Literature DB >> 31768607

A long hypoxia-inducible factor 3 isoform 2 is a transcription activator that regulates erythropoietin.

Jussi-Pekka Tolonen1,2, Minna Heikkilä1,2, Marjo Malinen3, Hang-Mao Lee2, Jorma J Palvimo4, Gong-Hong Wei2, Johanna Myllyharju5,6.   

Abstract

Hypoxia-inducible factor (HIF), an αβ dimer, is the master regulator of oxygen homeostasis with hundreds of hypoxia-inducible target genes. Three HIF isoforms differing in the oxygen-sensitive α subunit exist in vertebrates. While HIF-1 and HIF-2 are known transcription activators, HIF-3 has been considered a negative regulator of the hypoxia response pathway. However, the human HIF3A mRNA is subject to complex alternative splicing. It was recently shown that the long HIF-3α variants can form αβ dimers that possess transactivation capacity. Here, we show that overexpression of the long HIF-3α2 variant induces the expression of a subset of genes, including the erythropoietin (EPO) gene, while simultaneous downregulation of all HIF-3α variants by siRNA targeting a shared HIF3A region leads to downregulation of EPO and additional genes. EPO mRNA and protein levels correlated with HIF3A silencing and HIF-3α2 overexpression. Chromatin immunoprecipitation analyses showed that HIF-3α2 binding associated with canonical hypoxia response elements in the promoter regions of EPO. Luciferase reporter assays showed that the identified HIF-3α2 chromatin-binding regions were sufficient to promote transcription by all three HIF-α isoforms. Based on these data, HIF-3α2 is a transcription activator that directly regulates EPO expression.

Entities:  

Keywords:  Chromatin immunoprecipitation; Erythropoietin; Hypoxia response; Hypoxia response element; Hypoxia-inducible factor 3 isoform; Transcription activator

Mesh:

Substances:

Year:  2019        PMID: 31768607      PMCID: PMC7452874          DOI: 10.1007/s00018-019-03387-9

Source DB:  PubMed          Journal:  Cell Mol Life Sci        ISSN: 1420-682X            Impact factor:   9.261


Introduction

Oxygen-dependent organisms have developed elaborate means to maintain appropriate intracellular oxygen levels for the physicochemical reactions that occur within cells. The master regulators of oxygen homeostasis are the heterodimeric hypoxia-inducible factors (HIFs), present in some form in all metazoan species studied so far [1, 2]. When intracellular oxygen tension decreases below a typical concentration, the HIFs initiate and control graded mechanisms to reduce oxygen consumption and to increase oxygen availability via oxygen-dependent regulation of a genetic hypoxia response pathway [3, 4]. Three HIF-α subunit isoforms (HIF-1α, HIF-2, and HIF-3α) have been identified in vertebrates, encoded by three separate genes (HIF1A, EPAS1, and HIF3A), with HIF3A mRNA being subject to diverse alternative splicing [5-10]. HIF-1α, HIF-2α, and some HIF-3α variants contain basic helix–loop–helix–PAS domains, which facilitate heterodimerization with the HIF-β subunit, encoded by the ARNT gene, and binding to DNA [11]. Towards their C-terminus, the HIF-α protein also possess an oxygen-dependent degradation domain (ODDD), which accounts for their oxygen-dependent regulation. HIF-1α and HIF-2α contain two transactivation domains (NTAD and CTAD), whereas the long HIF3A splicing variants contain only the NTAD [12]. The HIFs bind to specific hypoxia-responsive elements (HREs) with a canonical core sequence (5′–RCGTG-3′) [13]. According to genome-wide chromatin immunoprecipitation sequencing (ChIP-seq) studies, approximately 40% and 20% of HREs for HIF–1 and HIF–2, respectively, reside in promoter regions within a 2.5-kb range from transcription initiation sites (TSS) [14]. HIF–1 appears to bind HREs in promoter regions, while HIF-2 binds more distant regions such as enhancers [15]. Most importantly, however, HIF-1 and HIF-2 do not compete for the same binding sites [15]. The HIF-3 αβ dimer has been shown to recognize the canonical HRE [16], but the genome-wide binding of the human HIF-3 and its consequences have not been characterized. Erythropoietin (EPO), the main regulator of red blood cell production, is a classic hypoxia-inducible gene mainly targeted by HIF-2 [17]. It is produced in the liver during early development and later in the kidney [18]. A 256-bp liver inducibility element (LIE) has been identified immediately 3′ to the gene in Hep3B cells, whereas a negative regulatory element (NRE) lies 4–6 kb upstream of the gene [19-22]. A kidney inducibility element (KIE) lies even farther upstream (9.5 to 14 kb), regulating EPO transcription in peritubular interstitial fibroblasts [17, 21]. The single HRE found in the LIE is crucial for maximal EPO expression and is probably bound only by HIF-2 in accordance with HIF-2 binding to enhancers [15, 17, 22–24]. Although some candidates for the kidney-specific HRE have been identified in vitro and in vivo, no definite consensus exists [24-26]. Of note, HIF1A knockdown does not suppress EPO expression in the three cell lines studied so far, namely, Hep3B, Kelly, and cortical astrocytes [23, 27]. Studies of the HIF pathway have thus far focused mainly on HIF-1 and HIF-2, leaving HIF-3 a relatively unknown regulator of the hypoxia response. Previous experiments conducted in mice suggested that a short splice variant of Hif3a, the inhibitory PAS domain containing protein (IPAS), acts as a dominant negative inhibitor of the hypoxia response by forming inactive complexes with HIF-1α and HIF-2α [5–7, 9, 28]. The short human HIF3A splice variant, HIF-3α4, inhibits the hypoxia response in a similar dominant negative manner [10, 12, 29]. However, more recent studies have suggested that each HIF-3α variant may perform manifestly different roles and that the long HIF-3 variants possess transactivation activity [9, 12, 30, 31]. Furthermore, we have previously shown that simultaneous in vitro knockdown of all human HIF3A splice variants results in the downregulation of several hypoxia-inducible genes including EPO [12]. Similar to other transcription factors with dominant negative and transactivating splice variants, such as the IKAROS family zinc finger 1 [32], HIF-3 may thus be a hypoxia-inducible transcription factor with a dual role. To test our hypothesis that human HIF-3 can induce the transcription of certain hypoxia-inducible genes, we carried out a cDNA microarray screen of hypoxia-dependent HIF-3 target genes in Hep3B cells. Under hypoxia, an overexpression of the long HIF-3α2 splice variant resulted in over twofold upregulation of eight genes, including EPO. HIF-3 clearly contributed to EPO signaling as overexpression of HIF-3α2 in two cell lines capable of endogenous EPO production, namely, Hep3B and the SK-N-AS neuroblastoma cell line, and siRNA knockdown of all HIF3A variants in the SK-N-AS cells resulted in significant changes in EPO mRNA and protein levels that are in line with the hypothesis that HIF-3 is a transcription activator. Our ChIP data suggest that HIF-3 binds its target genes via the canonical HRE. The HIF-3-binding regions are sufficient to drive the transcription of luciferase reporter genes when co-transfected with one of the HIF-α isoforms and HIF-β. These data indicate that at least one of the long HIF-3α variants is a transcription activator involved in erythropoietin signaling by binding directly on EPO and inducing its transcription.

Materials and methods

Cell culture

Hep3B hepatoma cells were cultured in Earle’s minimum essential medium (Sigma, USA), ChoK1 cells were cultured in Dulbecco’s minimum essential medium (Biochrom AG, Germany) with 0.375% sodium bicarbonate (Sigma) and SK-N-AS neuroblastoma cells were cultured in RPMI 1640 (Gibco, USA). The culture media for Hep3B and ChoK1 cells were supplemented with 0.1 mM non-essential amino acids (Sigma), 1 mM sodium puryvate (Sigma), 10% fetal bovine serum (HyClone, USA), 2 mM -glutamine (Sigma), and 100 U/ml penicillin with 0.1 mg/ml streptomycin (Gibco), while the SK-N-AS culture medium was supplemented with 10% fetal bovine serum (Sigma) and 100 U/ml penicillin with 0.1 mg/ml streptomycin (Gibco). Cell culture under hypoxic conditions (1% O2, 5% CO2, and 94% N2) was performed in the Invivo2 Hypoxia Workstation 400 (Ruskinn Technologies, UK) for cDNA microarray studies, and the Sci-Tive-N (Baker Ruskinn, UK) hypoxia station for all other experiments. As the Hep3B cells express EPO and other endogenous human hypoxia-inducible genes, they were chosen for the ChIP, cDNA microarray and functional experiments. The ChoK1 cell line was used as a host for the luciferase reporter assay due to its high transfection rate. The SK-N-AS cells that also express EPO were used to confirm results obtained in Hep3B cells.

