, we generated two TD05 derivatives, one with a plus oligo attached to the 3′ end (TD05+) and another one with a minus oligo attached to the 5′ end (TD05−) of the TD05 (Fig 1F). We also generated cyanine 5 (Cy5)-coupled derivatives of TD05, TD05+, and TD05− and showed that an oligo extension of TD05 did not change the binding of the aptamer to the BCR on Ramos B cells (Fig 1G).For bPHA, the Ramos cells were left untreated or exposed to saturating amounts of either TD05+, TD05−, or both aptamers. The cells were then washed, fixed, and incubated sequentially with Z-DNA and bDNA signal amplification components. Here, we used a pair of Z-DNA molecules that match to bDNA components generating fluorescence signal of Alexa Fluor 488. The bPHA signal was then quantified by flow cytometry with the setting for the green fluorescent protein/fluorescein isothiocyanate (GFP/FITC) channel (Fig 1H). Although cells treated with only the TD05− showed a weak increase of bPHA signal, a clear positive bPHA signal was only detected when the Ramos B cells were incubated with both the TD05+ and TD05− aptamer and the complete bDNA components. Under the confocal microscope, the TD05+:TD05− bPHA signal was restricted to the Ramos cell surface, where it is colocalized with fluorescent anti-humanIgM antibodies (Fig 1I). Taken together, these results suggest that the TD05+:TD05− bPHA detects a dimeric IgM complex (Fig 1J, left). However, we do not know the exact epitope covered by the TD05 aptamer on the mIgM molecule. The TD05 aptamer may bind once or twice to the homodimeric mIgM molecule (Fig 1J). In the latter case, the TD05+:TD05− bPHA signal may be specific for the mIgM homodimer (Fig 1J, right).
The bPHA provides quantitative proximity measurements within a large dynamic range
To test the dynamic range of the bPHA signal, we expressed on Ramos B cells a GFP-μm fusion protein carrying an N-terminal GFP extension instead of the variable and the first constant domain (VH and CH1) of the μm heavy chain (Fig 2A). GFP is a specific binding target of the nanobody Enhancer (Enh) [17]. The used Enh construct carries a C-terminal LPETG sortag that can be site-specifically labeled with either a plus or a minus oligo through a sortase-mediated transpeptidation [18] (S1 Fig). We first used a Cy5-coupled Enh (Enh Cy5) to test for the GFP-μm expression on transfected Ramos cells and found that Cy5-Enh binding correlates well with GFP expression (Fig 2B). We then used the oligo-coupled Enh+ and Enh− for bPHA. Because it is necessary to distinguish the bPHA signal from the GFP signal, here we used another pair of Z-DNA molecules that match to bDNA components generating fluorescence signal of Alexa Fluor 647 and quantified the bPHA signal by flow cytometry with the setting for the Cy5/ allophycocyanin (APC) channel. A bPHA signal was only obtained with the GFP-positive Ramos B cells (Fig 2C). Interestingly, cells treated with Enh− alone did not give any bPHA signal compared with other controls (S2 Fig), suggesting that the weak signal observed previously in the cells treated with TD05− (Fig 1H) is likely to be experiment specific instead of a general problem of bPHA.
Fig 2
The bPHA provides an excellent quantitative measurement of protein proximity in a large dynamic range.
(A) Schematic illustration showing that every GFP-μm expressed on Ramos cells surface have two GFPs in proximity that could be detected by Enh+:Enh− bPHA. (B) Flow cytometry results showing that the surface GFP-μm expression as assayed by Enh Cy5 staining is correlated with the GFP expression level. Gated for GFP+ cells. (C) Enh+:Enh− bPHA signal measured by flow cytometry for GFP− and GFP+ cells. (D) Flow cytometry results showing that the Enh+:Enh− bPHA signal is correlated with GFP signal. Gated for GFP+ cells. (E) Statistical analysis for data presented in (D). Raw data used for this plot are included in S1 Data. (F) Enh:Enh PLA signal measured by flow cytometry for GFP− and GFP+ cells. (G) Flow cytometry results showing that the Enh:Enh PLA signal is not correlated with GFP signal. Gated for GFP+ cells. (H) Statistical analysis for data presented in (G). Raw data used for this plot are included in S2 Data. Data are representative of a minimum of three independent experiments. bPHA, branched proximity hybridization assay; Cy5, cyanine 5; Enh, Enhancer; GFP, green fluorescent protein; PLA, proximity ligation assay.
The bPHA provides an excellent quantitative measurement of protein proximity in a large dynamic range.
(A) Schematic illustration showing that every GFP-μm expressed on Ramos cells surface have two GFPs in proximity that could be detected by Enh+:Enh− bPHA. (B) Flow cytometry results showing that the surface GFP-μm expression as assayed by Enh Cy5 staining is correlated with the GFP expression level. Gated for GFP+ cells. (C) Enh+:Enh− bPHA signal measured by flow cytometry for GFP− and GFP+ cells. (D) Flow cytometry results showing that the Enh+:Enh− bPHA signal is correlated with GFP signal. Gated for GFP+ cells. (E) Statistical analysis for data presented in (D). Raw data used for this plot are included in S1 Data. (F) Enh:Enh PLA signal measured by flow cytometry for GFP− and GFP+ cells. (G) Flow cytometry results showing that the Enh:Enh PLA signal is not correlated with GFP signal. Gated for GFP+ cells. (H) Statistical analysis for data presented in (G). Raw data used for this plot are included in S2 Data. Data are representative of a minimum of three independent experiments. bPHA, branched proximity hybridization assay; Cy5, cyanine 5; Enh, Enhancer; GFP, green fluorescent protein; PLA, proximity ligation assay.Importantly, the flow cytometry analysis of these cells shows that the bPHA signal is proportional to the GFP expression even at high fluorescence intensities (Fig 2D). When the single-cell fluorescence intensity values were exported for statistical analysis, the bPHA signal showed a linear correlation to the GFP signal with an R2 value of 0.82, in spite of the fact that the GFP expression varied in a vast range (Fig 2E). Using plus and minus probe-coupled Enh, the proximity between the GFP domains was also measured by PLA. Similar to bPHA, positive PLA signal was only detected in the GFP-positive Ramos B cells (Fig 2F). However, in this GFP-positive population, the PLA signal is not proportional to the GFP expression level (Fig 2G). In fact, analysis of the exported single-cell fluorescence intensity values shows that the PLA signal is hardly correlated with the GFP signal, with an R2 value of only 0.007 (Fig 2H).These results thus demonstrated that unlike the PLA, the bPHA signal can be better read out by flow cytometry, and thus, bPHA provides an excellent quantitative measurement of protein proximity in a large dynamic range.
