Yuan Gu1, Fei Zheng1,2, Yuan Wang1, Xiaoyun Su1, Yingguo Bai1, Bin Yao1, Huoqing Huang1, Huiying Luo1. 1. Key Laboratory for Feed Biotechnology of the Ministry of Agriculture, Feed Research Institute, Chinese Academy of Agricultural Sciences, Beijing, People's Republic of China. 2. College of Biological Sciences and Biotechnology, Beijing Forestry University, Beijing, People's Republic of China.
Abstract
Talaromyces leycettanus JCM12802 is a great producer of thermophilic glycoside hydrolases (GHs). In this study, two cellulases (TlCel5A and TlCel6A) belonging to GH5 and GH6 respectively were expressed in Pichia pastoris and functionally characterized. The enzymes had acidic and thermophilic properties, showing optimal activities at pH 3.5-4.5 and 75-80°C, and retained stable at temperatures up to 60°C and over a broad pH range of 2.0-8.0. TlCel5A and TlCel6A acted against several cellulose substrates with varied activities (3,101.1 vs. 92.9 U/mg to barley β-glucan, 3,905.6 U/mg vs. 109.0 U/mg to lichenan, and 840.3 and 0.09 U/mg to CMC-Na). When using Avicel, phosphoric acid swollen cellulose (PASC) or steam-exploded corn straw (SECS) as the substrate, combination of TlCel5A and TlCel6A showed significant synergistic action, releasing more reduced sugars (1.08-2.87 mM) than the individual enzymes. These two cellulases may represent potential enzyme additives for the efficient biomass conversion and bioethanol production.
Talaromyces leycettanusJCM12802 is a great producer of thermophilic glycoside hydrolases (GHs). In this study, two cellulases (TlCel5A and TlCel6A) belonging to GH5 and GH6 respectively were expressed in Pichia pastoris and functionally characterized. The enzymes had acidic and thermophilic properties, showing optimal activities at pH 3.5-4.5 and 75-80°C, and retained stable at temperatures up to 60°C and over a broad pH range of 2.0-8.0. TlCel5A and TlCel6A acted against several cellulose substrates with varied activities (3,101.1 vs. 92.9 U/mg to barley β-glucan, 3,905.6 U/mg vs. 109.0 U/mg to lichenan, and 840.3 and 0.09 U/mg to CMC-Na). When using Avicel, phosphoric acid swollen cellulose (PASC) or steam-exploded corn straw (SECS) as the substrate, combination of TlCel5A and TlCel6A showed significant synergistic action, releasing more reduced sugars (1.08-2.87 mM) than the individual enzymes. These two cellulases may represent potential enzyme additives for the efficient biomass conversion and bioethanol production.
Cellulose, the major component of plant cell walls, is composed of repeating d-glucose residues linked by β-1,4-glucosidic bonds. It represents the most plentiful sustainable resource on Earth and is widely used for the production of renewable energy [1,2,3]. The complete hydrolysis of cellulose requires the synergy of three types of cellulases: endoglucanase (EG; EC 3.2.1.4) that randomly cleaves the intracellular β-1,4-glucosidic bond of cellulose to release cellooligosaccharides; cellobiohydrolase (CBH; EC 3.2.1.91) that hydrolyzes short cellulose molecules and cellooligosaccharides to cellobiose; and β-glucosidase (BG; EC 3.2.1.21) to degrade cellobiose into glucose [4,5,6]Based on the similarities of protein sequences and structures, cellulases are divided into different glycoside hydrolase (GH) families. EGs are often found in GH5, GH7, GH12 and GH45, most CBHs belong to GH6 and GH7, and BGs are classified into GH1 and GH3 [7]. Among them, the EG of GH5 has been identified as the key endoglucanase of cellulase cocktail, and exhibits the highest catalytic efficiency in biomass conversion [8,9] and broad substrate specificity including cellulase, xylanase and mannanase activities [10,11,12]. The CBH of GH6 has capability of rapidly depolymerizing cellulose and cellooligosaccharides and is responsible for the majority of hydrolytic turnover [13], thus representing another key component of the cellulase cocktail [9].Microbial cellulases have received great research and development attention, and are widely used in the biofuel, laundry, textile, food, animal feed, and pulp and paper industries [14,15] Most of the commercial cellulases are derived from fungi, such as Trichoderma, Humicola, Aspergillus and Penicillium, due to the high activities and yields [16]. Dozens of GH5 EGs and GH6 CBHs have been cloned from fungi, expressed in prokyotic and eurakyotic systems, and functionally characterized [8,13,17,18]. Of them, those with thermostable properties are more favorable because of rapid viscosity reduction, lower process cost and fewer risks of microbial contamination [19-22]. Although most known fungal cellulases have optimal temperatures of 40–60°C [9,23], some exceptions have thermophilic properties. For example, the Cel5H from Dictyoglomus thermophilum is active at 50–85°C and retains thermostable at 70°C [24]; the EGL2 from Humicola grisea is optimally active at 75°C and remains more than 80% residual activity after incubation at 75°C for 10 min, and the glucanase E2 from Fusarium verticillioides has a temperature optimum at 80°C and keeps thermostable at 60°C [25]. For fungal cellulases of GH6, only the CBHII from Trichoderma viride CICC13038 has thermophilic property with the optimal temperature of 70°C [26].Talaromyces leycettanusJCM12802 is a well-known producer of thermophilic GHs, including β-mannanase [27], β-glucosidase [28], polygalacturonases [19], xylanase [29], and α-galactosidase [23]. In the present study, the genes (Tlcel5A and Tlcel6A) coding for a GH5 endoglucanase and a GH6 cellobiohydrolase were identified in T. leycettanus. The gene products were then expressed in Pichia pastoris, biochemically characterized, and their synergistic action on the hydrolysis of Avicel, phosphoric acid swollen cellulose (PASC) and steam-exploded corn straw (SECS) at 60°C were also analyzed [30].
Materials and methods
Strains, plasmids and culture conditions
T. leycettanusJCM12802 from the Japan Collection of Microorganisms (JCM, Japan) was used as the donor. It was cultivated at 40°C in potato-dextrose broth (PDB) or complex medium containing 5 g/L (NH4)2SO4, 1 g/L KH2PO4, 0.5 g/L MgSO4·7H2O, 0.2 g/L CaCl2, 10 mg/L FeSO4·7H2O, 30 g/L corncob, 30 g/L soybean meal and 30 g/L wheat bran. Escherichia coli Trans1-T1 used as the cloning host was cultivated in liquid Luria-Bertani (LB) medium with ampicillin at 37°C. The expression host P. pastoris GS115 (Invitrogen, Carlsbad, CA) was cultivated in the yeast peptone dextrose (YPD) medium at 30°C. Minimal dextrose (MD) medium or minimal methanol (MM) medium, buffered glycerol complex (BMGY) medium, and buffered methanol complex (BMMY) medium were prepared according to the manual of the Pichia Expression kit (Invitrogen) and used for transformant selection, cultivation and induction, respectively. The vectors pGEM-T Easy (Promega, Madison, WI) and pPIC9 (Invitrogen) were used for cloning and expression, respectively.