Expression plasmids and preparation of the HIF-3α antibody

The following expression plasmids described previously were used in this study: pcDNA3.1/Zeo(-)-V5-HisA, pEGFP-N1, full-length untagged human HIF-1α, HIF-2α, and HIF-β, and untagged as well as C-terminal V5-tagged human HIF-3α2 [10, 12]. To generate luciferase reporter constructs for HIF-3α2 binding sites identified by ChIP-seq in EPO, angiopoietin-like-4 (ANGPTL4) and Histone Cluster 1 H2B Family Member K (HIST1H2BK) genes, the DNA for the binding sites was amplified and cloned into the pGL4.75 vector (Promega, USA). To study the dependency of HIF-1α and HIF-3α2 binding on the canonical HRE sequences (5′-RCGTG-3′), all such sites found within the HIF-3α2 HIST1H2BK binding site on the forward and reverse strands were mutated to 5′-ATTTA-3′ (denoted mutHIST1H2BK) using the QuickChangeXL II site-directed mutagenesis kit (Stratagene, USA) according to manufacturer’s instructions. Mutagenesis primers are listed in Table 1.
Table 1

Sequences of the primers used in cloning, mutagenesis, RNA interference, qPCR analyses, ChIP studies, and luciferase reporter experiments

GeneUsePrimer IDSequence (5′ → 3′)
ACTBqPCRb-ActinFwTGTGGCATCCACGAAACTAC
qPCRb-ActinRvTCATACTCCTGCTTGCTGATCC
ANGPTL4ChIP-qPCRANGPTL4_cQ_FAAGTGTATGAGTGGCAGCCT
ChIP-qPCRANGPTL4_cQ_RAACTTGCACCGATCTCCTCT
CloningANGPTL4_B_FGCGAGATCTCACGGTTCGTAGAGGAAGGC
CloningANGPTL4_B_RGCGAAGCTTCCCACTCCTGTCCATACCCT
EIF5AChIP-qPCREIF5A_cQ_FTGGAGATGGGTAGGGTGTGT
ChIP-qPCREIF5A_cQ_RGACCAACCAAGCAGCCCTAT
EPAS1qPCRQ_HIF2a_FCCCAGATCCACCATTACAT
qPCRQ_HIF2a_RACTCCAGCTGTCGCTTCA
EPOqPCREPO_RT_FCTCCGAACAATCACTGCT
qPCREPO_RT_RGGTCATCTGTCCCCTGTCCT
(Control)ChIP-qPCREPO_ctrl_cQ_FGGAAGGCAATTTTGTGTGCG
(Control)ChIP-qPCREPO_ctrl_cQ_RCCAAGCACCAGAAACTCACC
ChIP-qPCREPO_cQ_FCCAGTGGAGAGGAAGCTGAT
ChIP-qPCREPO_cQ_RCTTCCTTCATCCCCACGTCT
CloningEPO-1_FGCGGAGCTCGGATTGTGGGAAGGGAGACC
CloningEPO-1_RGCGCTCGAGATAGCCGGGGCGCTAAATC
EPORChIP-qPCREPOR_cQ_FTAGGCAGCGAACACCAGAAG
ChIP-qPCREPOR_cQ_RTCACACACACACACAAGGCT
HIF1AqPCRQ_HIF1a_FCTAGCTTTGCAGAATGCTCAG
qPCRQ_HIF1a_RGTAGTAGCTGCATGATCGTCTG
HIF3ARNAisiHIF3A_aUAACAGGGCAGUAUCGCUU
RNAisiHIF3A_bCGACAGGAUUGCAGAAGUG
RNAisiHIF3A_cGCAAGAGCAUCCACACCUU
RNAisiHIF3A_dGAACUGCUCUGGACAUAUG
RNAisiHIF3A_eSR312024B, sequence not available
qPCRQ_HIF3a_all_FCCCCACGGAGCGGTGCTTCT
qPCRQ_HIF3a_all_RAGTCTGCGCAGGTGGCTTGT
HIST1H2BKqPCRHIST1H2BK_Q_FTGCTGCTCGTCTCAGGCTCGT
qPCRHIST1H2BK_Q_RCTCTCCTTGCGGCTGCGCTT
ChIP-qPCRHIST1H2BK_cQ_FGGGCCCCTAAGCTTTCAACA
ChIP-qPCRHIST1H2BK_cQ_RGGCTCTTCTGGCCTTGGAAA
CloningHIST1H2BK_RGCGGAGCTCCGGCGTCGAGTTAATCTTGT
CloningHIST1H2BK_RGCGCTCGAGTCCGGTTTTCAGTCTGGTCC
MutagenesisHIST1H2BK_HRE1_FAAGACGGTCACCGCCATGGTAAATGTCTACGCGCTCAAGCGCC
MutagenesisHIST1H2BK_HRE1_RGGCGCTTGAGCGCGTAGACATTTACCATGGCGGTGACCGTCTT
MutagenesisHIST1H2BK_HRE2_FGCCGTGACCTACACGGAGTAAATCAAGCGCAAGACGGTCAC
MutagenesisHIST1H2BK_HRE2_RGTGACCGTCTTGCGCTTGATTTACTCCGTGTAGGTCACGGC
MutagenesisHIST1H2BK_HRE3_FTGTTGAAGGTGTTCCTGGAGATAAATATCCGGGACGCCGTGACCTACAC
MutagenesisHIST1H2BK_HRE3_RGTGTAGGTCACGGCGTCCCGGATATTTATCTCCAGGAACACCTTCAACA
MutagenesisHIST1H2BK_HRE4_FTGCTCGCCGCGGCGTAAATAAGCGCATTTCTGGCCTCATCTATGAG
MutagenesisHIST1H2BK_HRE4_RCTCATAGATGAGGCCAGAAATGCGCTTATTTACGCCGCGGCGAGCA
HPRT1qPCRhHprt_FCCTGGCGTCGTGATTAGTGAT
qPCRhHprt_RAGACGTTCAGTCCTGTCCATAA
PMB6qPCRhPMB6qforAGCGACACCACAAAGAGTTCA
qPCRhPMB6qrevGCTGATGCTCCTGTAAGACTTGA
PSMD5ChIP-qPCRPSMD5_cQ_FAATCTTGATCCTGGGCCAGC
ChIP-qPCRPSMD5_cQ_RGCGCACGTCCCTATTACTCA
PTX3qPCRhPTXqforCATCTCCTTGCGATTCTGTTTTG
qPCRhPTXqrevCCATTCCGAGTGCTCCTGA
SLC6A14qPCRhSLC6A14qforACCGTGGTAACTGGTCCAAAA
qPCRhSLC6A14qrevCGCCTCCACCATTGCTGTAG
TBPqPCRTBP_Q_FGAATATAATCCCAAGCGGTTTG
qPCRTBP_Q_RACTTCACATCACAGCTCCCC
TMEM27qPCRhTMEM27qforCTGGTGACTGCCATTCATGCT
qPCRhTMEM27qrevCCATCGCTTTGAAGAGGTATTCT
Sequences of the primers used in cloning, mutagenesis, RNA interference, qPCR analyses, ChIP studies, and luciferase reporter experiments To produce the HIF-3α2 antibody used in the qPCR-based ChIP studies, High Five insect cells (Thermo Fisher Scientific, USA) were infected with an HIF-3α2 expression plasmid containing the FLAG-His tag. The denatured HIF-3α2 protein was then purified by QIAexpress metal chelate chromatography (QIAGEN, Germany) according to manufacturer’s instructions. Polyclonal antisera were produced at Innovagen Ab (Lund, Sweden) by immunizing rabbits with the denaturated recombinant HIF-3α2 protein. The antisera were tested to exclude cross-reactivity with HIF-1α and HIF-2α, after which the HIF-3α2 antibody was purified using HiTrap Protein G HP columns (Amersham, USA) according to manufacturer’s instructions.