The bPHA can quantify receptor proximity in a mixed cell population
Our analysis of the Ramos GFP-μm transfectants showed that bPHA signal detection might be combined with a flow cytometry analysis of other fluorescence signals, thus allowing a proximity analysis of a heterogenous cell population. As a proof of principle for this, we conducted the bPHA with a mixture of four different Ramos cell variants generated from the Ramos wild-type (WT) line by a CRISPR/Cas9-mediated gene knock-out and vector transfections (Fig 3A). The four Ramos variants expressed either the IgM-BCR or the IgD-BCR in the presence or absence of the GFP-μm fusion protein and can be identified in a flow cytometry analysis by gating for IgD and GFP expression (Fig 3B). The amount of the BCR and the GFP-μm on the surface of the Ramos variant lines was determined by flow cytometry using TD05 Cy5 and Enh Cy5, respectively (S3 Fig). Note that the TD05 aptamer binds to both the IgM- and the IgD-BCR. The mixed Ramos cells were probed for BCR or GFP proximity by bPHA using TD05+/TD05− or Enh+/Enh− probe pairs and then stained with anti-humanIgD phycoerythrin (PE) antibody. The TD05+:TD05− and Enh+:Enh− bPHA signals were then quantified for each gated population by flow cytometry (Fig 3C and 3D). In agreement with the equal BCR expression on the surface of Ramos cell variants (S3A Fig), the quantification of the TD05+:TD05− bPHA signals gave similar values (Fig 3C). The Enh+:Enh− bPHA signal was only detected on the GFP+ cells and gave a higher value for the IgD-BCR-producing Ramos cells that also carry more GFP-μm fusion protein on their surface (compare Fig 3D with S3B Fig).
Fig 3
The bPHA works in a mixed cell population.
(A) Schematic diagram showing the route map for generating GFP-μm-expressing IgM or IgD KO cells from WT Ramos B cells by CRSPR/Cas9 method. (B) Flow cytometry results showing that the subpopulations of the mixed cells can be identified by gating for the expression of GFP and anti-IgD staining. (C and D) TD05+:TD05− (C) or Enh+:Enh− (D) bPHA results were measured by flow cytometry and analyzed by the gating strategy shown in (B). Data represent three independent experiments. bPHA, branched proximity hybridization assay; Enh, Enhancer; GFP, Green fluorescent protein; IgD, immunoglobulin D; IgM, immunoglobulin M; KO, knock-out; PE, phycoerythrin; WT, wild-type.
The bPHA works in a mixed cell population.
(A) Schematic diagram showing the route map for generating GFP-μm-expressing IgM or IgD KO cells from WT Ramos B cells by CRSPR/Cas9 method. (B) Flow cytometry results showing that the subpopulations of the mixed cells can be identified by gating for the expression of GFP and anti-IgD staining. (C and D) TD05+:TD05− (C) or Enh+:Enh− (D) bPHA results were measured by flow cytometry and analyzed by the gating strategy shown in (B). Data represent three independent experiments. bPHA, branched proximity hybridization assay; Enh, Enhancer; GFP, Green fluorescent protein; IgD, immunoglobulin D; IgM, immunoglobulin M; KO, knock-out; PE, phycoerythrin; WT, wild-type.
A nanoscale receptor reorganization is detected on activated B cells by bPHA
The antigen-specific activation of mature B lymphocyte is accompanied by the opening of the oligomeric IgM-BCR and IgD-BCR and an increased IgM:IgD proximity [19]. To test for this nanoscale receptor reorganization, the IgD-BCR and GFP-μm-expressing Ramos B cells were directly exposed to saturate concentration of the oligo-coupled TD05 and/or Enh for 30 min for stimulation. The stimulated Ramos cells and untreated resting cells were then fixed and subjected to the TD05+:TD05−, TD05+:Enh−, and Enh+:Enh− bPHA analysis (Fig 4A). A weak TD05+:Enh− bPHA signal was detected on the resting IgD-BCR/GFP-μm Ramos cells, whereas this signal increased substantially upon B cell activation. Thus, an activation-dependent increased proximity of the IgD-BCR and GFP-μm proteins is detected on the Ramos B cell surface by bPHA (Fig 4B). A positive TD05+:TD05− bPHA signal was already monitored on resting Ramos cells and only slightly reduced upon cell stimulation, whereas the positive Enh+:Enh− bPHA signal remained unchanged on resting and stimulated Ramos cells (Fig 4A). This is in line with the equal staining of these cells with the TD05-Cy3 and Enh Cy5 reagents before and after stimulation (S4 Fig). Together, these results suggest that the TD05+:TD05− and Enh+:Enh− bPHAs mostly monitor the interdomain organization of the IgD-BCR and the GFP-μm chimeric molecule, respectively. Therefore, TD05 seems to have two identical binding sites inside the dimeric mIg molecule (Fig 4B).
Fig 4
The bPHA confirms the rearrangement of BCR upon stimulation.
(A) TD05+:TD05−, TD05+:Enh−, and Enh+:Enh− bPHA signals were measured by flow cytometry for resting and stimulated IgM-KO GFP-μm-expressing Ramos cells. The stimulated cells without the corresponding target binding probes served as control. Data represent four independent experiments. (B) Schematic diagrams showing that on the surface of IgM-KO GFP-μm-expressing Ramos cells surface, upon stimulation, IgD-BCR and GFP-μm mix together, producing positive TD05+:Enh− bPHA signal. BCR, B cell antigen receptor; bPHA, branched proximity hybridization assay; Enh, Enhancer; IgD, immunoglobulin D; IgM, immunoglobulin M; KO, knock-out.
The bPHA confirms the rearrangement of BCR upon stimulation.
(A) TD05+:TD05−, TD05+:Enh−, and Enh+:Enh− bPHA signals were measured by flow cytometry for resting and stimulated IgM-KO GFP-μm-expressing Ramos cells. The stimulated cells without the corresponding target binding probes served as control. Data represent four independent experiments. (B) Schematic diagrams showing that on the surface of IgM-KO GFP-μm-expressing Ramos cells surface, upon stimulation, IgD-BCR and GFP-μm mix together, producing positive TD05+:Enh− bPHA signal. BCR, B cell antigen receptor; bPHA, branched proximity hybridization assay; Enh, Enhancer; IgD, immunoglobulin D; IgM, immunoglobulin M; KO, knock-out.