Reagents and chemicals
The restriction endonucleases, T4 DNA ligase and endo-β-N-acetylglucosaminidase H (Endo H) were purchased from New England Biolabs (Ipswich, MA). The Taq DNA polymerase was from TaKaRa (Dalian, China). The DNA isolation and purification kits were purchased from Tiangen (Beijing, China) and Omega (Cowpens, SC), respectively. RNeasy plant mini kit and ReverTra-α-™ kit were supplied by Qiagen (QIAGEN, Germany) and TOYOBO (Osaka, Japan), respectively. The substrates lichenan, barley β-glucan, laminarin, Avicel, carboxymethyl cellulose sodium (CMC-Na), birchwood xylan, xyloglucan, konjac glucomannan, locus bean gum, 4-nitrophenyl β-d-cellobioside (pNPC), p-nitrophenyl-β-d-glucopyranoside (pNPGlu), and 4-nitrophenyl-α-d- galactopyranoside (pNPGal) were purchased from Sigma-Aldrich (St. Louis, MO). PASC treated by 85% of phosphoric acid and SECS were supplied by the Institute of Process, Chinese Academy of Sciences. And all other chemicals were of analytical grade and commercially available.
Cloning of the cellulase-encoding genes
The full length cellulase-encoding genes, Tlcel5A and Tlcel6A, were identified in the genome sequence of T. leycettanusJCM12802, and obtained by PCR amplification with specific primers GH5F/GH5R and GH6F/GH6R (Table 1). After three days’ growth in complex medium, the total RNA was extracted from the mycelia of T. leycettanusJCM12802 using the Qiagen RNeasy plant mini kit. cDNAs were then synthesized in vitro using the ReverTra Ace-a-™ kit. The cDNAs coding for the mature TlCel5A and TlCel6A were amplified with primers GH5F1/GH5R1 and GH6F1/GH6R1 harboring restriction sites, respectively. The PCR products with appropriate sizes were inserted into plasmid pGEM-T Easy and then transformed into E. coli Trans1-T1. Positive clones were confirmed by PCR and DNA sequencing.
Table 1
Primers used in this study.
Primers
Sequences (5′→3′)a
Size (bp)
GH5F
CCGTACGTAGCACCCAAGAGCAAGACCAAGC
31
GH5R
GATTGCGGCCGCCTACAGGCACTGGTAGTAATAGGGGTTC
40
GH6F
CATGAATTCCAGCAAACCATGTGGGGTCAATGC
33
GH6R
GATTGCGGCCGCCTAGAAAGAGGGGTTGGCGTTGGTAAG
39
GH5F1
CCGTACGTAGCACCCAAGAGCAAGACCAAGC
31
GH5R1
GATTGCGGCCGCCTACAGGCACTGGTAGTAATAGGGGTTC
40
GH6F1
CATGAATTCCAGCAAACCATGTGGGGTCAATGC
33
GH6R1
GATTGCGGCCGCCTAGAAAGAGGGGTTGGCGTTGGTAAG
39
a The restriction sites are underlined
a The restriction sites are underlined
Sequence and structure analysis
The nucleotide and amino acid sequences were used for BLAST analysis at NCBI (http:// www.ncbi.nlm.nih.gov/BLAST/). Simplified sequence alignment and prediction of the isoelectric point and molecular weight were conducted by using the Vector NTI Suite 10.0 software. Signal peptide prediction was carried out with SignalP 4.1 Server (http://www.cbs.dtu.dk/services/SignalP/). Multiple alignment of protein sequences was performed with the ClustalX 2.1 (http://www.clustal.org, [31], and the results were demonstrated by ESPript 3.0 (http://espript.ibcp.fr/ESPript/cgi-bin/ESPript.cgi [32]. The NetNglyc server was used to predict the putative N-glycosylation sites (http://www.cbs.dtu.dk/services/NetNGlyc/). And the modeled structures were predicted and visualized by using the SWISS-MODEL [33] and Pymol [34].
Heterogeneous expression in P. pastoris
Heterologous expression of TlCel5A and TlCel6A was performed in P. pastoris according to the manual of the Pichia Expression kit (Invitrogen) with some modifications. The cDNA fragments coding for the mature proteins of TlCel5A and TlCel6A were digested with restriction enzymes SnabI or EcoRI and NotI and subcloned into plasmid pPIC9 to yield expression vectors pPIC9-Tlcel5A and pPIC9-Tlcel6A, respectively. The recombinant plasmids were then linearized with BglII and individually transformed into P. pastoris GS115 competent cells by electroporation. Transformants were selected on MD plates, and positive transformants were grown in 10 mL shake tubes containing 3 mL BMGY for 2 days and 1 mL BMMY for another 2 days (220 rpm and 30°C). The culture supernatants were collected by centrifugation at 5,000 rpm for 10 min, followed by cellulase activity assay as described below. The transformants with highest cellulase activities were selected for flask-level fermentation.The most active transformants of TlCel5A and TlCel6A were grown in 1 L shake-flasks containing 400 mL BMGY at 220 rpm and 30°C for 2 days, respectively. The cultures were pelleted by centrifugation and resuspended in 200 mL of BMMY for 3-day-growth at 30°C and 200 rpm. Methanol was then added at the final concentration of 0.5% every 24 h for continuous induction of 3 days. The culture supernatants were collected by centrifugation at 4500× g for further analysis.
Purification of recombinant TlCel5A and TlCel6A
The viva flow 200 ultrafiltration membrane system (Sartorius, Germany) with 5 kDa cut-off was used for the concentration and buffer exchange (to 0.1 M Tris-HCl, pH 8.0) of the crude enzymes. The recombinant proteins were desalted by HiTrapTM Desalting column and purified using the HiTrap Q Sepharose XL FPLC column (GE Healthcare) pre-equilibrated with 0.1 M Tris-HCl (pH 8.0). The gradient NaCl of 0–0.7 M at the flow rate of 3 mL/min was used to elute the proteins. Fractions showing cellulase activities were pooled and further desalted with a 5 kDa molecular cut-off concentration tube (Millipore) using 0.1 M McIlvaine buffer (pH 3.5 or 4.5). The purified proteins were separated on 12% sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) for purity and molecular mass analysis. Protein concentration was determined by using the Bradford method.
Deglycosylation of the purified recombinant TlCel5A and TlCel6A
To remove N-glycosylation, the purified recombinant TlCel5A and TlCel6A were treated with Endo H for 2 h at 37°C following the manufacturer’s instructions (New England Biolabs), and checked by SDS-PAGE.