cDNA microarray and qPCR analysis

For overexpression, 300 000 Hep3B cells were co-transfected once with either 1000 ng of pcDNA3.1/Zeo(-) or 1000 ng of HIF-3α2 plasmid with 1000 ng of HIF-β plasmid using FuGENE HD (Promega) and cultured for 24 h in normoxia and then 24 h in 1% hypoxia. For RNA interference, 300,000 cells were transfected twice with HIF3A siRNA (siGENOME, USA, MQ-010068-03-0005) targeting all HIF3A splice variants using siPORT NeoFX (Ambion, USA) at a 24-h interval and cultured under hypoxia for 24 h after the second transfection. All samples were prepared in triplicate and pooled for cDNA microarray analysis. RNA was isolated by E.Z.N.A Total RNA kit I (Promega). cDNA was prepared using the iScript cDNA Synthesis Kit (Bio-Rad, USA). The microarray was conducted using two Affymetrix Human Genome U133 Plus 2.0 Array chips with an Affymetrix Gene Chip Scanner 3000 7G (Thermo Fisher Scientific, USA) in Biocenter Oulu DNA Analysis Core, and the data were analyzed using the Chipster software (https://chipster.csc.fi/, version 3.12) [33]. Functional pathway analyses were carried out by Chipster using hypergeometric test for Gene Ontology (GO) with default settings. The microarray data have been deposited in the Gene Expression Omnibus database with accession number GSE128847. The results of the microarray analysis were verified by quantitative real-time PCR (qPCR) with gene-specific primers (Table 1) and SsoFast EvaGreen Supermix (Bio-Rad) with a CFX96 Touch real-time PCR detection system (Bio-Rad). TATA box-binding protein (TBP), or β-actin (ACTB) and hypoxanthine phosphoribosyltransferase 1 (HPRT1) mRNA were used as reference genes for Hep3B and SK-N-AS cells, respectively.

Chromatin immunoprecipitation (ChIP) followed by high-throughput sequencing (ChIP-seq)

ChIP experiments were performed as described previously [34]. Briefly, 1.6 × 106 Hep3B cells were co-transfected with 6 000 ng of HIF-3α2-V5 and 4000 ng of HIF-β plasmids, cultured under normoxic conditions for 24 h and continued 24 h at 1% oxygen prior to ChIP. For the qPCR based ChIP studies, the control samples were co-transfected with 10,000 ng of pcDNA3.1-V5-HisA. Cells were crosslinked with 1% (v/v) formaldehyde and harvested for sonication to an average fragment size of 200–400 bp using Bioruptor UCD-300-TO (Diagenode, USA). The chromatin was immunoprecipitated for ChIP-seq with V5-tag antibody (R960-25, Invitrogen, USA) and for qPCR-based ChIP assays with the HIF3A antibody described above, and normal rabbit IgG (sc-2027, Santa Cruz Biotechnology, USA). ChIP-seq samples were processed according to Illumina’s instructions and DNA libraries were sequenced using Illumina HiSeq System (Illumina, USA) in the EMBL Gene Core Facility (Heidelberg, Germany). The qPCR-based ChIP results were normalized with respect to input. Fold changes were calculated using the formula 2−(ΔCt), where ΔCt is Ct(immunoprecipitated DNA) − Ct(input) and Ct is the cycle at which the threshold line is crossed. The primers are listed in Table 1. The ChIP-seq data have been deposited in the Gene Expression Omnibus database with accession number GSE129491.

HIF-3α2 peak calling and Integrative Genomics Viewer visualization

The original Fastq files were trimmed by ngsShoRT with the option “lqr_5adpt_tera”. Reads were aligned to hg19 human genome by Bowtie2. For the functional analyses, peaks were called by Homer with default parameters. De novo motifs were discovered by Homer. To visualize HIF-3α2 binding at certain target genes, peaks were called using the MACS algorithm with input as control. The bedGraph format from MACS was converted to bigwig using the UCSC pre-compiled utilities bedGraphToBigWig provided with chromosome sizes. Finally, the bigWigToWig utility was used to produce Wig files that were converted to TDF files for Integrative Genomics Viewer (IGV) visualization. The HRE location was searched by the “Find Motif” function in IGV with pattern “RCGTG”.

HIF-3α overexpression and knockdown experiments and EPO-ELISA

For HIF-α overexpression EPO-ELISA experiments, 140,000 Hep3B cells were transfected with 1 200 ng of either pcDNA3.1-V5-HisA, HIF-3α2-V5, HIF-1α or HIF-2α, and 1000 ng of HIF-β plasmids, using FuGENE HD. For SK-N-AS cells, 250 000 cells were transfected with 900 ng of either pcDNA3.1-V5-HisA, HIF-3α2-V5, HIF-1α or HIF-2α, and HIF-β plasmids using FuGENE HD. For knockdown experiments in the SK-N-AS neuroblastoma cell line, the cells were seeded at 250,000 cells per well and transfected with HIF3A siRNA SR312024B (OriGene, USA) twice at an interval of 24 h using Lipofectamine RNAiMAX (Invitrogen). After the second transfection, the cells were cultured in 1% O2 for 24 h. Before isolating the total RNA as described above, the medium was collected and stored at –20 °C for EPO-ELISA. EPO-ELISA was carried out using the Quantikine IVD ELISA kit (R&D Systems, USA) according to manufacturer’s instructions. The absorbance was measured by Tecan Infinite m1000 PRO plate reader (Tecan, Austria) using 450 nm as the primary wavelength and 600 nm as the reference wavelength.

Dual luciferase reporter assay

45,000 ChoK1 cells were co-transfected once with 200 ng of wild-type EPO, ANGPTL4, HIST1H2BK, or mutated HIST1H2BK luciferase reporters with HIF-1α, HIF-2α, or HIF-3α2-V5 plasmids at one (100 ng) or two concentrations (100 ng and 300 ng) as indicated, with or without 200 ng of the HIF-β overexpression plasmid. The empty pcDNA3.1 vector was used to balance the amount of transfected DNA. The pRL-CMV Renilla luciferase reporter was transfected for normalization at 10 ng. FuGENE HD (Promega) was used as transfection reagent. The cells were cultured under normoxic conditions for 24 h. The luciferase protein samples were prepared using the Dual-Luciferase Reporter Assay System (Promega) according to manufacturer’s instructions and analyzed using the Varioskan LUX plate reader (Thermo Fisher Scientific).

Statistical analysis

Data are presented as means (± SD). Statistical analyses were carried out using the two-tailed Student’s t test using GraphPad Prism (version 7.03). Values of p < 0.05 are considered statistically significant, with * or # denoting p < 0.05, ** or ## p < 0.01, and *** or ### p < 0.001.

Results

Identification of HIF-3 target genes by microarray analysis

HIF-3α has previously been considered mainly as a dominant inhibitor of the hypoxia response by competitive binding of the other HIF-α subunits [5]. However, more recent studies have shown that the long human HIF-3 variants possess transactivation activity [9, 12, 30, 31, 35]. siRNA knockdown of all human HIF-3α variants simultaneously results in downregulation of certain hypoxia-responsive genes such as EPO, GLUT1, and ANGPTL4, and overexpression of long HIF-3α variants that possess the NTAD under conditions, where HIF-β is not limiting has an inducing effect on the same genes, with HIF-3α2 producing the most robust induction of EPO expression out of the five long HIF-3α variants [12]. To explore the potentially dual role of HIF-3 in the hypoxia response, we carried out a cDNA microarray screen of HIF-3α2 overexpression and siRNA knockdown of all HIF3A splice variants in hypoxic Hep3B cells. Setting the cut-off point of change in the expression level of a gene at ≥ 2-fold revealed eight upregulated (Fig. 1a) and eight downregulated (Fig. 1b) genes by HIF-3α2 and HIF-β co-overexpression in Hep3B cells incubated in 1% hypoxia for 24 h. The control cells were transfected with the empty pcDNA3.1/Zeo(−) vector and HIF-β. The upregulated genes include EPO, bone morphogenetic protein 6 (BMP6), pentraxin 3 (PTX3), and solute carrier family 6 member 14 (SLC6A14) among others. In contrast, the eight genes downregulated by HIF-3α2 overexpression include sperm autoantigenic protein 17 (SPA17) and frizzled family receptor 6 (FZD6), among others.
Fig. 1