Class-specific kinetics of spleen tyrosine kinase recruitment to the activated BCR is monitored by bPHA
B cell activation is accompanied by the activation of several protein tyrosine kinases (PTKs) and an increase in PTK substrate phosphorylation. In particular, the spleen tyrosine kinase (Syk) plays a central role in the opening of the BCR and BCR signal amplification [20]. This involves the phosphorylation of the two tyrosines located in the immunoreceptor tyrosine-based activation motif (ITAM) of the BCR signaling subunits CD79a and CD79b and the binding of the tandem Src Homology 2 (SH2) domains of Syk to the double phosphorylated immune-receptor tyrosine activation motif (ppITAM) sequence [21,22]. Thus, the recruitment of Syk to the CD79a/CD79b heterodimer is a good indicator for BCR activation.To monitor the increased Syk/BCR proximity during the Syk recruitment process on a single-cell basis, we developed an intracellular bPHA (Fig 5A). For this, we first labeled anti-Syk and anti-CD79a antibodies with the minus and plus oligo, respectively, using a cross-linker and click chemistry. The labeling efficiency of the antibodies was verified by SDS-PAGE (S5 Fig). Enriched splenic B cells from C57BL/6 mice were left resting or stimulated for different times (1, 5, 10 min) with either anti-IgD or anti-IgM antibodies. After fixation and permeabilization of the cells, we employed the oligo-coupled anti-CD79a and anti-Syk antibodies for bPHA (Fig 5B). An anti-CD79a+:anti-Syk− bPHA signal was already detected in some of the resting B cells. However, this signal increased in the majority of B cells upon their stimulation, indicating a recruitment of Syk to the BCR. Interestingly, our intracellular bPHA depicted class-specific differences in the recruitment of Syk to the BCR. In the anti-IgM-stimulated B cells, the anti-CD79a+:anti-Syk− bPHA signal peaked at 1 min, whereas in the anti-IgD-stimulated B cells, the signal was still increasing 10 min after the stimulation. This is consistent with a previous western blot study showing that IgD-BCR induces a stronger and more prolonged protein tyrosine phosphorylation than IgM-BCR upon stimulation [23]. Unlike the western blot, however, the bPHA offers single-cell resolution and delineates heterogeneity in the Syk recruitment of the activated B cell population. Depending on the time point, only 30%–50% of the B cells show an increased Syk:CD79a proximity, indicating that BCR signaling is not synchronized in all B cells, probably because of the heterogeneity of surface BCR expression in the isolated splenic B cells (S6 Fig).
Fig 5
The bPHA uncovers class-specific kinetics of Syk recruitment to BCR.
(A) Schematic diagrams showing that upon stimulation, Syk can be recruited to CD79a. The proximity between CD79a and Syk can be measured by bPHA using oligo-coupled anti-CD79a and anti-Syk antibodies. (B) Anti-CD79a+:anti-Syk− bPHA signals were measured by flow cytometry for resting and anti-IgD- or anti-IgM-stimulated splenic B cells. Cells without the corresponding target binding probes served as controls for both the resting and stimulated cells. Data represent three independent experiments. BCR, B cell antigen receptor; bPHA, branched proximity hybridization assay; IgD, immunoglobulin D; IgM, immunoglobulin M; Syk, spleen tyrosine kinase.
The bPHA uncovers class-specific kinetics of Syk recruitment to BCR.
(A) Schematic diagrams showing that upon stimulation, Syk can be recruited to CD79a. The proximity between CD79a and Syk can be measured by bPHA using oligo-coupled anti-CD79a and anti-Syk antibodies. (B) Anti-CD79a+:anti-Syk− bPHA signals were measured by flow cytometry for resting and anti-IgD- or anti-IgM-stimulated splenic B cells. Cells without the corresponding target binding probes served as controls for both the resting and stimulated cells. Data represent three independent experiments. BCR, B cell antigen receptor; bPHA, branched proximity hybridization assay; IgD, immunoglobulin D; IgM, immunoglobulin M; Syk, spleen tyrosine kinase.
Discussion
We here demonstrated that the bDNA signal amplification method can be adopted for a new proximity assay with nanometer resolution. Most cellular processes depend on a close proximity of molecular components, but these nanoscale organizations are difficult to study with the light microscope. Thus, in recent years, several new proximity methods have been developed [24]. Among them, PLA offers a unique advantage to study the organization of unmodified endogenous proteins. PLA was originally designed to visualize protein–protein interactions in situ. PLA results are captured as microscopic images, and PLA dots are counted from these images [10]. As PLA requires imaging processing, its throughput is limited to a few hundred cells per experiment. Recently, PLA was combined with flow cytometry to simplify data acquisition and improve throughput [25-27]. However, because of the fact that the signaling amplification of PLA through RCA is nonlinear, the PLA signals are bound to saturate at a higher density [28]. In our hands, staining cells with high amounts of probes often generates indistinguishable saturated PLA signals for samples and controls, whereas staining cells with low amounts of probes produces weak signals that are hardly detected by flow cytometer. We thus prefer to quantify PLA results by counting dots of microscopic images [20,29,30].Except for enzyme-catalyzed amplification, an oligonucleotide can also be amplified by hybridization. Recently, the proximity-dependent hybridization chain reaction (proxHCR) method was described for detecting protein proximities in microscopy and flow cytometry using a local HCR to amplify signals from two closely positioned hairpin oligonucleotides [31]. Because it also depends on the dual binding of proximity probes, proxHCR reaches similar specificities to in situ PLA. However, it was not determined whether the HCR method is able to amplify the proximity signal linearly.With bPHA, the protein proximity signal is linearly amplified by bDNA that has a broad detection range over four to five orders of magnitude [12]. Thus, this amplification procedure can be combined with flow cytometry, thereby achieving high throughput (thousands to millions of cells per measurement) with single-cell resolution. As proof of principle, we showed in our flow cytometric analysis of dimeric GFP-μm-expressing Ramos B cells that the bPHA signals are linearly correlated with GFP expression over a big range. In addition, modern flow cytometers are equipped with multiple lasers, enabling bPHA measurement in mixed cell populations, as we have shown in this work. By using aptamers or nanobodies instead of Fab fragments or whole antibodies, we also improved the molecular resolution of the proximity assay. A limitation of this high-resolution assay is that, in the case of dimeric proteins, our bPHA preferentially detects intra- instead of intermolecular proximity.Similar to PLA, for bPHA, the proximity between two target proteins is translated via oligo- coupled binding reagents into the proximity of a plus and minus oligo. However, in our design for bPHA, the proximity between the plus and minus oligos is not directly used for bDNA signal amplification but, rather, for the close pairing of two Z-DNAs. As we have shown here, this design allows us to switch between bDNA components with different fluorescence dyes to fit with different conditions using the same pair of oligos. Furthermore, different molecules in the same cell could be labeled with their specific binding probes carrying different oligo sequences. The proximities between these different oligos might then be picked up and amplified by different pairs of Z-DNA and amplifier reagents, thus making it appropriate to multiplex bPHA reactions for monitoring an array of molecular proximities.By using nonpermeabilized cells, the bPHA can specifically monitor the proximity of molecules on the cell surface. In this way, we show here that the IgD-BCR and IgM-BCR are segregated from each other on resting B cells but concatenated after B cell stimulation, thus confirming previous Fab-PLA and superresolution microscopy studies [19]. After a cellular permeabilization, our bPHA method can, however, also monitor intracellular molecular proximities. This we employed for a kinetic study of the Syk recruitment to the BCR in activated splenic B murine cells. We found that anti-IgD stimulation results in a more prolonged and prominent Syk recruitment than the anti-IgM stimulation, which is in line with the kinetics of protein phosphorylation upon IgD-BCR and IgM-BCR activation [23].