Enzyme activity assays
The cellulase activities were determined using 1% (w/v) CMC-Na, barley β-glucan or lichenan as the substrate. The reaction mixtures containing 100 μL of properly diluted enzyme solution and 900 μL substrate solution in 0.1 M McIlvaine buffer (pH 3.5 and 4.5) were incubated at 75°C or 80°C (optimum temperature) for 10 min. When using 5 mg/mL Avicel as the substrate, the reaction period was lengthened to 60 min. The amounts of reducing sugars were determined via the 3,5-dinitrosalicylic acid (DNS) method [35]. One unit (U) of enzyme activity was defined as the amount of enzyme producing 1 μmol of reducing sugar per minute under the assay conditions.
Biochemical characterization of TlCel5A and TlCel6A
CMC-Na, barley β-glucan and PASC were used as the substrates for enzyme characterization. The optimal pH was determined at 75°C for TlCel5A and 80°C for TlCel6A, respectively, in 0.1 M McIlvaine buffer with pH ranging from 2.0 to 8.0. To test the pH stability, the purified enzymes were pre-incubated at 37°C for 60 min in buffers with pH ranging from 1.0 to 12.0 (0.1 M KCl-HCl for pH 1.0–2.0, 0.1 M McIlvaine buffer for 2.0 to 8.0, and 0.1 M glycine-NaOH for pH 9.0–12.0). The residual enzyme activities were determined at 75°C and pH 3.5 for TlCel5A and 80°C (barley β-glucan) or 70°C (PASC) and pH 4.5 for TlCel6A, respectively. To determine the optimal temperature, the cellulase activities were determined at temperatures ranging from 30°C to 90°C and pH 3.5 for TlCel5A or pH 4.5 for TlCel6A for 10 min, respectively. For thermal stability assays, TlCel5A and TlCel6A were incubated at temperatures of 70°C, 75°C or 80°C and pH 3.5 or 4.5 for different periods of time. For half-life determination, 0.05 mg of TlCel5A or 0.2 mg of TlCel6A was incubated at 60°C, 65°C or 70°C for 0.5–24 h. Residual activities were determined as described above.
Substrate specifiity and kinetic parameters
Substrate specificity of TlCel5A and TlCel6A were determined by using 1% (w/v) CMC-Na, barley β-glucan, Avicel, lichenan, laminarin, xyloglucan, birchwood xylan, konjac flour, locus bean gum, glucomannan, or 0.2 mM of pNPGlu, pNPGal, pNPC as the substrate.The kinetic parameters (Km, Vmax and kcat/Km) of TlCel5A were determined by incubating the enzyme with 0.25 to 10 mg/mL CMC-Na at pH 3.5 and 75°C for 5 min. For TlCel6A, the kinetic parameters were determined at pH 4.5 and 80°C for 5 min with 0.25–10.0 mg/mL barley β-glucan as the substrate. The enzyme activities were determined by using the DNS method. The kinetic constants were calculated using the Lineweaver-Burk plots by GraphPad Prism 6.0 (http://www.graphpad.com/scientific-software/prism/).
Analysis of the cellooligosaccharides hydrolysis products
The hydrolysis products of cellooligosaccharides by TlCel5A and TlCel6A were detected by high-performance anion exchange chromatography (HPAEC, model 2500, Dionex, Sunnyvale, CA). Purified TlCel5A (0.05 U) or TlCel6A (0.02 U) was added into 1 mL of cellooligosaccharide solution containing 200 μg of cellotetraose, cellopentaose, or cellohexaose and incubated at 60°C for 0 min, 1 min, 5 min, 30 min, 1 h, 4 h or 5 h. After enzyme inactivation by boiling water bath, the hydrolysates were diluted 100 times with ddH2O, and 100 μL of each sample was injected into the column of HPAEC. The oligosaccharides were eluted by 100 mM NaOH. The standards consisted of glucose, cellobiose, cellotriose, cellotetraose, cellopentaose, and cellohexaose. The amount of each hydrolysate was calculated based on the peak area. One enzyme unit (U) was defined as the amount of enzyme to hydrolyze 1 μmol of substrate per minute under the assay conditions. The catalytic efficiency values (kcat/Km) of TlCel6A against cellooligosaccharides were calculated according to Xia et al. (2016).
Synergistic action of TlCel5A and TlCel6A on cellulose hydrolysis
To determine the hydrolytic capabilities of TlCel5A and TlCel6A to degrade cellulose substrates, the enzymes were combined at different ratios, and the commercial β-glucosidase from Aspergillus fumigatu (Sigma-Aldrich) was added at the concentration of 10% (mol β-glucosidase/mol total enzyme) to convert cellobiose to glucose. When using Avicel as the substrate, TlCel5A and TlCel6A were combined at the ratios of 0.4:3.6, 0.8:3.2, 1.2:2.8, 1.6:2.4, 2.0:2.0, 2.4:1.6, 2.8:1.2, 3.2:0.8, 3.6:0.4 in the total amount of 4.0 μM and incubated with 5 mg/mL of Avicel in 50 mM McIlvaine buffer, pH 4.0 at 60°C for 24 h. The amounts of reducing sugars released were determined using the DNS method.Based on the results above, the best ratio of TlCel5A and TlCel6A was used for further enzyme combinations. When using SECS or Avicel as the substrate, 8 μM of TlCel5A or TlCel6A alone, or 4 μM TlCel5A and 4 μM TlCel6A was incubated with 5 mg/mL substrate at pH 4.0 and 60°C for 12 or 18 h. With 2.5 mg/mL PASC as the substrate, 2 μM of TlCel5A or TlCel6A alone or 1 μM TlCel5A and 1 μM TlCel6A was added. The amounts of reducing sugars released were determined by using the DNS method. The amounts of glucose released were analyzed by a one-factor ANOVA of SPSS19.0 to assess the synergistic effects of TlCel5A and TlCel6A. Statistical differences were considered to be significant at P < 0.05.
Nucleotide sequence accession numbers
The nucleotide sequences of TlCel5A and TlCel6A from T. leycettanusJCM12802 have been deposited in the GenBank database under the accession numbers MG993208 and MG993209, respectively.