cDNA microarray screen of hypoxia-dependent HIF-3 target genes. The heatmaps show ≥ 2-fold upregulated (a) and downregulated (b) genes by HIF-3α2 and HIF-β co-overexpression, and downregulated (c) and upregulated (d) genes by HIF3A siRNA treatment in Hep3B cells incubated for 24 h in 1% hypoxia. The heatmaps are based on six pooled biological replicates on two microarray chips and show relative linear expression levels for control and treated cells as indicated. Darker shades of blue and red indicate higher levels of expression. e–g Validation of BMP6, PTX3 and SLC6A14 expression levels by qPCR with HIF-3α2 and HIF-β co-overexpression in Hep3B cells incubated in 1% hypoxia for 24 h. The qPCR data show upregulation of target genes that is in line with the microarray data. The mRNA levels are shown relative to TBP mRNA. Data are represented as means (± SD) from three independent experiments, n = 3. **p < 0.01, two-tailed Student’s t test

cDNA microarray screen of hypoxia-dependent HIF-3 target genes. The heatmaps show ≥ 2-fold upregulated (a) and downregulated (b) genes by HIF-3α2 and HIF-β co-overexpression, and downregulated (c) and upregulated (d) genes by HIF3A siRNA treatment in Hep3B cells incubated for 24 h in 1% hypoxia. The heatmaps are based on six pooled biological replicates on two microarray chips and show relative linear expression levels for control and treated cells as indicated. Darker shades of blue and red indicate higher levels of expression. e–g Validation of BMP6, PTX3 and SLC6A14 expression levels by qPCR with HIF-3α2 and HIF-β co-overexpression in Hep3B cells incubated in 1% hypoxia for 24 h. The qPCR data show upregulation of target genes that is in line with the microarray data. The mRNA levels are shown relative to TBP mRNA. Data are represented as means (± SD) from three independent experiments, n = 3. **p < 0.01, two-tailed Student’s t test Next, treating Hep3B cells with either control siRNA or siRNA targeting all HIF3A splice variants and incubating the cells in 1% hypoxia for 24 h revealed a downregulation of 39 genes with ≥ 2-fold change (Fig. 1c). These genes include vesicle-associated membrane protein 7 (VAMP7), thioredoxin interacting protein (TXNIP), proteasome subunit type 6 (PSMB6), and angiopoietin-like 3 (ANGPTL3), among others. In comparison, 24 genes were upregulated ≥ 2-fold by siHIF3A knockdown (Fig. 1d), including tescalcin (TESC), solute carrier family 7 member 11 (SLC7A11), and eukaryotic translation initiation factor 3, subunit I (EIF3I). The cDNA microarray data suggest that HIF-3 has both inductive and inhibitory effects on global gene expression. As the microarray analysis setup was designed to provide an initial screen of the effects of HIF-3 on gene expression, it should only be taken as indicative. To verify the changes observed by HIF-3α2 and HIF-β co-overexpression on cDNA microarray, the upregulation of a subset of genes was confirmed by qPCR. HIF-3α2 overexpression produces an upregulation of BMP6 (2.5 (± 0.37)-fold, Fig. 1e) and PTX3 (1.9 (± 0.13)-fold, Fig. 1f) but not of SLC6A14 (Fig. 1g). Similarly, EPO expression was validated on mRNA and protein levels (Fig. 2). Of note, EPO is expressed at a low level in Hep3B cells and thus only appears on the HIF-3α2 overexpression microarray.
Fig. 2

EPO regulation by HIF-3 in two cell lines. EPO mRNA and protein levels are upregulated by HIF-α overexpression in Hep3B (a, b) and SK-N-AS cells (c, d) when co-transfected with HIF-β. Treating SK-N-AS cells with siRNA targeting all HIF3A variants results in statistically significant downregulation of EPO mRNA and protein levels (e, f). Fold changes are relative to cells co-transfected with empty pcDNA3.1-V5-HisA vector and HIF-β, or control siRNA. EPO mRNA levels are relative to TBP for Hep3B cells, and ACTB and HPRT1 for SK-N-AS cells. Data represent means (± SD) from three independent experiments, n = 6–9. *p < 0.05, **p < 0.01, ***p < 0.001, two-tailed Student’s t test

EPO regulation by HIF-3 in two cell lines. EPO mRNA and protein levels are upregulated by HIF-α overexpression in Hep3B (a, b) and SK-N-AS cells (c, d) when co-transfected with HIF-β. Treating SK-N-AS cells with siRNA targeting all HIF3A variants results in statistically significant downregulation of EPO mRNA and protein levels (e, f). Fold changes are relative to cells co-transfected with empty pcDNA3.1-V5-HisA vector and HIF-β, or control siRNA. EPO mRNA levels are relative to TBP for Hep3B cells, and ACTB and HPRT1 for SK-N-AS cells. Data represent means (± SD) from three independent experiments, n = 6–9. *p < 0.05, **p < 0.01, ***p < 0.001, two-tailed Student’s t test Finally, functional enrichment analyses were carried out with Chipster [33]. Setting the cut-off point at 66% upregulation by HIF-3α2 and HIF-β co-overexpression revealed an upregulation of 59 genes. GO enrichment analyses suggest that HIF-3α2 is involved in DNA replication-dependent nucleosome assembly, vascular endothelial growth factor receptor signaling pathway, urogenital system development, and erythrocyte homeostasis (Table 2). A cut-off point of downregulation by 40% upon siHIF3A treatment revealed 126 downregulated genes. GO analysis shows enrichment of genes involved in heterotypic cell–cell adhesion, plasminogen activation, negative regulation of endothelial cell apoptotic process, blood coagulation, and fibrin clot formation as well as fibrinolysis (Table 3).
Table 2

Gene ontology (GO) functional analysis of upregulated genes by HIF-3α2 overexpression in Hep3B cells

GO termp valueDescription
GO:00721630.00042Mesonephric epithelium development
GO:00331890.00193Response to vitamin A
GO:00063350.00283DNA replication-dependent nucleosome assembly
GO:00480100.00295Vascular endothelial growth factor receptor signaling pathway
GO:00550930.00389Response to hyperoxemia
GO:00001880.00418Inactivation of MAPK activity
GO:00016550.00458Urogenital system development
GO:00341010.00554Erythrocyte hemostasis
GO:00016570.00571Ureteric bud development
GO:00320940.0061Response to food
GO:00320940.00648Positive regulation of bone mineralization
GO:19015320.00722Regulation of hematopoietic progenitor cell differentiation
Table 3

Gene Ontology (GO) functional analysis of downregulated genes by siHIF3A treatment of Hep3B cells

GO termp valueDescription
GO:00341160.00019Positive regulation of heterotypic cell–cell adhesion
GO:00459210.00042Positive regulation of exocytosis
GO:00434360.00066Oxoacid metabolic process
GO:00316390.00079Plasminogen activation
GO:19020420.00096Negative regulation of extrinsic apoptotic signaling pathway via death domain receptors
GO:20003520.00115Negative regulation of endothelial apoptotic process
GO:00723780.0124Blood coagulation, fibrin clot formation
GO:00427300.00145Fibrinolysis
GO:00515920.00152Response to calcium ion
GO:19000260.00156Positive regulation of substrate adhesion-dependent cell spreading
Gene ontology (GO) functional analysis of upregulated genes by HIF-3α2 overexpression in Hep3B cells Gene Ontology (GO) functional analysis of downregulated genes by siHIF3A treatment of Hep3B cells

The expression of EPO correlates with the knockdown of HIF3A and overexpression of HIF-3α2