Materials and methods
Ethics statement
The animals were maintained and used in agreement with The German Animal Welfare Act (Das deutsche Tierschutzgesetz). Animals were sacrificed under the project X-17/10C and registered with the Committee on Animal Experimentation of the Regional Council Freiburg, Germany (Tierversuchskommission des Regierungspräsidiums Freiburg, Deutschland).
Binding reagents
For surface staining of Ramos cells, the following anti-human antibodies, aptamers, and nanobodies were used: anti-IgMeFluor 450 (SA-DA4, eBioscience, 12-9998-42), TD05 Cy5, TD05+ Cy5, TD05− Cy5, TD05 Cy3 (custom order from Sigma-Aldrich), Enh Cy5 (homemade), and anti-IgD PE (IA6-2, BD Bioscience, 555779). For surface staining of mouse splenic B cells, the following anti-mouse antibodies were used: anti-IgMeFluor 450 (eB121-15F9, eBioscience, 14-5890-82) and anti-IgDFITC (11-26c.2a, Biolegend, 405704). For stimulating mouse splenic B cells, anti-IgM (polyclonal, SouthernBiotech, 2020–01) and anti-IgD (polyclonal, eBioscience, 24-5093-51) were used. For bPHA probe preparation, the following antibodies were used: anti-CD79a (JCB117+HM47/A9, abcam, ab213114) and anti-Syk (SYK-01, Biolegend, 626202).
Cell culture
All Ramos cell lines (German Collection of Microorganisms and Cell Cultures DSMZ ACC603) were cultured in RPMI medium (Gibco, with stable glutamine) supplemented with 10% FCS (Biochrom), 10 units/mL penicillin/streptomycin (Gibco), and 50 mM beta-mercaptoethanol (Sigma-Aldrich) at 37°C in 5% CO2. The Phoenix cell line was cultured in Iscove’s medium (Biochrom, with stable glutamine) supplemented with 10% FCS (PAN Biotech), 10 units/mL penicillin/streptomycin (Gibco), and 50 mM beta-mercaptoethanol (Sigma-Aldrich) at 37°C in 7.5% CO2.
Retroviral transduction
Retroviral transductions in Ramos cells were performed as previously described [32]. In brief, Phoenix cells were transfected using PolyJet DNA in vitro transfection reagent following the manufacturer’s protocol (SignaGen Laboratories). Retrovirus-containing supernatants were collected 48 h after transfection and used for transduction.
Isolation of mouse splenic B cells
Total splenocytes were isolated from 8-wk-old to 12-wk-old C57BL/6 mice (female or male). Splenic B cells were enriched by MACS depletion of CD43+ cells using anti-CD43 magnetic beads (Miltenyi Biotech) according to the manufacturer’s instructions. The purified splenic B cells were cultured for a minimum of 2 h at 37°C in 7.5% CO2 in Iscove’s medium (Biochrom, with stable glutamine) supplemented with 10 units/mL penicillin/streptomycin, 50 mM beta-mercaptoethanol (Sigma-Aldrich), and 10% FCS (PAN Biotech). The splenic B cells were then further analyzed for IgM- and IgD-BCR surface expression or stimulated with antibodies, and the recruitment of Syk to CD79a by bPHA was detected.
Flow cytometry analysis
For Ramos cells, 2 × 105 cells were stained with TD05 Cy5 (1 mM), TD05+ Cy5 (1 mM), TD05 Cy3 (1 mM), TD05− Cy5 (1 mM), Enh Cy5 (1.5 μg/mL), or anti-IgD PE (1:100) in 100 μL of PBS. For mouse splenic B cells, 2 × 105 cells were stained with anti-IgMeFluor 450 (1:100) and anti-IgDFITC (1:100) in 100 μL of PBS. Staining was performed at 4°C for 15 min. After washing, samples were measured with the Attune NxT Flow Cytometer (Thermo Fisher Scientific). Data were exported in FCS-3.0 format and analyzed with FlowJo software (TreeStar).
Confocal imaging
After bPHA and staining, cells were transferred to 18-well μ-slides (ibidi) and rested for 15 min to allow the attachment of cells to the slides. Samples were then imaged using a Zeiss 780 Meta confocal microscope (Carl Zeiss) equipped with a Zeiss Plan-Apochromat 63× oil immersion objective lens. Images were processed using ImageJ.
Sortase-mediated transpeptidation
The pentamutant sortase [33] was expressed in Escherichia coli with a 6xHis tag at the C terminus and purified by Ni-NTA. The sortase-mediated transpeptidation was performed overnight at 4°C in 50 mM Tris (pH 7.5), 150 mM NaCl, and 10 mM CaCl2 sortagging buffer by mixing 100 μM Enh with 500 μM GGG-oligo (plus oligo: TGCATAATCACCACTAAAACTGTAAAGCT AAGTGA or minus oligo: GTTACGAAACACGCTCTAAGTCTCTAAACTCGAAT, ordered from Biomers) and 2.5 μM sortase. Afterward, the His-tagged sortase and remaining His-tagged, unlabeled Enh and His-tagged Gly residue produced during sortagging were all removed by passing over a Ni-NTA column (Qiagen).
SDS-PAGE
Protein samples were mixed with 5× nonreducing/reducing loading buffer and then heated at 95°C for 5–10 min. Protein marker (PageRule Prestained 10–180 kDa Protein Ladder, Thermo Fisher Scientific) and equal amounts of proteins were loaded and separated on 12.5% Tris-glycineSDS-PAGE gels. Gels were stained in 20–30 mL protein staining solution (Instant BlueTM, expedeon) overnight. The next day, gels were imaged by Molecular Imager Gel DocTM XR+ (BioRad). All recorded images were analyzed with Image Lab software.