Labooratory protocol
Link: dx.doi.org/10.17504/protocols.io.8g4htyw
Results
Gene cloning and sequence analysis
The full-length Tlcel5A and Tlcel6A contained 1464 bp and 1898 bp, respectively, which were interrupted by four (67, 56, 57, and 54 bp) and seven (69, 75, 78, 69, 71, 70, and 71 bp) introns. The cDNAs were 1230 bp and 1398 bp in lengths, and encoded two polypeptides of 409 and 465 amino acids, respectively. A putative signal peptide of 18 amino acids was predicted at the N-termini, and two (Asn36 and Asn240 in TlCel5A) and three (Asn293, Asn307 and Asn423 in TlCel6A) potential N-glycosylation sites were predicted in deduced TlCel5A and TlCel6A.BLAST analysis indicated that TlCel5A is an endoglucanase of GH5 while TlCel6A is a cellobiohydrolase of GH6, respectively. Both enzymes consist of a cellulose-binding module (CBM), a linker region and a catalytic domain. The CBM of TlCel5A is at the C-terminus while that of TlCel6A is at the N-terminus. The deduced TlCel5A showed the highest protein identity of 76% to an EG from Aspergillus udagawae (GAO86105.1) and 77% with the catalytic domain of structure-resolved EG (1GZJ) from Thermoascus aurantiacus. Deduced TlCel6A shared the highest identity of 99% with a GH6 CBH from T. leycettanus (CDF76448.1).Multiple sequence alignment and structure analysis (S1 Fig) indicated that Glu159 and Glu266 of TlCel5A and Asp239 and Asp419 of TlCel6A function as the proton donors and nucleophiles, respectively. TlCel5A has eight conserved residues of GH5 members, including Arg75, His119, Asn158, Glu159, His224, Tyr226, Glu266 and Trp299. The catalytic domain of TlCel5A was a typical (α/β)8 barrel structure (S2A Fig) containing a long and shallow substrate binding cavity. Several aromatic residues in the cavity played very important role in enzyme activity. Thirteen conserved residues (Tyr120, Trp151, Tyr187, Asp193, Asp239, Asn243, Thr246, Trp287, Trp290, Trp382, Trp385, Asp419, and His432) of GH6 members were found in TlCel6A. The modeled structure of the catalytic domain of TlCel6A is a distorted α/β barrel (S2B Fig), in which the central β-sheet core is composed of seven instead of eight parallel β-strands. It has a long substrate binding groove, and the catalytic center is enclosed by two active-site loops (residues 190–207 and 412–446). The loops are stabilized by disulfide bonds Cys194-Cys253 and Cys386-Cys433.
Expression and purification of the recombinant TlCel5A and TlCel6A
Recombinant TlCel5A and TlCel6A were successfully expressed in P. pastoris GS115. With barley β-glucan as the substrate, the highest activities of 2.02 U/mL and 1.86 U/mL, were detected in the positive transformants of TlCel5A and TlCel6A, respectively. After large-scale fermentation for 144 h, the culture supernatants were collected, concentrated and purified to electrophoretic homogeneity by anion exchange chromatography. SDS-PAGE revealed that the purified recombinant TlCel5A and TlCel6A had apparent molecular masses of approximately 45 kDa and 65 kDa (Fig 1), which were higher than their theoretical values (42.5 kDa and 47.0 kDa). After Endo H treatment, the molecular mass of TlCel5A remained the same, while the TlCel6A migrated as a single band of about 60 kDa. Other post-translational modification like O-glycosylation might account for the extra molecular masses.
Fig 1
SDS-PAGE (12% polyacrylamide gel) analysis of the purified recombinant TlCel5A and TlCel6A.
Lane M, the molecular mass standards; lane 1, the culture supernatant of TlCel6A; lane 2, the purified recombinant TlCel6A; lane 3, the deglycosylated TlCel6A with Endo H treatment; lane 4, the culture supernatant of TlCel5A; lane 5, the purified recombinant TlCel5A; lane 6, the deglycosylated TlCel5A with Endo H treatment.
SDS-PAGE (12% polyacrylamide gel) analysis of the purified recombinant TlCel5A and TlCel6A.
Lane M, the molecular mass standards; lane 1, the culture supernatant of TlCel6A; lane 2, the purified recombinant TlCel6A; lane 3, the deglycosylated TlCel6A with Endo H treatment; lane 4, the culture supernatant of TlCel5A; lane 5, the purified recombinant TlCel5A; lane 6, the deglycosylated TlCel5A with Endo H treatment.
Enzymatic properties of purified recombinant TlCel5A and TlCel6A
The enzymatic properties of TlCel5A were determined with CMC-Na, and the TlCel6A activities were determined by using barley β-glucan and PASC as the substrates. TlCel5A had the optimal pH of 3.5 (Fig 2A) and retained more than 90% activity at pH 2.0 to 10.0 (Fig 2B). The pH optima of TlCel6A towards barley β-glucan and PASC were both 4.5 (Fig 2A), but retained stable over a narrower pH range of 2.0 to 8.0 (Fig 2B). Both enzymes were thermophilic: TlCel5A was optimally active at 75°C, and remained more than 90% activity at 80°C, while TlCel6A showed the maximum activity at 80°C to barley β-glucan and 70°C to PASC (Fig 2A). The enzymes were highly stable at 60°C (Fig 2D). When increased the temperature to 70°C, TlCel5A retained most of the activity after 1-h incubation, while TlCel6A lost approximately 50% and 40% activities towards barley β-glucan and PASC, respectively, after 30 min (Fig 2E and 2F). The t1/2 values of TlCel5A and TlCel6A were determined to be 20 h and 31 h at 60°C, 4.2 h and 7 h at 65°C, and 1.7 h and 0.5 h at 70°C.
Fig 2
Effects of pH and temperature on the enzyme activity and stability of purified recombinant TlCel5A and TlCel6A.
(A) pH-activity profiles. TlCel5A was incubated at 75°C for 10 min with 1.0% (w/v) CMC for enzyme assays. The enzymatic activities of TlCel6A were measured at 70°C against barley β-glucan and 80°C for PASC for 10 min, respectively. (B) pH stability of TlCel5A and TlCel6A after 1 h-incubation at 37°C. The enzyme activities were measured under standard conditions. (C) Temperature-activity profiles of TlCel5A and TlCel6A assayed at optimal pH for 10 min. (D) TlCel5A thermostability at 70, 75 and 80°C and pH 3.5 for various durations. (E) TlCel6A thermostability at 60, 70 and 80°C and pH 4.5 with barley β-glucan as the substrate. (F) TlCel6A activities measured at 55, 60, 65, 70 and 80°C and pH 4.5 with PASC as the substrate. Each value in the panel represents the means ± SD (n = 3).
Effects of pH and temperature on the enzyme activity and stability of purified recombinant TlCel5A and TlCel6A.