As the microarray data indicate upregulation of EPO by HIF-3α2 overexpression (Fig. 1a), and as we have previously shown that siRNA knockdown of all HIF3A splice variants results in downregulation of EPO mRNA by 39–60% and protein by 28–73% in Hep3B cells [12], we carried out further HIF-3α2 overexpression experiments in Hep3B and the EPO-producing SK-N-AS neuroblastoma cells, as well as siHIF3A knockdown experiments in the SK-N-AS cells. EPO mRNA was upregulated 7- and 5-fold in Hep3B and SK-N-AS cells, respectively, with HIF-3α2 overexpression (Fig. 2a, c). In comparison, overexpression of HIF-1α and HIF-2α resulted in 17- and 25-fold upregulation of EPO mRNA in Hep3B cells, and in 110- and 220-fold upregulation in SK-N-AS cells, respectively (Fig. 2a, c). A 79% downregulation of EPO mRNA level was observed in SK-N-AS cells with siHIF3A treatment (Fig. 2e). It is highly unlikely that this was due to non-specific knockdown of HIF1A or HIF2A, as their mRNA levels were unchanged (Fig. 2e). Of note, previous experiments using siRNA targeting HIF1A mRNA in Hep3B cells, Kelly neuroblastoma cells, and cortical astrocytes have shown no effect on EPO expression [23, 27]. Changes in EPO expression were then analyzed at protein level by ELISA. Overexpression of HIF-3α2, HIF-1α, or HIF-2α resulted in sevenfold, 160-fold and 250-fold increases in EPO protein level in SK-N-AS cells, respectively (Fig. 2d). In Hep3B cells, similar treatment resulted in sixfold, 18-fold and 36-fold changes, respectively (Fig. 2b). Treating SK-N-AS cells with siRNA targeting all HIF3A splice variants resulted in downregulation of EPO protein level by 28% (Fig. 2f), which is in line with previous results obtained in Hep3B cells [12]. Next, to assess whether HIF3A mRNA is expressed at a biologically relevant level, we compared the mRNA abundances of the three HIF-α isoforms by qPCR in normoxic Hep3B cells and Hep3B cells that were incubated in 1% hypoxia for 24 h. As expected, the HIF3A mRNA is induced by 73% in hypoxia (Fig. 3a). Previous studies have shown that this hypoxic induction is HIF-1 dependent [9, 10]. In both normoxic and hypoxic Hep3B cells, HIF-1α is the predominant HIF-α isoform with a 240–300-fold abundance over HIF3A mRNA (Fig. 3a). However, hypoxic Hep3B cells express HIF-3α and HIF-2α mRNA at a 1:2 ratio (Fig. 3a). The data—especially that of HIF1A expression—are to be treated with caution as differences in primer efficiencies cannot be excluded.
Fig. 3

Hypoxic Hep3B cells express HIF-2α and HIF-3α at considerably lower levels than HIF-1α. a Hep3B cells were incubated in normoxia (pO2 21%) and 1% hypoxia for 24 h before isolation of mRNA and quantification by qPCR. HIF-1α mRNA is 240 to 300-fold more abundant than HIF-3α mRNA, while HIF-2α mRNA abundance is only 2-fold higher than that of HIF-3α in hypoxia. HIF-3α expression is induced by hypoxia. Data are represented as means (± SD) from three independent experiments, n = 6. **p < 0.01, ***p < 0.001 against HIF3A mRNA abundance in normoxia, #p < 0.05, ###p < 0.001 against HIF3A mRNA abundance in 1% hypoxia, two-tailed Student’s t test. b Hep3B cells were transfected with the HIF-2α overexpression plasmid together with either the empty pcDNA3.1 vector or the HIF-3α2 overexpression plasmid, and with or without the HIF-β overexpression plasmid as indicated, and incubated in 1% hypoxia for 24 h. Co-overexpression of HIF-3α2 does not induce or inhibit EPO expression upon HIF-2α overexpression. However, co-overexpression of HIF-β doubles EPO mRNA abundance. Data are represented as means (± SD) from three independent experiments, n = 3. *p < 0.05, **p < 0.01, two-tailed Student’s t test

Hypoxic Hep3B cells express HIF-2α and HIF-3α at considerably lower levels than HIF-1α. a Hep3B cells were incubated in normoxia (pO2 21%) and 1% hypoxia for 24 h before isolation of mRNA and quantification by qPCR. HIF-1α mRNA is 240 to 300-fold more abundant than HIF-3α mRNA, while HIF-2α mRNA abundance is only 2-fold higher than that of HIF-3α in hypoxia. HIF-3α expression is induced by hypoxia. Data are represented as means (± SD) from three independent experiments, n = 6. **p < 0.01, ***p < 0.001 against HIF3A mRNA abundance in normoxia, #p < 0.05, ###p < 0.001 against HIF3A mRNA abundance in 1% hypoxia, two-tailed Student’s t test. b Hep3B cells were transfected with the HIF-2α overexpression plasmid together with either the empty pcDNA3.1 vector or the HIF-3α2 overexpression plasmid, and with or without the HIF-β overexpression plasmid as indicated, and incubated in 1% hypoxia for 24 h. Co-overexpression of HIF-3α2 does not induce or inhibit EPO expression upon HIF-2α overexpression. However, co-overexpression of HIF-β doubles EPO mRNA abundance. Data are represented as means (± SD) from three independent experiments, n = 3. *p < 0.05, **p < 0.01, two-tailed Student’s t test Finally, to explore whether co-overexpression of HIF-2α and HIF-3α2 with or without HIF-β alters EPO expression, we transfected Hep3B cells with the HIF-α and HIF-β overexpression plasmids as indicated and measured EPO mRNA abundances by qPCR (Fig. 3b). Of note, the pcDNA3.1/Zeo(−) backbone produces an upregulation of HIF-α mRNA by a fold of a few hundred, which most likely saturates EPO expression. No statistically significant changes were observed in EPO expression with or without HIF-β upon co-overexpression of HIF-2α and HIF-3α2 (Fig. 3b). Based on these findings, it is unlikely that HIF-3α2 acts as a dominant inhibitor of HIF-2α in the context of EPO expression.

The long HIF-3 αβ dimer binds target gene promoters via the canonical HRE

To analyze HIF-3 binding to its target genes, we performed ChIP-seq analysis after HIF-3α2 and HIF-β co-overexpression in Hep3B cells. De novo motif analysis of the peaks shows that the most significant motif for HIF-3α2 enrichment is the canonical HRE core sequence, 5′-RCGTG-3′, with the R position showing preference for adenine (Fig. 4a). The motif is shared most significantly by HIF-β. Overall, the data show that the HIF-3α2 peaks are enriched in the promoter regions (data not shown, GSE129491).
Fig. 4

HIF-3 binding is associated with the canonical HRE in the promoter regions of its target genes. a HIF-3α2 ChIP-seq enrichment signal associates with the canonical HRE sequence with preference for A at position R. b, c HIF-3α2 enrichment is observed on the EPO and ANGPTL4 genes near the promoter-TSS, co-localizing with sites that contain six canonical HRE sequences (5′-RCGTG-3′, included HREs underlined) on forward and reverse strands as denoted by blue and red lines, respectively. Interestingly, no HIF-3α2 enrichment is detected on the LIE immediately 3′ to EPO. HIF-3α2 enrichment (first track) is shown relative to input (lower track). Samples were prepared in triplicate and pooled for ChIP. d–i Validation of a subset of HIF-3α2 chromatin-binding enrichment sites by ChIP-qPCR. ChIP-qPCR by HIF3A and normal rabbit IgG antibodies shows amplification in the HIF-3α2 enrichment site on five genes, namely EPO (d), EPOR (f), EIF5A (g), PSMD5 (h), and ANGPTL4 (i), and no amplification with a control primer set designed to target regions of EPO where no enrichment is observed (e), n = 3. The ChIP-qPCR results are normalized with respect to input. *p < 0.05, **p < 0.01, ***p < 0.001, two-tailed Student’s t test

HIF-3 binding is associated with the canonical HRE in the promoter regions of its target genes. a HIF-3α2 ChIP-seq enrichment signal associates with the canonical HRE sequence with preference for A at position R. b, c HIF-3α2 enrichment is observed on the EPO and ANGPTL4 genes near the promoter-TSS, co-localizing with sites that contain six canonical HRE sequences (5′-RCGTG-3′, included HREs underlined) on forward and reverse strands as denoted by blue and red lines, respectively. Interestingly, no HIF-3α2 enrichment is detected on the LIE immediately 3′ to EPO. HIF-3α2 enrichment (first track) is shown relative to input (lower track). Samples were prepared in triplicate and pooled for ChIP. d–i Validation of a subset of HIF-3α2 chromatin-binding enrichment sites by ChIP-qPCR. ChIP-qPCR by HIF3A and normal rabbit IgG antibodies shows amplification in the HIF-3α2 enrichment site on five genes, namely EPO (d), EPOR (f), EIF5A (g), PSMD5 (h), and ANGPTL4 (i), and no amplification with a control primer set designed to target regions of EPO where no enrichment is observed (e), n = 3. The ChIP-qPCR results are normalized with respect to input. *p < 0.05, **p < 0.01, ***p < 0.001, two-tailed Student’s t test Next, ChIP-seq shows enrichment for HIF-3α2 in the promoter-TSS within the 0.4-kb 5′-flanking region of EPO, and some enrichment 3′ end to intron 1 (Fig. 4b), a region involved in liver-specific expression [19, 20]. Enrichment is not evident immediately at 3′ end of EPO on the 256-bp LIE (Fig. 4b) which has been identified as a crucial site for HIF-2, but not HIF-1, driven EPO regulation in the liver [20, 22, 23]. The 5′-flanking enrichment site contains six canonical HREs on the reverse strand, showing HIF-3α2 binding mainly across the first four HREs. In contrast, the LIE contains only a single HRE. Although the ANGPTL4 gene does not show up on the cDNA microarray data, previous studies have shown that its hypoxic induction is HIF-3 dependent [9, 12], and thus, we decided to pursue it further on ChIP-seq. Two chromatin regions of enrichment for HIF-3α2 are detected near the promoter-TSS of ANGPTL4, 290 bp upstream and 380 bp downstream from the TSS (Fig. 4c). The downstream HIF-3α2-enriched region contains up to four canonical HREs. Finally, we validated the ChIP-seq data by ChIP-qPCR with primer sets designed to span the HIF-3 binding regions. ChIP-qPCR shows relative enrichment of HIF-3α2 occupancy over IgG using primer sets for EPO [6.0 (± 1.4)-fold], EPOR [48.6 (± 13.9)-fold], EIF5A [47.5 (± 2.4)-fold], PSMD5 [10.2 (± 2.3)-fold], and ANGPTL4 [7.2 (± 1.0)-fold], and no enrichment over IgG with a primer set designed to target a region of EPO, where no HIF-3 binding was observed (Fig. 4d–i).