Antibody labeling
To label antibodies with oligo, 100 μg (0.67 nmole) of anti-CD79a and anti-Syk were first mixed with 20 nmole cross-linker DBCO-Sulfo-NHS-ester (762040, Sigma-Aldrich). Samples were incubated at 37°C for 60 min. After desalting (Zeba spin desalting columns, Thermo Fisher Scientific), cross-linker-activated antibodies were mixed with 12 nmole of either plus or minus oligos (Azid-PEG4 modified at 5′ for the plus and 3′ for the minus oligo, ordered from Biomers). Samples were then kept at 37°C for 30 min. Labeled antibodies were kept at 4°C.
bPHA
For measuring the proximity between BCRs (TD05+:TD05−), between GFP domains of GFP-μm (Enh+:Enh−), or between BCR and GFP-μm (TD05+:Enh−) by bPHA, 1 × 106 Ramos WT or mutant cells were aliquoted and washed with DPBS (Sigma-Aldrich). Cells were stained in 100 μL of DPBS with the corresponding oligo-coupled TD05 and/or Enh probes at 4°C for 30 min and fixed with the PrimeFlow fixation buffer 1 (PrimeFlow RNA Assay, Thermo Fisher Scientific) in the dark for 30 min at 4°C.For detecting the reorganization of BCR upon stimulation, cells first fixed and later stained with bPHA probes were treated as resting cells, whereas cells stained with bPHA probes for 30 min at 4°C and then fixed were treated as stimulated cells.To monitor the recruitment of Syk to CD79a, 2.5 × 106 mouse splenic B cells were aliquoted, washed with DPBS (Sigma-Aldrich), resuspended in 500 μL DPBS, and cultured at 37°C for 20–30 min. Cells were stimulated with anti-mouse-IgM (1:500) or anti-mouse-IgD (1:500) for 1, 5, and 10 min, respectively. Untreated cells were used as 0-min control. After fixation, cells were permeabilized using the PrimeFlow Permeabilization Buffer (PrimeFlow RNA Assay, Thermo Fisher Scientific), stained with anti-CD79a plus and anti-Syk minus probes at 4°C for 30 min, and then fixed again with the PrimeFlow fixation buffer 2 (PrimeFlow RNA Assay, Thermo Fisher Scientific) in the dark for 60 min at room temperature (RT).The bPHA probe final concentration was as follows: TD05+, 1 μM; TD05−, 1 μM; Enh+, 1.5 μg/mL; Enh−, 1.5 μg/mL; anti-CD79a+, 5 μg/mL; anti-Syk−, 0.25 μg/mL.Cells already labeled with the corresponding bPHA probes and fixed then underwent bDNA signal amplification according to the manufacturer’s instructions of the PrimeFlow RNA Assay Kit (Thermo Fisher Scientific). In brief, cells were first hybridized with the Z-DNA pairs (1:20 in target probe diluent) for 2 h at 40°C. After washing with the wash buffer (2×, 5 min, RT), bPHA signals were further amplified and fluorescently labeled by a sequential hybridization with the standard PreAmp Mix (1.5 h), Amp Mix (1.5 h), and Label Probes mix (1:200 in target probe diluent, 1 h) at 40°C with 2×, 5-min RT wash with the wash buffer after each hybridization step.For measuring protein proximity in a mixed cell population, cells were further stained with anti-humanIgD PE (1:100) for 15 min at 4°C.bPHA signals were then measured by Attune NxT Flow Cytometer (Thermo Fisher Scientific).
Flow PLA
Purified Enh was coupled to Duolink PLA probes following the manufacturer’s instructions of Duolink PLA Probemaker PLUS and Duolink PLA Probemaker MINUS kits (Sigma-Aldrich). The flow PLA is performed based on the Duolink PLA Flow Cytometry protocol (Sigma-Aldrich) with modification using the Duolink flowPLA Detection Kit–Orange (Sigma-Aldrich). In brief, 5 × 105 cells were washed with PBS and then incubated with plus and minus oligo-labeled Enh (1:5 each in Duolink Probe Diluent) for 1 h at 37°C. After washing twice with ice-cold PBS, the cells were fixed by 2% paraformaldehyde (PFA) at RT for 20 min and then blocked with Duolink Blocking Solution (1 h, 37°C) after washing. Washing with PBS again, ligase (1:40 in Duolink Ligation buffer) was then mixed with the cells and incubated for 30 min at 37°C for ligation to happen. After washing twice with Duolink Wash Buffer A, the cells were then incubated with polymerase (1:80 in amplification buffer) overnight at 37°C. After washing twice with Duolink Wash Buffer B, the cells were incubated for 30 min at 37°C with 1X flowPLA Detection Solution. After washing twice more with Duolink Wash Buffer B, the cells were then subjected to measurement using Attune NxT Flow Cytometer (Thermo Fisher Scientific).
Sortase-mediated site-specific labeling of Enh with oligo extensions for bPHA.
(A) Schematic presentation of the labeling reaction. (B and C) Coomassie-stained 12.5% reducing SDS-PAGE gel showing the composition of materials after sortase-mediated transpeptidation (B) or after further clearance with Ni-NTA column (C). bPHA, branched proximity hybridization assay; Enh, Enhancer; Ni-NTA; nickel-nitrilotriacetic acid.(TIF)Click here for additional data file.
Enh+:Enh− bPHA signal measured by flow cytometry for GFP-μm-expressing Ramos cells treated with the indicated probes.
bPHA, branched proximity hybridization assay; Enh, Enhancer; GFP; green fluorescent protein.(TIF)Click here for additional data file.
Surface BCR and GFP-μm levels in mixed cell population.
(A and B) Flow cytometry results showing the surface IgD- or IgM-BCR level evaluated by TD05 Cy5 staining (A) or GFP-μm level by Enh Cy5 staining (B) for the mixed Ramos cells following the gating strategy shown in Fig 3B. BCR, B cell antigen receptor; Cy5, cyanine 5; Enh, Enhancer; GFP, green fluorescent protein; IgD, immunoglobulin D; IgM, immunoglobulin M.(TIF)Click here for additional data file.
Surface IgD-BCR and GFP-μm levels are not changed upon stimulation.
(A and B) Flow cytometry results showing the surface IgD-BCR level evaluated by TD05 Cy3 staining (A) or GFP-μm level by Enh Cy5 staining (B) for the resting and activated IgM-KO GFP-μm-expressing Ramos cells. BCR, B cell antigen receptor; Cy3, cyanine 3; Cy5, cyanine 5; Enh, Enhancer; GFP, green fluorescent protein; IgD, immunoglobulin D; IgM, immunoglobulin M; KO, knock-out.(TIF)Click here for additional data file.
The 12.5% reducing TGX Stain-Free gel showing the composition of antibodies after coupling to the oligo extensions.
TGX; tris-glycine extended.(TIF)Click here for additional data file.
Flow cytometry results showing the heterogeneity of mouse splenic B cells in terms of the surface expression of IgD- and IgM-BCR.
BCR, B cell antigen receptor; IgD, immunoglobulin D; IgM, immunoglobulin M.(TIF)Click here for additional data file.
Excel spreadsheet containing the underlying numerical data for Fig 2E.
(XLSX)Click here for additional data file.
Excel spreadsheet containing the underlying numerical data for Fig 2H.
(XLSX)Click here for additional data file.
Raw images of S1B Fig, S1C Fig, and S5 Fig.