(A) pH-activity profiles. TlCel5A was incubated at 75°C for 10 min with 1.0% (w/v) CMC for enzyme assays. The enzymatic activities of TlCel6A were measured at 70°C against barley β-glucan and 80°C for PASC for 10 min, respectively. (B) pH stability of TlCel5A and TlCel6A after 1 h-incubation at 37°C. The enzyme activities were measured under standard conditions. (C) Temperature-activity profiles of TlCel5A and TlCel6A assayed at optimal pH for 10 min. (D) TlCel5A thermostability at 70, 75 and 80°C and pH 3.5 for various durations. (E) TlCel6A thermostability at 60, 70 and 80°C and pH 4.5 with barley β-glucan as the substrate. (F) TlCel6A activities measured at 55, 60, 65, 70 and 80°C and pH 4.5 with PASC as the substrate. Each value in the panel represents the means ± SD (n = 3).
Substrate specificity and kinetic parameters
TlCel5A exhibited broad substrate specificity including barley β-glucan, lichenan, CMC-Na, Avicel, laminarin, konjac glucomannan, and birchwood xylan. It had higher specific activities on lichenan (3,905.6 ± 39.9 U/mg), barley β-glucan (3,101.1 ± 12.1 U/mg) than on CMC-Na (840.3 ± 0.7 U/mg). With CMC-Na as the substrate, the Km, Vmax and kcat/Km values of purified TlCel5A were determined to be 7.06 mg/mL, 1130.2 μmol/min/mg, and 113.4 mL/s/mg, respectively.The specific activities of TlCel6A on lichenan, barley β-glucan and PASC were 109.0 ± 4.5 U/mg, 92.9 ± 1.4 U/mg and 4.0 ± 0.1 U/mg. When using Avicel and CMC-Na as the substrate, TlCel6A showed much lower activities (0.12 U/mg and 0.09 U/mg). No activity was detected on pNP-substrates. The Km, Vmax, and kcat/Km values of TlCel6A using barley β-glucan as the substrate were determined to be 2.1 mg/mL, 196.1 μmol/min/mg, and 73.2 mL/s/mg, respectively. For cellooligosaccharide hydrolysis, TlCel5A had low specific activity on cellotetraose, cellopentaose (15.2 U/mg) and cellohexaose (16.1 U/mg). And TlCel6A had high activities on cellotetraose (186.7 U/mg), cellopentaose (99.6 U/mg), and cellohexaose (138.9 U/mg). The relative low activity on cellopentaose might be ascribed to the preference of TlCel6A for cellooligosaccharides containing even numbers of glucose units.
Hydrolysis products of cellooligosaccharides
The hydrolysis products of TlCel5A and TlCel6A on cellooligosaccharides (cellotetraose, cellopentaose, or cellohexaose) were analyzed by using the method of HPLC (Table 2). TlCel5A had no activity on cellotetraose (S3A Fig), cleaved cellopentaose into mainly cellobiose and cellotriose and low amounts of cellotetraose (S3B Fig), and cellohexaose into cellobiose, cellotriose, cellotetraose and cellopentaose (S3C Fig). TlCel6A was active against cellotetraose, releasing cellobiose as the sole product (S3D Fig). TlCel6A also hydrolyzed cellopentaose and cellohexaose rapidly. The main products were cellobiose and cellotriose (S3E and S3F Fig). The catalytic efficiency values of TlCel5A and TlCel6A against cellotetraose, cellopentaose and cellohexaose were 0, 10.4, 19.3 and 95.2, 42.9, 139. 3 /μM/min, respectively.
Table 2
Hydrolysis product analysis of cellooligosaccharides by TlCel5A and TlCel6A.
Protein
Substrate
Time (min)
Oligosaccharides (μg)
Cellobiose
Cellotriose
Cellotetraose
Cellopentaose
Cellohexaose
TlCel5A
Cellotetraose
5
-
-
4.84±0.06
60
-
-
4.82±0.02
120
-
-
4.75±0.12
TlCel5A
Cellopentaose
5
0.34±0.01
0.41±0.01
0.34±0.02
5.76±0.03
30
0.95±0.01
1.18±0.01
0.38±0.01
4.73±0.03
120
2.09±0.01
2.57±0.02
0.45±0.01
2.94±0.01
300
3.27±0.03
3.79±0.04
0.55±0.01
1.20±0.01
TlCel5A
Cellohexaose
5
0.29±0.01
0.42±0.01
0.46±0.01
-
3.76±0.01
30
0.66±0.01
1.22±0.02
1.07±0.02
-
1.68±0.01
60
0.78±0.01
1.63±0,02
1.27±0.01
-
1.01±0.01
120
0.93±0.01
2.28±0.01
1.38±0.01
-
0.35±0.01
TlCel6A
Cellotetraose
1
3.43±0.05
-
2.65±0.06
5
6.53±0.06
-
0.21±0.01
TlCel6A
Cellopentaose
1
1.05±0.03
1.50±0.03
-
4.72±0.07
5
2.10±0.03
3.00±0.03
-
3.05±0.02
30
4.21±0.02
5.79±0.03
-
-
60
4.22±0.02
5.79±0.02
-
-
TlCel6A
Cellohexaose
1
1.09±0.02
1.56±0.02
0.51±0.01
-
1.81±0.03
5
2.15±0.01
2.92±0.01
0.50±0.01
-
-
30
2.24±0.01
2.74±0.02
0.31±0.01
-
-
60
2.38±0.01
2.76±0.01
0.20±0.01
-
-
The hydrolytic capabilities of TlCel5A, TlCel6A and their combinations at different concentrations (0.4–4.0 μM) towards Avicel were determined after 24-h incubation at 60°C. As shown in Fig 3A, the enzyme combinations released more glucose than the individual enzyme or the sum of the individuals. The highest amount of glucose (4.00 mM) was released by the enzyme combination of 2 μM TlCel5A and 2 μM TlCel6A. Thus the enzyme ratio of 1:1 was used for further studies.
Fig 3
Synergistic actions of TlCel5A, TlCel6A and a commercial glucosidase on the hydrolysis of different cellulose substrates.
(A)Avicel (5.0 mg/mL) hydrolysis by the TlCel5A, TlCel6A, and their combination at different ratios. (B)Avicel (2.5 mg/mL) hydrolysis by the TlCel5A, TlCel6A, and their combination at the ratio of 1:1. (C) SECS (5.0 mg/mL) hydrolysis by the TlCel5A, TlCel6A, and their combination at the ratio of 1:1. (D) PASC (2.5 mg/mL) hydrolysis by the TlCel5A, TlCel6A, and their combination at the ratio of 1:1. Each experiment had triplicate, and the data were shown as mean ± standard deviation (n = 3).
Synergistic actions of TlCel5A, TlCel6A and a commercial glucosidase on the hydrolysis of different cellulose substrates.