HIF-3α2 overexpression may result in frivolous HRE-dependent chromatin binding

To further explore the chromatin binding capacity of the long HIF-3 αβ dimer, we focused on Histone Cluster 1 H2B Family Member K (HIST1H2BK) as the ChIP-seq data suggest HIF-3α2 association with this gene. The ChIP-seq analysis revealed an enrichment of HIF-3α2 occupancy in the promoter region 440 bp upstream from the TSS of HIST1H2BK (Fig. 5a). This region contains four canonical HREs. ChIP-qPCR confirmed HIF-3α2 binding with a 7.7 (± 2.6)-fold relative enrichment over IgG (Fig. 5b).
Fig. 5

HIF-3α2 overexpression may result in frivolous HRE-dependent chromatin binding. a ChIP-seq shows HIF-3α2 enrichment on the HIST1H2BK gene near the promoter-TSS, co-localizing with a site that contains four canonical HRE sequences. b ChIP-qPCR confirmation of HIF-3α2 binding on HIST1H2BK. c Luciferase reporter construct containing the HIF-3α2 enrichment site on HIST1H2BK shows statistically significant upregulation by HIF-1α and HIF-3α2. Induction by HIF-3α2 plateaus already at the lower 100 ng transfection dosage. The data represent means (± SD) from three independent experiments, n = 8–9. d Four HREs observed in the HIF-3α2 enrichment site on HIST1H2BK were mutated to 5′-ATTTA-3′ to study the HRE-dependency of HIF-3α2 and HIF-1α binding, showing 66–69% decrease in luminescence signal. The data represent means (± SD) from four independent experiments, n = 11–12. e Hep3B cells were incubated in normoxia (pO2 21%) and 1% hypoxia to study the hypoxia-dependent expression of HIST1H2BK. Hypoxia downregulates HIST1H2BK expression by 25%, representing means (± SD) from three independent experiments, n = 6. f Hep3B cells were treated with control siRNA or siRNA targeting all splice variants of the HIF3A locus, and incubated in 1% hypoxia for 24 h. HIF3A knockdown upregulates HIST1H2BK expression by 65%. The data represent means (± SD) from three independent experiments, n = 3. *p < 0.05, **p < 0.01, ***p < 0.001, two-tailed Student’s t test

HIF-3α2 overexpression may result in frivolous HRE-dependent chromatin binding. a ChIP-seq shows HIF-3α2 enrichment on the HIST1H2BK gene near the promoter-TSS, co-localizing with a site that contains four canonical HRE sequences. b ChIP-qPCR confirmation of HIF-3α2 binding on HIST1H2BK. c Luciferase reporter construct containing the HIF-3α2 enrichment site on HIST1H2BK shows statistically significant upregulation by HIF-1α and HIF-3α2. Induction by HIF-3α2 plateaus already at the lower 100 ng transfection dosage. The data represent means (± SD) from three independent experiments, n = 8–9. d Four HREs observed in the HIF-3α2 enrichment site on HIST1H2BK were mutated to 5′-ATTTA-3′ to study the HRE-dependency of HIF-3α2 and HIF-1α binding, showing 66–69% decrease in luminescence signal. The data represent means (± SD) from four independent experiments, n = 11–12. e Hep3B cells were incubated in normoxia (pO2 21%) and 1% hypoxia to study the hypoxia-dependent expression of HIST1H2BK. Hypoxia downregulates HIST1H2BK expression by 25%, representing means (± SD) from three independent experiments, n = 6. f Hep3B cells were treated with control siRNA or siRNA targeting all splice variants of the HIF3A locus, and incubated in 1% hypoxia for 24 h. HIF3A knockdown upregulates HIST1H2BK expression by 65%. The data represent means (± SD) from three independent experiments, n = 3. *p < 0.05, **p < 0.01, ***p < 0.001, two-tailed Student’s t test To validate the activity of the HIST1H2BK regulatory sequence, we cloned the HIF-3α2-bound genomic region of HIST1H2BK in front of a luciferase gene in the pGL4.75 vector. The reporter plasmid was co-transfected into ChoK1 cells with either HIF-1α or HIF-3α2 at two concentrations (100 ng or 300 ng) with HIF-β and the Renilla reporter for normalization, after which the ChoK1 cells were incubated in normoxia for 24 h. Both HIF-1α and HIF-3α2 co-overexpressed with HIF-β induce the transcription of the luciferase reporter, with HIF-1α producing higher levels of luminescence signal in a dose-dependent manner (Fig. 5c). HIF-3α2 reaches a plateau already at the lower plasmid concentration (Fig. 5c). To study the HRE-dependency for HIF-1α and HIF-3α2 binding, we mutated the four HREs in the HIST1H2BK luciferase reporter to 5′-ATTTA-3′. The luminescence signal produced by the mutated HIST1H2BK luciferase reporter with HIF-1α and HIF-3α2 overexpression was reduced by 66% and 69%, respectively, providing further evidence that the HREs are necessary for maximal transcription and are the main but not sole determinant of HIF binding (Fig. 5d). However, functional studies suggest that the endogenous HIF-3 αβ dimer may not bind the HIST1H2BK gene. We quantified the HIST1H2BK mRNA levels in normoxic and hypoxic Hep3B cells after incubation in 1% hypoxia for 24 h. Hypoxia downregulates HIST1H2BK expression by 25% in Hep3B cells (Fig. 5e). Finally, treating Hep3B cells with control siRNA or siRNA targeting all HIF3A splice variants and incubating the cells in 1% hypoxia for 24 h shows that HIF3A silencing produces an upregulation of HIST1H2BK by 65% (Fig. 5f). Therefore, it is possible that some of the HIF-3α2 occupancy observed on ChIP-seq is a result of overexpression and may not reflect endogenous function highlighting the importance of validation of the data at an endogenous level.

Synergistic activity at the EPO promoter with HIF-3α2 and HIF-1α or HIF-2α co-overexpression

In contrast to the HIST1H2BK gene, functional experiments in the Hep3B and SK-N-AS cell lines suggest that the long HIF-3 αβ dimer is involved in the regulation of EPO expression, whereas ChIP assays demonstrate that this regulation is via direct chromatin binding. To validate the activity of the regulatory sequence in the EPO promoter, we cloned the HIF-3α2-bound genomic region into the pGL4.75 luciferase vector. The EPO luciferase reporter was then co-transfected into ChoK1 cells with one of the HIF-α isoform overexpression plasmids, the Renilla reporter for normalization, and either the empty pcDNA3.1/Zeo(−) vector or the HIF-β overexpression plasmid. Next, the cells were incubated in normoxia for 24 h. Both HIF-1α and HIF-2α can induce the transcription of the luciferase reporter without HIF-β, with HIF-1α producing a 20% increase and HIF-2α producing up to a 3 (± 0.41)-fold increase over the control cells (Fig. 6a). With a co-overexpression of HIF-β, all HIF-α isoforms can induce the EPO luciferase reporter by 34.2 (± 9.1)-fold, 41.6 (± 4.5)-fold, and 9.0 (± 2.3)-fold for HIF-1α, HIF-2α, and HIF-3α2, respectively (Fig. 6b).
Fig. 6