(PDF)Click here for additional data file.27 Jun 2019Dear Dr YANG,Thank you for submitting your manuscript entitled "A new branched proximity hybridization assay for the quantification of nanoscale protein-protein proximity" for consideration as a Methods and Resources by PLOS Biology.Your manuscript has now been evaluated by the PLOS Biology editorial staff as well as by an academic editor with relevant expertise and I am writing to let you know that we would like to send your submission out for external peer review.However, before we can send your manuscript to reviewers, we need you to complete your submission by providing the metadata that is required for full assessment. To this end, please login to Editorial Manager where you will find the paper in the 'Submissions Needing Revisions' folder on your homepage. Please click 'Revise Submission' from the Action Links and complete all additional questions in the submission questionnaire.**Important**: Please also see below for further information regarding completing the MDAR reporting checklist. The checklist can be accessed here: https://plos.io/MDARChecklistPlease re-submit your manuscript and the checklist, within two working days, i.e. by Jun 29 2019 11:59PM.Login to Editorial Manager here: https://www.editorialmanager.com/pbiologyDuring resubmission, you will be invited to opt-in to posting your pre-review manuscript as a bioRxiv preprint. Visit http://journals.plos.org/plosbiology/s/preprints for full details. If you consent to posting your current manuscript as a preprint, please upload a single Preprint PDF when you re-submit.Once your full submission is complete, your paper will undergo a series of checks in preparation for peer review. Once your manuscript has passed all checks it will be sent out for review.Feel free to email us at plosbiology@plos.org if you have any queries relating to your submission.Kind regards,Di Jiang, PhDAssociate EditorPLOS Biology==================INFORMATION REGARDING THE REPORTING CHECKLIST:PLOS Biology is pleased to support the "minimum reporting standards in the life sciences" initiative (https://osf.io/preprints/metaarxiv/9sm4x/). This effort brings together a number of leading journals and reproducibility experts to develop minimum expectations for reporting information about Materials (including data and code), Design, Analysis and Reporting (MDAR) in published papers. We believe broad alignment on these standards will be to the benefit of authors, reviewers, journals and the wider research community and will help drive better practise in publishing reproducible research.We are therefore participating in a community pilot involving a small number of life science journals to test the MDAR checklist. The checklist is intended to help authors, reviewers and editors adopt and implement the minimum reporting framework.IMPORTANT: We have chosen your manuscript to participate in this trial. The relevant documents can be located here:MDAR reporting checklist (to be filled in by you): https://plos.io/MDARChecklist**We strongly encourage you to complete the MDAR reporting checklist and return it to us with your full submission, as described above. We would also be very grateful if you could complete this author survey:https://forms.gle/seEgCrDtM6GLKFGQAAdditional background information:Interpreting the MDAR Framework: https://plos.io/MDARFrameworkPlease note that your completed checklist and survey will be shared with the minimum reporting standards working group. However, the working group will not be provided with access to the manuscript or any other confidential information including author identities, manuscript titles or abstracts. Feedback from this process will be used to consider next steps, which might include revisions to the content of the checklist. Data and materials from this initial trial will be publicly shared in September 2019. Data will only be provided in aggregate form and will not be parsed by individual article or by journal, so as to respect the confidentiality of responses.Please treat the checklist and elaboration as confidential as public release is planned for September 2019.We would be grateful for any feedback you may have.8 Aug 2019Dear Dr YANG,Thank you very much for submitting your manuscript "A new branched proximity hybridization assay for the quantification of nanoscale protein-protein proximity" for consideration as a Methods and Resources at PLOS Biology. Your manuscript has been evaluated by the PLOS Biology editors, an Academic Editor with relevant expertise, and by two independent reviewers.In light of the reviews (below), we will not be able to accept the current version of the manuscript, but we would welcome resubmission of a revised version that takes into account the reviewers' comments. You will need to include improved comparisons with other methods as requested by reviewer 1. In addition, our Academic Editor encourages you to show that the ability to quantify the interaction can be used to learn new biology, but this isn't mandatory. We cannot make any decision about publication until we have seen the revised manuscript and your response to the reviewers' comments. Your revised manuscript is also likely to be sent for further evaluation by the reviewers.Your revisions should address the specific points made by each reviewer. Please submit a file detailing your responses to the editorial requests and a point-by-point response to all of the reviewers' comments that indicates the changes you have made to the manuscript. In addition to a clean copy of the manuscript, please upload a 'track-changes' version of your manuscript that specifies the edits made. This should be uploaded as a "Related" file type. You should also cite any additional relevant literature that has been published since the original submission and mention any additional citations in your response.Please note while forming your response, if your article is accepted, you may have the opportunity to make the peer review history publicly available. The record will include editor decision letters (with reviews) and your responses to reviewer comments. If eligible, we will contact you to opt in or out.Before you revise your manuscript, please review the following PLOS policy and formatting requirements checklist PDF: http://journals.plos.org/plosbiology/s/file?id=9411/plos-biology-formatting-checklist.pdf. It is helpful if you format your revision according to our requirements - should your paper subsequently be accepted, this will save time at the acceptance stage.Please note that as a condition of publication PLOS' data policy (http://journals.plos.org/plosbiology/s/data-availability) requires that you make available all data used to draw the conclusions arrived at in your manuscript. If you have not already done so, you must include any data used in your manuscript either in appropriate repositories, within the body of the manuscript, or as supporting information (N.B. this includes any numerical values that were used to generate graphs, histograms etc.). For an example see here: http://www.plosbiology.org/article/info%3Adoi%2F10.1371%2Fjournal.pbio.1001908#s5.For manuscripts submitted on or after 1st July 2019, we require the original, uncropped and minimally adjusted images supporting all blot and gel results reported in an article's figures or Supporting Information files. We will require these files before a manuscript can be accepted so please prepare them now, if you have not already uploaded them. Please carefully read our guidelines for how to prepare and upload this data: https://journals.plos.org/plosbiology/s/figures#loc-blot-and-gel-reporting-requirements.Upon resubmission, the editors will assess your revision and if the editors and Academic Editor feel that the revised manuscript remains appropriate for the journal, we will send the manuscript for re-review. We aim to consult the same Academic Editor and reviewers for revised manuscripts but may consult others if needed.We expect to receive your revised manuscript within two months. Please email us (plosbiology@plos.org) to discuss this if you have any questions or concerns, or would like to request an extension. At this stage, your manuscript remains formally under active consideration at our journal; please notify us by email if you do not wish to submit a revision and instead wish to pursue publication elsewhere, so that we may end consideration of the manuscript at PLOS Biology.When you are ready to submit a revised version of your manuscript, please go to https://www.editorialmanager.com/pbiology/ and log in as an Author. Click the link labelled 'Submissions Needing