(A)Avicel (5.0 mg/mL) hydrolysis by the TlCel5A, TlCel6A, and their combination at different ratios. (B)Avicel (2.5 mg/mL) hydrolysis by the TlCel5A, TlCel6A, and their combination at the ratio of 1:1. (C) SECS (5.0 mg/mL) hydrolysis by the TlCel5A, TlCel6A, and their combination at the ratio of 1:1. (D) PASC (2.5 mg/mL) hydrolysis by the TlCel5A, TlCel6A, and their combination at the ratio of 1:1. Each experiment had triplicate, and the data were shown as mean ± standard deviation (n = 3).The combination of TlCel5A and TlCel6A released 3.72 mM, 4.33 mM, and 7.87 mM of glucose from Avicel at 18 h, SECS at 12 h, and PASC at 60 min, respectively, which were significantly higher (P < 0.05) than that released by TlCel5A or TlCel6A individually from Avicel (1.08 and 2.64 mM; Fig 3B), SECS (1.46 and 1.96 mM; Fig 3C), and PASC (5.33 and 5.51 mM; Fig 3D). The results indicated that TlCel5A and TlCel6A have synergistic action on cellulose degradation.
Discussion
The endoglucanases of GH5 and cellobiohydrolases of GH6 are crucial components of the cellulase complex for biomass conversion. These cellulases generally have a temperature optimum of 40–70°C and retain stable at 50–60°C [9,36,37]. To improve the hydrolytic efficiency and reduce the cost, thermostable cellulases with high activities are much favorable. In the present study, two cellulases (TlCel5A and TlCel6A) from T. leycettanusJCM12802 were heterologously produced in P. pastoris and functionally characterized. The recombinant enzymes were found to be thermophilic and highly active, and showed great efficiency in the bioconversion of various cellulose substrates.In comparison to their close homologues, TlCel5A and TlCel6A showed adaptability to higher temperatures. For example, the optimal temperature of TlCel5A is 75°C, which is at least 5°C higher than those characterized EGs (with 60–77% sequence identities) of Penicillium brasilianum (Cel5C; [38], Aspergillus niger (AnCel5A; [39], and Thermoascus aurantiacus (EGI; [17]. One exception is the TeEgl5A from T. emersonii CBS394.64, which exhibits optimal activity at 90°C [12]. However, the TlCel5A activity (840 U/mg) on CMC-Na was much higher than that of TeEgl5A (624 U/mg), EGI (336 U/mg) and Cel5C (51 U/mg). The temperature optima of TlCel6A on barley β-glucan and PASC are 80°C and 70°C, much higher than or similar to its homologues 40–70°C [26,40,41]. These excellent properties make TlCel5A and TlCel6A much potential for the application in the biofuel industry.The hydrolytic capabilities of TlCel5A and TlCel6A in combination with a commercial glucosidase were then assessed. These enzymes employ endo- and exo-mode of actions [42-44], and acted synergistically on the hydrolysis of different cellulose substrates. When added the TlCel5A and TlCel6A at the ratio of 1:1, it produced the highest amount of glucose (up to 4 mM). There are significant differences in the amounts of reducing sugars released by TlCel5A, TlCel6A and their combination. The synergy effect of combined TlCel5A and TlCel6A with Avicel as the substrate is greater than that of Ctendo45 and CtCel6 [19], which might be ascribed to the enzymatic properties of different enzyme components. Although TlCel5A and TlCel6A individually showed higher activities on PASC than on Avicel, the synergy effect of TlCel5A and TlCel6A was lower on PASC. Similar results have been reported by Zhang and Lynd [45]. For natural substrate like SECS, TlCel5A and TlCel6A showed greater synergy than the individual enzymes. Of the two enzymes, TlCel6A had higher hydrolysis activity than TlCel5A towards crystalline Avicel, but had no difference in hydrolysis of PASC and steam-exploded corn straw. The reason might be that TlCel5A contributes to the increased hydrolytic efficiency of TlCel6A by producing new chain ends and smoothing the physical obstacles on the surface of cellulose, while TlCel6A depolymerizes some tight cellulose structure to promote the TlCel5A activity [46]. Therefore, the enzyme combination of TlCel5A and TlCel6A is more favorable to degrade natural biomass with higher hydrolysis efficiency.It has been reported that N-linked glycan is one important component of the processive machinery of cellobiohydrolases and plays a role in the enzyme activity [47]. Although some studies indicated that N-glycosylation has no significant effect on enzyme activity, and it does influence the protein stability [48]. According to the theory of [47], the position of N-glycosylation on the protein surface plays the key role. There are three potential N-glycosylation sites (Asn293, Asn307 and Asn423) in TlCel6A. Since the glycan linked to Asn293 is located in close proximity to the entrance of the active site tunnel, this long glycan chain might block the cellulose molecules from the tunnel and finally decrease the activity. On the other hand, Asn423 is located on the active loop, and the glycans attached to this residue might form interactions with the cellulose molecules and boost the enzyme activity. Further site-directed mutagenesis at these potential N-glycosylation sites will be conducted to reveal the underlying mechanisms.
Conclusions
Two acidic cellulases TlCel5A and TlCel6A were identified in T. leycettanusJCM12802 and heterologously produced in P. pastoris. In comparison to close homologues, these cellulases are superior in higher activities and greater thermostability. Their combination at the ratio of 1:1 showed distinguished synergy on Avicel, PASC and steam-exploded corn straw. Thus TlCel5A and TlCel6A may represent great candidates for the industrial conversion of lignocellulose.Multiple sequence alignment of The catalytic residues are indicated by circles. The conserved residues are indicated with asterisks. And the potential N-glycosylation sites are indicated by triangles.(TIF)Click here for additional data file.Modeled structures of Orange sticks represent potential N-glycosylation sites, red sticks indicate the catalytic residues, and spheres indicate the conserved residues.(TIF)Click here for additional data file.
Hydrolysis products of TlCel5A and TlCel6A on cellooligosaccharides determined by HPLC.