Synergistic induction of the EPO luciferase reporter by co-overexpression of HIF-1α or HIF-2α with HIF-3α2. a, b ChoK1 cells were transfected with the EPO luciferase reporter containing the HIF-3α2 binding site near the EPO promoter-TSS and either the HIF-1α, HIF-2α, or HIF-3α2 overexpression plasmid with or without HIF-β in normoxia. All three HIF-α isoforms can induce the activity of the EPO luciferase reporter when co-overexpressed with HIF-β. HIF-2α produces the most robust upregulation of the reporter. HIF-β significantly enhances the transactivation capacity of all HIF-α isoforms. The data represent means (± SD) from three independent experiments, n = 9. c, d Co-overexpression of HIF-1α or HIF-2α with HIF-3α2 produces a synergistic upregulation of the EPO reporter, representing means (± SD) from three independent experiments, n = 9. The relative luciferase activity is normalized against the pRL-CMV Renilla reporter. *p < 0.05, **p < 0.01, ***p < 0.001, two-tailed Student’s t test

Synergistic induction of the EPO luciferase reporter by co-overexpression of HIF-1α or HIF-2α with HIF-3α2. a, b ChoK1 cells were transfected with the EPO luciferase reporter containing the HIF-3α2 binding site near the EPO promoter-TSS and either the HIF-1α, HIF-2α, or HIF-3α2 overexpression plasmid with or without HIF-β in normoxia. All three HIF-α isoforms can induce the activity of the EPO luciferase reporter when co-overexpressed with HIF-β. HIF-2α produces the most robust upregulation of the reporter. HIF-β significantly enhances the transactivation capacity of all HIF-α isoforms. The data represent means (± SD) from three independent experiments, n = 9. c, d Co-overexpression of HIF-1α or HIF-2α with HIF-3α2 produces a synergistic upregulation of the EPO reporter, representing means (± SD) from three independent experiments, n = 9. The relative luciferase activity is normalized against the pRL-CMV Renilla reporter. *p < 0.05, **p < 0.01, ***p < 0.001, two-tailed Student’s t test Finally, to further explore the transactivation capacity of HIF-3α2, we co-overexpressed HIF-3α2 with HIF-1α or HIF-2α and measured the relative luciferase activity produced by the EPO luciferase reporter. Without HIF-β, HIF-3α2 induced the relative luciferase activity by 17% and 21% over HIF-1α or HIF-2α alone, respectively (Fig. 6c, d). With HIF-β, however, a co-overexpression of HIF-1α or HIF-2α with HIF-3α2 produced a 45.6 (± 10.4)-fold and 59.6 (± 14.0)-fold increase in the relative luciferase activity meaning that HIF-3α2 induced the luciferase activity by 34% and 44% over HIF-1α or HIF-2α alone, respectively (Fig. 6c, d).

Discussion

The contributions of HIF-3 and especially those of the long HIF-3α splicing variants to the regulation of the hypoxia response are yet largely unknown. We set out here to study the transactivation capacity of HIF-3α2 in more detail. Among the long HIF-3α variants, HIF-3α2 has been previously shown to induce the highest upregulation of EPO mRNA in Hep3B cells; HIF-3α2 is also expressed in the fetal and adult liver and kidney, which are the main EPO producing tissues [10, 12]. We explored HIF-3 target genes by cDNA microarray analysis in Hep3B cells and concluded that eight genes were upregulated by ≥ 2-fold with HIF-3α2 overexpression and 39 genes were downregulated by ≥ 2-fold with siHIF3A treatment suggesting a HIF-3 specific transcriptional program. No overlap is observed between these microarray data, because the HIF3A siRNA result in a knockdown of all HIF-3α splice variants, while the overexpression experiments include only HIF-3α2. However, both knockdown and overexpression settings result in positive and negative effects on global gene expression suggesting that HIF-3 plays a dual role in the hypoxia response. In the context of overall hypoxia-dependent gene regulation, this can be considered a small subset of genes as HIF-1 and HIF-2 have been shown to regulate the transcription of over 1 500 human genes through direct transactivation according to different ChIP assays [14, 15, 36, 37]. In zebrafish, the overexpression of the long Hif-3 splice variant resulted in the upregulation of 136 unique genes, whereas Hif-1α overexpression upregulated up to 690 genes with 97 overlapping targets [30], supporting the view that HIF-3 is responsible for the oxygen-dependent regulation of a relatively small subset of hypoxia-inducible genes. We validated the role of HIF-3 in regulating EPO signaling in vitro. We have previously shown that siRNA knockdown of all HIF3A splice variants simultaneously results in the downregulation of EPO mRNA in the Hep3B cell line [12] that was originally used to study the hypoxia-dependent regulation of EPO [19]. Here, we show using Hep3B and SK-N-AS, two cell lines capable of endogenous EPO production, that loss and overexpression of HIF-3 results in significant changes in EPO mRNA and protein levels, further indicating that HIF-3 has a role in erythropoiesis through EPO regulation. Of note, previous studies using siRNA to target HIF1A mRNA in similar cell lines have not produced significant effects in EPO expression [23, 27]. In the murine cardiomyocytes, the knockdown of Hif3a has been associated with a very minor upregulation of EPO expression, but an upregulation of HIF-1α and HIF-2α mRNA was also observed [38]. No human kidney-derived cell lines with inducible EPO expression exist, while the derivation of a murine kidney cell line with inducible EPO expression was reported only recently [39]. The last line of evidence supporting our hypothesis that HIF-3 is a transcription activator involved in the regulation of EPO signaling arises from ChIP and transactivation studies. In Hep3B cells, HIF-3α2 binds chromatin immediately 5′ to the EPO gene, and this genomic region is sufficient to transactivate a luciferase reporter construct by all three HIF-α isoforms. Interestingly, HIF-3α2 enrichment is not observed at the single HRE required for HIF-2 driven EPO regulation at the liver inducibility element immediately 3′ to EPO [17]. This may imply that HIF-3 does not compete for the binding sites used by HIF-1 and HIF-2 as was recently shown to be true between HIF-1 and HIF-2 despite a set of shared target genes [15, 40]. Finally, using the HIST1H2BK gene, we show that HIF-3 may redistribute to non-endogenous HREs upon overexpression and that chromatin occupancy studies should be paired with functional assays to dissect endogenous target genes. Our data are in line with previous studies about the biological function of the long HIF-3 isoforms. We have shown that siRNA knockdown of all HIF3A splice variants and overexpression of certain long HIF-3 isoforms downregulate and upregulate, respectively, EPO, ANGPTL4, and GLUT1, but not VEGF which is predominantly a HIF-1 target [12]. Similarly, Zhang and colleagues characterized the role of Hif-3 as transcription activator in the zebrafish, and show that hypoxia and overexpression of human HIF-3α9 [10] induce LC3C, REDD1 and SQRDL expression in human HEK293 and U2OS cell lines [30]. Furthermore, HIF-3α has been implicated in the progression of pancreatic cancer by directly binding the promoters of RHOC and ROCK1 and transactivating the RhoC-ROCK1 pathway in cancer cells that overexpress HIF3A [41]. The data presented in this study may provide basis for human disease. Two single-nucleotide variants in the HIF3A locus have been associated with familial erythrocytosis [42]. The data reported here suggest that it may be through a direct transactivation effect. However, studies that are more sensitive (i.e., ChIP-seq using antibodies that recognize the endogenous HIF-3α protein, or RNA-seq to study the kinetics of HIF3A splicing and expression) are required to elucidate the role of HIF-3 further. Next, methylation of the HIF3A gene in blood cells and adipose tissue was recently shown to correlate with increased body-mass index in a genome-wide association study [43]. The data suggest that impairment of the HIF pathway may result in the dysregulation of body weight, which is in line with previous studies showing that HIF prolyl 4-hydroxylase-2 inhibition and hence HIF-α stabilization and activation of the hypoxia response pathway is protective of obesity and metabolic dysfunction [44, 45]. We have shown that demethylation increases HIF3A mRNA levels in Hep3B cells [10]. Here, we show that HIF-3α2 directly regulates the expression of ANGPTL4, which is involved in the induction of white adipose tissue lipolysis [46, 47] and may thus regulate energy metabolism. Other HIF-3 target genes identified by cDNA microarray, such as ANGPTL3 and PANK1, may also be involved in metabolic regulation [48-51]. This link between HIF-3 and lipid metabolism may also explain why only a few cancer cell lines express the long HIF3A splice variants, whereas the HIF-1α that drives glucose metabolism is their major HIF form [10, 52]. However, further studies are required to elucidate the direct mechanisms of HIF-3 dependent regulation of body weight. In conclusion, our present study shows that HIF-3 is involved in the regulation of a subset of hypoxia-inducible genes. According to our chromatin immunoprecipitation data, HIF-3 directly binds EPO in its promoter-TSS at a region harboring several HREs. This region is sufficient to drive the transcription of a luciferase reporter gene. We provide evidence that HIF-3 is a transcription factor required for maximal induction of EPO on mRNA and protein levels, and that HIF-3α2 is more likely to produce synergistic than inhibitory effects when co-overexpressed with HIF-1α or HIF-2α. We would, therefore, suggest that the next step in exploring the biological role of HIF-3 is to study murine Hif3a splice variants in EPO regulation in vivo, but it should be noted that splicing of the mouse Hif3a gene is far less complex than that of the human HIF3A gene [6, 7, 10, 53]. Therefore, inactivating the individual human HIF3A splice variants using the CRISPR-Cas9 technology or studying the kinetics of HIF3A and HIF-β expression through RNA-seq could be preferential approaches for future studies.
  45 in total

Review 1.  Hypoxia-inducible factors in physiology and medicine.