Revision' where you will find your submission record.Thank you again for your submission to our journal. We hope that our editorial process has been constructive thus far, and we welcome your feedback at any time. Please don't hesitate to contact us if you have any questions or comments.Sincerely,Di Jiang, PhDAssociate EditorPLOS Biology*****************************************************Reviewer remarks:Reviewer #1: The paper “A new branched proximity hybridization assay for the quantification of nanoscale protein-protein proximity” by Zheng et al. describes an approach to demonstrate colocation of proteins directly in biological samples. It is a matter of increasing importance to understand functional properties of cellular systems by observing how proteins may be interacting to exert their activities, and improved methods for their analysis can be of value.The approach the authors describe is a variant of the widely used in situ PLA technique, commercially available from SigmaAldrich, and applicable both in situ and for flow cytometry as also shown by Zheng et al. using their bHPA technique. In both bHPA and in situ PLA samples are first treated with pairs of oligonucleotide-conjugated protein-binding reagents, such as antibodies. Zheng et al. demonstrate proximal binding by a hybridization-based local amplification technique called branched DNA, previously reported in reference 11 and here used via a kit, commercially available from ThermoFisher. By contrast, in the in situ PLA technique oligonucleotides on pairs of reagents brought in proximity serve as templates for ligation reactions that produce DNA circles. These DNA circles are then locally amplified via enzyme-catalyzed rolling circle amplification, resulting in prominent detection signals.Zhen et al. demonstrate the ability of their technique to reveal protein interactions in the context of signaling via the B cell antigen receptor on cell lines and mouse splenocytes, but the focus of the paper is on the method rather than the biology. I have some specific comments as follows:1. The branched DNA technique depends on that signals should only be detected when both members of the Z-DNA pairs have bound in proximity and can contribute to the strength of hybridization. In that regard it is of some concern that the bPHA signals illustrated by the light blue peak in Figure 1h are somewhat elevated over the background (shifted to the right), although still considerably lower than the red peak that illustrates the situation when all required reagents were present. This indicates that the “TD05-“ reagent alone can elicit some signal, something that could complicate analysis of protein interactions when target proteins are evaluated across a wide range of expression levels. The authors should comment on this, or preferably find conditions where this background is not observed.2. The reported 400-fold signal amplification (lines 16 and 68), should be supported either by referring to information about the kit or own measurements.3. In the abstract the bHPA technique is said to offer better quantification of protein proximity (line 13), without mentioning what this is in comparison to. Elsewhere it is clear that the authors are comparing their approach to in situ PLA as is appropriate. Unfortunately, they do not provide any data from experimental side-by-side comparisons, however, making it difficult to evaluate to what extent their technique represents real progress. In situ PLA is said to result in a nonlinear amplification process (lines 42 and 194), but this claim is supported by reference 27, which represents a not fully relevant comparison between FRET and in situ PLA. On theoretical grounds it is not obvious why branched DNA amplification would yield a more linear result than rolling circle amplification, so such claims need to be supported by evidence from direct comparisons.4. The novel element of the paper is the use of branched DNA as an enzyme-free signal amplification method to reveal protein proximity via pairs of oligonucleotide-conjugated antibodies. It would therefore be relevant also to refer to and briefly discuss the paper “Proximity-dependent initiation of hybridization chain reaction” Bjorn Koos et al., 2015, DOI: 10.1038/ncomms8294. Like bHPA and in situ PLA this paper describes analysis of protein proximity via similar pairs of DNA-conjugated reagents but using another enzyme-independent local amplification technique namely a hybridization chain reaction.5. On lines 69 and 213 the claim is made that bHPA differs from in situ PLA in that in bHPA the oligonucleotides attached to the affinity reagents are not directly used for amplification, permitting multiplexing. This is a misunderstanding, however, as for in situ PLA secondarily added oligonucleotides are converted to a DNA circle used for amplification, and similar to bHPA this renders the assays suitable for multiplexing. (By contrast, in PLA used for protein detection in solution phase, the antibody-conjugated DNA strands are directly amplified via PCR)6. Since the purpose of the paper is to demonstrate the advantages of a local amplification method different from that used in the established in situ PLA technique for protein proximity analyses, it would be preferable if side-by-side experimental comparisons were presented to help the reader evaluate how the two procedures compare. It would also be helpful to offer a theoretical comparison, perhaps in a table form, between bHPA, in situ PLA and the above mentioned proximity-dependent hybridization chain reaction. For example, the latter and bHPA differ from in situ PLA in that no enzyme is required for signal amplification, potentially simplifying automation.Reviewer #2: In the manuscript entitled ” A new branched proximity hybridization assay for the quantification of nanoscale protein-protein proximity” Zheng et al describes a method to probe for proximity, using branched hybridization to obtain a signal amplification. The authors show convincing data on the performance of the method. The advantage with the methods compared with methods such as PLA is that it does not require any enzymatic steps, hence should be more inexpensive. Novel methods for biology are needed and the development described herein will be of interest to the scientific community. I only have a minor suggestions to the authors.1. The method section is rather short and it would be valuable if more details could be added, e.g. sequences of oligos used, buffer conditions for hybridization, where was sortase obtained? For a reader who want to replicate the experiments or use the method, it is important to provide all details regarding the method.2. Why the intermediate step with hybridization of Z-DNA, can the pre-amplifier be hybridized directly to the minus and plus probe? That would remove one step of the assay.7 Oct 2019Submitted filename: Point to point answer.docxClick here for additional data file.31 Oct 2019Dear Dr YANG,Thank you for submitting your revised Methods and Resources entitled "A new branched proximity hybridization assay for the quantification of nanoscale protein-protein proximity" for publication in PLOS Biology. I have now obtained advice from the original reviewers and have discussed their comments with the Academic Editor.Based on the reviews, we will probably accept this manuscript for publication, assuming that you will modify the manuscript to address the remaining points raised by the reviewers. Please also make sure to address the data and other policy-related requests noted at the end of this email.We expect to receive your revised manuscript within two weeks. Your revisions should address the specific points made by each reviewer. In addition to the remaining revisions and before we will be able to formally accept your manuscript and consider it "in press", we also need to ensure that your article conforms to our guidelines. A member of our team will be in touch shortly with a set of requests. As we can't proceed until these requirements are met, your swift response will help prevent delays to publication.Upon acceptance of your article, your final files will be copyedited and typeset into the final PDF. While you will have an opportunity to review these files as proofs, PLOS will only permit corrections to spelling or significant scientific errors. Therefore, please take this final revision time to assess and make any remaining major changes to your manuscript.NOTE: If Supporting Information files are included with your article, note that these are not copyedited and will be published as they are submitted. Please ensure that these files are legible and of high quality (at least 300 dpi) in an easily accessible file format. For this reason, please be aware that any references listed in an SI file will not be indexed. For more information, see our Supporting Information guidelines:https://journals.plos.org/plosbiology/s/supporting-informationPlease note that you may have the opportunity to make the peer review history publicly available. The record will include editor decision letters (with reviews) and your responses to reviewer comments. If eligible, we will contact you to opt in or out. Please see here for more details:https://blogs.plos.org/plos/2019/05/plos-journals-now-open-for-published-peer-review/Please note that an uncorrected proof of your manuscript will be published online ahead of the final version, unless you opted out when submitting your manuscript. If, for any reason, you do not want an earlier version of your manuscript published online, uncheck the box. Should you, your institution's press office or the journal office choose to press release your paper, you will automatically be opted out of early publication. We ask that you notify us as soon as possible if you or your institution is planning to press release the article.To submit your revision, please go to https://www.editorialmanager.com/pbiology/ and log in as an Author. Click the link labelled 'Submissions Needing Revision' to find your submission record. Your revised submission must include a cover letter, a Response to Reviewers file that provides a detailed response to the reviewers' comments (if applicable), and a track-changes file indicating any changes that you have made to the manuscript.Please do not hesitate to contact me should you have any questions.Sincerely,Di Jiang,Associate EditorPLOS Biology------------------------------------------------------------------------ETHICS STATEMENT:Please include an Ethics Statement subsection in the beginning of the Methods section. The Ethics Statements in the submission form and Methods section of your manuscript should match verbatim. Please ensure that any changes are made to both versions.Please include the full name of the IACUC/ethics committee that reviewed and approved the animal care and use protocol/permit/project license in the Ethics Statement. Please also include an approval number.Please include the specific national or international regulations/guidelines to which your animal care and use protocol adhered. Please note that institutional or accreditation organization guidelines (such as AAALAC) do not meet this requirement.------------------------------------------------------------------------Reviewer remarks:Reviewer #1: Zheng et al. have now resubmitted their paper after addressing comments by both reviewers.As previously, the authors claim on lines 19 and 71 a 400-fold amplification by the bPHA technique, now supported by a reference to information from the manufacturer, but the number represents a theoretical maximal signal amplification, and since no evidence is given that this amplification is actually achieved it would be prudent to describe this as a theoretical limit. Comparing panels 2B and 2D the amplified bPHA signals, where detection depends on binding by pairs of affinity reagents, seems to yield around ten-fold higher fluorescence than that of a single, unamplified Enh-Cy5 probe. Admittedly, the dependence for detection on binding by pairs of probes might reduce efficiency compared to assays that depends on binding by single reagents so this may not be a fair comparison for estimating signal amplification.Throughout the manuscript the authors describe the RCA process as nonlinear and the bDNA techniques as linear, but it is unclear what they mean by this. Both RCA and bDNA would be expected to give rise to local amplification products in direct proportion to the proper starting molecules, in the case of RCA a DNA circle and for bPHA proximal target sequences for the two Z-DNA probes. In the new figure 2 GFP expression of the Ramos cells seems to vary over more than an order of magnitude in the bPHA experiment, but less than one order of magnitude for the PLA experiment, complicating estimation of correlation or linearity of responses.In line 225 bPHA is said to correlate to GFP over three orders of magnitude differences of GFP expression, but this is not evident from figure 2 where in the bPHA experiment GFP varied over a little more than an order of magnitude. It would be prudent to point this out.This figure 2 is rendered a little confusing by the inclusion of zero values in the logarithmic axes of panels B, C, D, F and G. The zero values should be replaced by the proper numbers. This is also true for panels 1H and 3B,C and D, 4A and 5B, as well as for supplementary figures 2, 3, 4 and 6.As a final point, were the TD05+ and – probes really used at 1 mM concentration as stated in line 339? This is a surprisingly high concentration.Reviewer #2: All points raised have been adressed13 Nov 2019Submitted filename: Point to point answer.docxClick here for additional data file.14 Nov 2019Dear Dr YANG,On behalf of my colleagues and the Academic Editor, Ana J. Garcia-Saez, I am pleased to inform you that we will be delighted to publish your Methods and Resources in PLOS Biology.The files will now enter our production system. You will receive a copyedited version of the manuscript, along with your figures for a final review. You will be given two business days to review and approve the copyedit. Then, within a week, you will receive a PDF proof of your typeset article. You will have two days to review the PDF and make any final corrections. If there is a chance that you'll be unavailable during the copy editing/proof review period, please provide us with contact details of one of the other authors whom you nominate to handle these stages on your behalf. This will ensure that any requested corrections reach the production department in time for publication.Early VersionThe version of your manuscript submitted at the copyedit stage will be posted online ahead of the final proof version, unless you have already opted out of the process. The date of the early version will be your article's publication date. The final article will be published to the same URL, and all versions of the paper will be accessible to readers.PRESSWe frequently collaborate with press offices. If your institution or institutions have a press office, please notify them about your upcoming paper at this point, to enable them to help maximise its impact. If the press office is planning to promote your findings, we would be grateful if they could coordinate with biologypress@plos.org. If you have not yet opted out of the early version process, we ask that you notify us immediately of any press plans so that we may do so on your behalf.We also ask that you take this opportunity to read our Embargo Policy regarding the discussion, promotion and media coverage of work that is yet to be published by PLOS. As your manuscript is not yet published, it is bound by the conditions of our Embargo Policy. Please be aware that this policy is in place both to ensure that any press coverage of your article is fully substantiated and to provide a direct link between such coverage and the published work. For full details of our Embargo Policy, please visit http://www.plos.org/about/media-inquiries/embargo-policy/.Thank you again for submitting your manuscript to PLOS Biology and for your support of Open Access publishing. Please do not hesitate to contact me if I can provide any assistance during the production process.Kind regards,Sofia VickersSenior Publications AssistantPLOS BiologyOn behalf of,Di Jiang,Associate EditorPLOS Biology
Authors: Palash Chandra Maity; Amy Blount; Hassan Jumaa; Olaf Ronneberger; Björn F Lillemeier; Michael Reth Journal: Sci Signal Date: 2015-09-15 Impact factor: 8.192
Authors: Victoria Hung; Peng Zou; Hyun-Woo Rhee; Namrata D Udeshi; Valentin Cracan; Tanya Svinkina; Steven A Carr; Vamsi K Mootha; Alice Y Ting Journal: Mol Cell Date: 2014-07-04 Impact factor: 17.970
Authors: Xiaocui He; Kathrin Kläsener; Joseena M Iype; Martin Becker; Palash C Maity; Marco Cavallari; Peter J Nielsen; Jianying Yang; Michael Reth Journal: EMBO J Date: 2018-04-18 Impact factor: 11.598
Authors: Maik Müller; Fabienne Gräbnitz; Niculò Barandun; Yang Shen; Fabian Wendt; Sebastian N Steiner; Yannik Severin; Stefan U Vetterli; Milon Mondal; James R Prudent; Raphael Hofmann; Marc van Oostrum; Roman C Sarott; Alexey I Nesvizhskii; Erick M Carreira; Jeffrey W Bode; Berend Snijder; John A Robinson; Martin J Loessner; Annette Oxenius; Bernd Wollscheid Journal: Nat Commun Date: 2021-12-02 Impact factor: 14.919