(TIF)Click here for additional data file.(TIF)Click here for additional data file.9 Sep 2019PONE-D-19-21437Characterization of two thermophilic cellulases from Talaromyces leycettanusJCM12802 and their synergistic action on cellulose hydrolysisPLOS ONEDear Mrs. Luo,Thank you for submitting your manuscript to PLOS ONE. After careful consideration, we feel that it has merit but does not fully meet PLOS ONE’s publication criteria as it currently stands. Therefore, we invite you to submit a revised version of the manuscript that addresses the points raised during the review process.We would appreciate receiving your revised manuscript by Oct 24 2019 11:59PM. When you are ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file.If you would like to make changes to your financial disclosure, please include your updated statement in your cover letter.To enhance the reproducibility of your results, we recommend that if applicable you deposit your laboratory protocols in protocols.io, where a protocol can be assigned its own identifier (DOI) such that it can be cited independently in the future. For instructions see: http://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocolsPlease include the following items when submitting your revised manuscript:A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). This letter should be uploaded as separate file and labeled 'Response to Reviewers'.A marked-up copy of your manuscript that highlights changes made to the original version. This file should be uploaded as separate file and labeled 'Revised Manuscript with Track Changes'.An unmarked version of your revised paper without tracked changes. This file should be uploaded as separate file and labeled 'Manuscript'.Please note while forming your response, if your article is accepted, you may have the opportunity to make the peer review history publicly available. The record will include editor decision letters (with reviews) and your responses to reviewer comments. If eligible, we will contact you to opt in or out.We look forward to receiving your revised manuscript.Kind regards,Jean-Guy BerrinAcademic EditorPLOS ONEJournal Requirements:When submitting your revision, we need you to address these additional requirements.1. Please ensure that your manuscript meets PLOS ONE's style requirements, including those for file naming. The PLOS ONE style templates can be found athttp://www.journals.plos.org/plosone/s/file?id=wjVg/PLOSOne_formatting_sample_main_body.pdf and http://www.journals.plos.org/plosone/s/file?id=ba62/PLOSOne_formatting_sample_title_authors_affiliations.pdf2. PLOS ONE now requires that authors provide the original uncropped and unadjusted images underlying all blot or gel results reported in a submission’s figures or Supporting Information files. This policy and the journal’s other requirements for blot/gel reporting and figure preparation are described in detail at https://journals.plos.org/plosone/s/figures#loc-blot-and-gel-reporting-requirements and https://journals.plos.org/plosone/s/figures#loc-preparing-figures-from-image-files. When you submit your revised manuscript, please ensure that your figures adhere fully to these guidelines and provide the original underlying images for all blot or gel data reported in your submission. See the following link for instructions on providing the original image data: https://journals.plos.org/plosone/s/figures#loc-original-images-for-blots-and-gels.In your cover letter, please note whether your blot/gel image data are in Supporting Information or posted at a public data repository, provide the repository URL if relevant, and provide specific details as to which raw blot/gel images, if any, are not available. Email us at plosone@plos.org if you have any questions.[Note: HTML markup is below. Please do not edit.]Reviewers' comments:Reviewer's Responses to QuestionsComments to the Author1. Is the manuscript technically sound, and do the data support the conclusions?The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented.Reviewer #1: YesReviewer #2: Yes**********2. Has the statistical analysis been performed appropriately and rigorously?Reviewer #1: YesReviewer #2: Yes**********3. Have the authors made all data underlying the findings in their manuscript fully available?The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified.Reviewer #1: YesReviewer #2: Yes**********4. Is the manuscript presented in an intelligible fashion and written in standard English?PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here.Reviewer #1: YesReviewer #2: Yes**********5. Review Comments to the AuthorPlease use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters)Reviewer #1: Figures are of poor quality and need to be replacedSeveral of the references are old and should be replaced or supplemented with more recent publicationsReviewer #2: I recommend this manuscript for publication in PLOS ONE. I suggest the following issue to address though. Speaking about the synergistic action, the Authors should make some thoughts and provide chemical scheme of hydrolysis reaction pathway for this scenario. It will simplify understanding the concept of enzymes action.**********6. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.If you choose “no”, your identity will remain anonymous but your review may still be made public.Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.Reviewer #1: NoReviewer #2: No[NOTE: If reviewer comments were submitted as an attachment file, they will be attached to this email and accessible via the submission site. Please log into your account, locate the manuscript record, and check for the action link "View Attachments". If this link does not appear, there are no attachment files to be viewed.]While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com/. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Registration is free. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email us at figures@plos.org. Please note that Supporting Information files do not need this step.19 Oct 2019Response to editor:1. Please ensure that your manuscript meets PLOS ONE's style requirements, including those for file naming.Answer: We have checked the manuscript carefully and changed the name of my files to ensure meet PLOS ONE's style requirements.2. PLOS ONE now requires that authors provide the original uncropped and unadjusted images underlying all blot or gel results reported in a submission’s figures or Supporting Information files.Answer: I have provided the original uncropped and unadjusted gel image in the Supporting Information file.3. In your cover letter, please note whether your blot/gel image data are in Supporting Information or posted at a public data repository.Answer: The gel image data has been provided in the Supporting Information file.4. Figures are of poor quality and need to be replaced.Answer: The figures with high quality have been replaced and uploaded.5. To enhance the reproducibility of your results, we recommend that if applicable you deposit your laboratory protocols in protocols.io, where a protocol can be assigned its own identifier (DOI) such that it can be cited independently in the future.Answer: I have finished the protocol and uploaded it, this is the link: dx.doi.org/10.17504/protocols.io.8g4htyw.Response to Reviewer 1:Reviewer #1: Several of the references are old and should be replaced or supplemented with more recent publicationsAnswer: The latest references have been added and inserted into the corresponding position in the article and marked yellow. The followings are the six newly inserted references.3. Touijer H, Benchemsi N, Ettayebi M, Janati A, Chaouni B, Bekkari H. Thermostable Cellulases from the YeastTrichosporon sp. Enzyme research. 2019;1-6. (Line42)6. Kamal S, Khan SU, Muhammad N, Shoaib M, Omar M, Kaneza P, et al. Insights on heterologous expression of fungal cellulases in Pichia pastoris. Biochemistry and Molecular Biology. 2018; 3(1): 15-35. (Line47)15. Kamal S, Khan SU, Khan S, Shoaib M, Khan H, Man S, et al. Recent view on heterologous expression of thermostable fungal cellulases, focused on expression factory of Pichia Pastoris. International Journal of Basic Medical Sciences and Pharmacy. 