Authors:  Gregg L Semenza
Journal:  Cell       Date:  2012-02-03       Impact factor: 41.582

2.  Inhibitory PAS domain protein is a negative regulator of hypoxia-inducible gene expression.

Authors:  Y Makino; R Cao; K Svensson; G Bertilsson; M Asman; H Tanaka; Y Cao; A Berkenstam; L Poellinger
Journal:  Nature       Date:  2001-11-29       Impact factor: 49.962

3.  Expression and characterization of hypoxia-inducible factor (HIF)-3alpha in human kidney: suppression of HIF-mediated gene expression by HIF-3alpha.

Authors:  S Hara; J Hamada; C Kobayashi; Y Kondo; N Imura
Journal:  Biochem Biophys Res Commun       Date:  2001-10-05       Impact factor: 3.575

4.  The hypoxia-inducible transcription factor pathway regulates oxygen sensing in the simplest animal, Trichoplax adhaerens.

Authors:  Christoph Loenarz; Mathew L Coleman; Anna Boleininger; Bernd Schierwater; Peter W H Holland; Peter J Ratcliffe; Christopher J Schofield
Journal:  EMBO Rep       Date:  2010-11-26       Impact factor: 8.807

5.  Hypoxia-inducible factor (HIF)-3alpha is subject to extensive alternative splicing in human tissues and cancer cells and is regulated by HIF-1 but not HIF-2.

Authors:  Annika Pasanen; Minna Heikkilä; Kati Rautavuoma; Maija Hirsilä; Kari I Kivirikko; Johanna Myllyharju
Journal:  Int J Biochem Cell Biol       Date:  2010-04-21       Impact factor: 5.085

6.  Multiple splice variants of the human HIF-3 alpha locus are targets of the von Hippel-Lindau E3 ubiquitin ligase complex.

Authors:  Mindy A Maynard; Heng Qi; Jacky Chung; Eric H L Lee; Yukihiro Kondo; Shuntaro Hara; Ronald C Conaway; Joan W Conaway; Michael Ohh
Journal:  J Biol Chem       Date:  2003-01-21       Impact factor: 5.157

7.  The human HIF (hypoxia-inducible factor)-3alpha gene is a HIF-1 target gene and may modulate hypoxic gene induction.

Authors:  Tetsuhiro Tanaka; Michael Wiesener; Wanja Bernhardt; Kai-Uwe Eckardt; Christina Warnecke
Journal:  Biochem J       Date:  2009-10-23       Impact factor: 3.857

8.  Inhibitory PAS domain protein (IPAS) is a hypoxia-inducible splicing variant of the hypoxia-inducible factor-3alpha locus.

Authors:  Yuichi Makino; Arvydas Kanopka; William J Wilson; Hirotoshi Tanaka; Lorenz Poellinger
Journal:  J Biol Chem       Date:  2002-07-15       Impact factor: 5.157

Review 9.  The role of hypoxia-inducible factors in tumorigenesis.

Authors:  E B Rankin; A J Giaccia
Journal:  Cell Death Differ       Date:  2008-02-15       Impact factor: 15.828

Review 10.  Hypoxia-inducible factors: central regulators of the tumor phenotype.

Authors:  John D Gordan; M Celeste Simon
Journal:  Curr Opin Genet Dev       Date:  2007-01-08       Impact factor: 5.578

View more
  17 in total

Review 1.  Elucidating the role of hypoxia-inducible factor in rheumatoid arthritis.

Authors:  Essa M Sabi; Anuja Singh; Ziyad M Althafar; Tapan Behl; Aayush Sehgal; Sukhbir Singh; Neelam Sharma; Saurabh Bhatia; Ahmed Al-Harrasi; Hosam M Alqahtani; Simona Bungau
Journal:  Inflammopharmacology       Date:  2022-04-01       Impact factor: 4.473

2.  Unraveling the epigenomic and transcriptomic interplay during alcohol-induced anxiolysis.

Authors:  Harish R Krishnan; Huaibo Zhang; Ying Chen; John Peyton Bohnsack; Annie W Shieh; Handojo Kusumo; Jenny Drnevich; Chunyu Liu; Dennis R Grayson; Mark Maienschein-Cline; Subhash C Pandey
Journal:  Mol Psychiatry       Date:  2022-09-12       Impact factor: 13.437

Review 3.  Hypoxia as a Modulator of Inflammation and Immune Response in Cancer.

Authors:  Rosa A Castillo-Rodríguez; Cristina Trejo-Solís; Alfredo Cabrera-Cano; Saúl Gómez-Manzo; Víctor Manuel Dávila-Borja
Journal:  Cancers (Basel)       Date:  2022-05-04       Impact factor: 6.575

4.  Calcitriol Suppresses HIF-1 and HIF-2 Transcriptional Activity by Reducing HIF-1/2α Protein Levels via a VDR-Independent Mechanism.

Authors:  Ioanna-Maria Gkotinakou; Eleni Kechagia; Kalliopi Pazaitou-Panayiotou; Ilias Mylonis; Panagiotis Liakos; Andreas Tsakalof
Journal:  Cells       Date:  2020-11-09       Impact factor: 6.600

5.  Contribution of hypoxia inducible factor-1 during viral infections.

Authors:  Antonia Reyes; Nicolás Corrales; Nicolás M S Gálvez; Susan M Bueno; Alexis M Kalergis; Pablo A González
Journal:  Virulence       Date:  2020-12       Impact factor: 5.882

Review 6.  Specific Inhibition of HIF Activity: Can Peptides Lead the Way?

Authors:  Ilias Mylonis; Georgia Chachami; George Simos
Journal:  Cancers (Basel)       Date:  2021-01-22       Impact factor: 6.639

7.  Exposure to hypoxia causes stress erythropoiesis and downregulates immune response genes in spleen of mice.

Authors:  Haijing Wang; Daoxin Liu; Pengfei Song; Feng Jiang; Xiangwen Chi; Tongzuo Zhang
Journal:  BMC Genomics       Date:  2021-06-05       Impact factor: 3.969

8.  HIF-1α as a Target Molecule in the Use of Triazino-Indole Derivative on the Acoustic Trauma Model.

Authors:  Vladimir L Pastushenkov; Leonid G Buynov; Maksim S Kuznetsov; Vladimir V Dvorianchikov; Lev A Glaznikov; Aleksandr L Pastushenkov
Journal:  Audiol Res       Date:  2021-07-15

Review 9.  Hypoxia Pathway Proteins are Master Regulators of Erythropoiesis.

Authors:  Deepika Watts; Diana Gaete; Diego Rodriguez; David Hoogewijs; Martina Rauner; Sundary Sormendi; Ben Wielockx
Journal:  Int J Mol Sci       Date:  2020-10-30       Impact factor: 5.923

10.  Biochemical and biophysical analyses of hypoxia sensing prolyl hydroxylases from Dictyostelium discoideum and Toxoplasma gondii.

Authors:  Tongri Liu; Martine I Abboud; Rasheduzzaman Chowdhury; Anthony Tumber; Adam P Hardy; Kerstin Lippl; Christopher T Lohans; Elisabete Pires; James Wickens; Michael A McDonough; Christopher M West; Christopher J Schofield
Journal:  J Biol Chem       Date:  2020-09-15       Impact factor: 5.157

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.