2018; 7(2), 43-57. (Line66)21. Li D C, Papageorgiou A C. Cellulases from thermophilic fungi: recent insights and biotechnological potential. Enzyme Research. 2019; 395-417. (Line72)22. Xu X, Fan C, Song L, Li J, Chen Y, Zhang Y, et al. A novel CreA-mediated regulation mechanism of cellulase expression in the thermophilic fungus Humicola insolens. International Journal of Molecular Sciences. 2019; 20(15): 3693. (Line72)30. Fang H, Zhao R, Li CF, Zhao C. Simultaneous enhancement of the beta–exo synergism and exo–exo synergism in Trichoderma reesei cellulase to increase the cellulose degrading capability. Microbial Cell Factories. 2019; 18(1): 9-23. (Line103)Response to Reviewer 2:Reviewer #2: I recommend this manuscript for publication in PLOS ONE. I suggest the following issue to address though. Speaking about the synergistic action, the Authors should make some thoughts and provide chemical scheme of hydrolysis reaction pathway for this scenario. It will simplify understanding the concept of enzymes action.Answer: We would like to take this opportunity to thank Reviewer 2 for his/her suggestions on my paper with kindly words. And the chemical scheme of hydrolysis reaction pathway of synergistic action was as follows:“Cooperation between many functionally related proteins is very important in biology. A prominent example is the apparent rate of substrate conversion increased by the addition of different combination cellulase enzymes to break down cellulose. A high level of coordination between the enzyme, e.g. exo/endo, exo/exo and endo/the BG synergistic effect, which is effective to hydrolyze crystalline cellulose required. [1] [2] [3] [4]There are three significant types of cellulases to be used basically for the efficient degradation of cellulose. And perhaps the most widely known mechanism remains the so-called endo/exo synergy model. In this form, cellobiohydrolases (CBHs), also called exo-glucanases, cleave cellobiose from the reducing and nonreducing ends producing crystalline ends of cellulose; Endo-glucanases (EGs) break recurrently the glycosidic bonds inside the amorphous part of the substrate creating new attack sites for the CBHs. The products of cellobiohydrolases and endoglucanases are able to inhibit the activities of their own enzymes, so finally, beta-glucosidases (BGLs) hydrolyze unconfined cellobiose and various soluble cellodextrins into glucose monomers. The efficient hydrolysis of cellulose requires the composition of a complete and balanced cellulase, with all components of the cellulase co-acting the enzymatic hydrolysis of cellulose. Synergy is used to describe the ability of collaboration between enzymes. [4] [5] [6] [7] [8]For my experiments, the enzymes of TlCel5A and TlCel6A were combined at different ratios, and the commercial β-glucosidase from Aspergillus fumigatu (Sigma-Aldrich) was added at the concentration of 10% (mol β-glucosidase/mol total enzyme) to hydrolyze cellobiose to glucose finally. When using Avicel, phosphoric acid swollen cellulose (PASC) or steam-exploded corn straw (SECS) as the substrate, combination of TlCel5A and TlCel6A showed significant synergistic action, releasing more reduced sugars than the individual enzymes. (Line270)1. Shang B Z, Chu J W. Kinetic modeling at single-molecule resolution elucidates the mechanisms of cellulase synergy. ACS Catalysis. 2014; 4(7): 2216-2225.2. Van Dyk J S, Pletschke B I. A review of lignocellulose bioconversion using enzymatic hydrolysis and synergistic cooperation between enzymes-factors affecting enzymes, conversion and synergy. Biotechnology Advances. 2012; 30(6):1458-1480.3. Yang B, Dai Z, Shi-You Ding, et al. Enzymatic hydrolysis of cellulosic biomass. Biofuels. 2011; 2(4):421-450.4. Kamal S, Khan S U, Muhammad N, et al. Insights on heterologous expression of fungal cellulases in Pichia pastoris. Biochemistry and Molecular Biology. 2018; 3(1): 1-15.5. Olsen J P, Borch K, Westh P. Endo/exo-synergism of cellulases increases with substrate conversion. Biotechnology and bioengineering. 2017; 114(3): 696-700.6. Badino S F, Christensen S J, Kari J, et al. Exo-exo synergy between Cel6A and Cel7A from Hypocrea jecorina: Role of carbohydrate binding module and the endo-lytic character of the enzymes. Biotechnology and bioengineering. 2017; 114(8): 1639-1647.7. Boisset C, Fraschini C, Schülein M, et al. Imaging the enzymatic digestion of bacterial cellulose ribbons reveals the endo character of the cellobiohydrolase Cel6A from Humicola insolens and its mode of synergy with cellobiohydrolase Cel7A. Applied & Environmental Microbiology. 2000; 66(4): 1444-1452.8. Fang H, Zhao R, Li C, et al. Simultaneous enhancement of the beta-exo synergism and exo-exo synergism in Trichoderma reesei cellulase to increase the cellulose degrading capability. Microbial cell factories. 2019; 18(1): 1-9.Submitted filename: Response to reviewers.docxClick here for additional data file.23 Oct 2019Characterization of two thermophilic cellulases from Talaromyces leycettanusJCM12802 and their synergistic action on cellulose hydrolysisPONE-D-19-21437R1Dear Dr. Luo,We are pleased to inform you that your manuscript has been judged scientifically suitable for publication and will be formally accepted for publication once it complies with all outstanding technical requirements.Within one week, you will receive an e-mail containing information on the amendments required prior to publication. When all required modifications have been addressed, you will receive a formal acceptance letter and your manuscript will proceed to our production department and be scheduled for publication.Shortly after the formal acceptance letter is sent, an invoice for payment will follow. To ensure an efficient production and billing process, please log into Editorial Manager at https://www.editorialmanager.com/pone/, click the "Update My Information" link at the top of the page, and update your user information. If you have any billing related questions, please contact our Author Billing department directly at authorbilling@plos.org.If your institution or institutions have a press office, please notify them about your upcoming paper to enable them to help maximize its impact. If they will be preparing press materials for this manuscript, you must inform our press team as soon as possible and no later than 48 hours after receiving the formal acceptance. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information, please contact onepress@plos.org.With kind regards,Jean-Guy BerrinAcademic EditorPLOS ONEAdditional Editor Comments (optional):Reviewers' comments:1 Nov 2019PONE-D-19-21437R1Characterization of two thermophilic cellulases from Talaromyces leycettanusJCM12802 and their synergistic action on cellulose hydrolysisDear Dr. Luo:I am pleased to inform you that your manuscript has been deemed suitable for publication in PLOS ONE. Congratulations! Your manuscript is now with our production department.If your institution or institutions have a press office, please notify them about your upcoming paper at this point, to enable them to help maximize its impact. If they will be preparing press materials for this manuscript, please inform our press team within the next 48 hours. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information please contact onepress@plos.org.For any other questions or concerns, please email plosone@plos.org.Thank you for submitting your work to PLOS ONE.With kind regards,PLOS ONE Editorial Office Staffon behalf ofDr Jean-Guy BerrinAcademic EditorPLOS ONE
Authors: M A Larkin; G Blackshields; N P Brown; R Chenna; P A McGettigan; H McWilliam; F Valentin; I M Wallace; A Wilm; R Lopez; J D Thompson; T J Gibson; D G Higgins Journal: Bioinformatics Date: 2007-09-10 Impact factor: 6.937
Authors: Christina M Payne; Brandon C Knott; Heather B Mayes; Henrik Hansson; Michael E Himmel; Mats Sandgren; Jerry Ståhlberg; Gregg T Beckham Journal: Chem Rev Date: 2015-01-28 Impact factor: 60.622
Authors: Maxim Kostylev; Markus Alahuhta; Mo Chen; Roman Brunecky; Michael E Himmel; Vladimir V Lunin; John Brady; David B Wilson Journal: Biotechnol Bioeng Date: 2013-11-21 Impact factor: 4.530
Authors: Mpho S Mafa; Heinrich W Dirr; Samkelo Malgas; Rui W M Krause; Konanani Rashamuse; Brett I Pletschke Journal: Molecules Date: 2020-02-09 Impact factor: 4.411