Literature DB >> 31601223

Efficient expression vectors and host strain for the production of recombinant proteins by Yarrowia lipolytica in process conditions.

Young-Kyoung Park1, Marie Vandermies2, Paul Soudier1, Samuel Telek2, Stéphane Thomas1, Jean-Marc Nicaud3,4, Patrick Fickers2.   

Abstract

BACKGROUND: The oleaginous yeast Yarrowia lipolytica is increasingly used as an alternative cell factory for the production of recombinant proteins. Recently, regulated promoters from genes EYK1 and EYD1, encoding an erythrulose kinase and an erythritol dehydrogenase, respectively, have been identified and characterized in this yeast. Hybrid promoters up-regulated by polyols such as erythritol and erythrulose have been developed based on tandem copies of upstream activating sequences from EYK1 (UAS1EYK1) and XPR2 (encoding extracellular protease, UAS1XPR2) promoters.
RESULTS: The strength of native (pEYD1) and engineered promoters (pEYK1-3AB and pHU8EYK) was compared using the extracellular lipase CalB from Candida antarctica as a model protein and a novel dedicated host strain. This latter is engineered in polyol metabolism and allows targeted chromosomal integration. In process conditions, engineered promoters pEYK1-3AB and pHU8EYK yielded 2.8 and 2.5-fold higher protein productivity, respectively, as compared to the reference pTEF promoter. We also demonstrated the possibility of multicopy integration in the newly developed host strain. In batch bioreactor, the CalB multi-copy strain RIY406 led to a 1.6 fold increased lipase productivity (45,125 U mL-1) within 24 h as compared to the mono-copy strain.
CONCLUSIONS: The expression system described herein appears promising for recombinant extracellular protein production in Y. lipolytica.

Entities:  

Keywords:  CalB; Erythritol; Induction; Promoter; Protein secretion; Regulation; Synthetic promoter; Upstream activating sequence; Yarrowia lipolytica

Mesh:

Substances:

Year:  2019        PMID: 31601223      PMCID: PMC6785901          DOI: 10.1186/s12934-019-1218-6

Source DB:  PubMed          Journal:  Microb Cell Fact        ISSN: 1475-2859            Impact factor:   5.328


Background

The oleaginous yeast Yarrowia lipolytica is increasingly used as an alternative to model yeasts such as Saccharomyces cerevisiae or Komagataella phaffii (Pichia pastoris). for the production of recombinant proteins [1, 2]. More than one hundred heterologous proteins have already been produced at high yield, highlighting its potential utilization as a cell factory. Y. lipolytica has been also shown able to produce efficiently chemicals such as citric acid [3], itaconic acid [4], erythritol [5], erythrulose [6] and lipid for biodiesel and biojet fuel [7, 8]. In nature, Y. lipolytica can grow in environments rich in lipids and proteins due to its ability to synthesize and secrete hydrolytic enzymes such as proteases or lipases [9, 10]. Based on these metabolic features, several engineering tools such as strong promoters and efficient sorting signals, including the prepro sequence of the LIP2 gene encoding an extracellular lipase, have been developed [1, 11]. The promoter from the XPR2 gene encoding alkaline extracellular protease was the first developed for recombinant gene expression [12]. Its functional dissection led to the identification of an upstream activating sequence (UAS1XPR2), later used to construct constitutive hybrid promoters [13]. These are based on UAS1XPR2 repeats fused upstream of the minimal LEU2 promoter (mLEU2) [14, 15]. The number of UAS1XPR2 repeats was found to modulate the strength of the promoter, allowing thus a fine-tuning of gene expression. A similar strategy was also applied to design constitutive promoters derived from the TEF1 gene encoding the translation elongation factor 1α [16]. Regulated promoters derived from the LIP2 and POX2 genes encoding an extracellular lipase and an acyl-CoA oxidase, respectively, have been also developed for recombinant gene expression [17]. Although these regulated promoters delivered strong gene expression, their utilization at industrial scale is impeded by the hydrophobic nature of their inducers (i.e. triglycerides and fatty acids). Recently, we have characterized two genes, namely EYD1 and EYK1, involved in erythritol catabolic pathway [6, 18]. Gene EYD1 was found to encode an erythritol dehydrogenase able to convert erythritol to erythrulose, while gene EYK1 was suggested to encode an erythrulose kinase. Induction of EYK1 native promoter (pEYK300) is significantly increased, in a dose-dependent manner, in the presence of erythritol or erythrulose, and drastically reduced in the presence of glycerol and glucose. Moreover, we demonstrated that erythrulose is a better inducer than erythritol [19]. The dissection of the EYK1 promoter highlighted the existence of two UAS, namely UAS1EYK1 and UAS2EYK1. Using a reporter system based on yellow fluorescent protein (YFP) and mutated promoter, UAS1EYK1 was identified as essential for promoter induction by both erythritol and erythrulose. By contrast, UAS2EYK1 was found involved in repression by glucose. Synthetic promoters were constructed by addition of multiple copies of UAS1EYK1 or UAS1XPR2 upstream of the native pEYK300 promoter. These promoters yielded, respectively, 3.2 and 15.6-fold higher expression levels of YFP-encoding gene than those obtained with wild-type pEYK300 promoter [19]. Carly et al. [6, 18] found that the disruption of the EYK1 gene impairs the ability of yeast cells to fully metabolize erythritol, since an eyk1Δ mutant could only convert erythritol into erythrulose. Therefore, with such a mutant, erythritol and/or erythrulose could be used as a free inducer as demonstrated previously [19]. Promoter engineering efforts were pursued with a reporter system based on RedStar fluorescent protein [20]. It concerned the influence of UAS1EYK1 repeats and core element (EYK1, TEF) on promoter strength in wild type and eyk1Δ mutant. Based on previous results, three promoters, namely pEYK1-3AB which comprises three repeats of UAS1EYK1, pHU8EYK which comprises eight copies UAS1XPR2 from XPR2 gene and the native promoter of gene EYD1 seemed to be promising to drive the production of recombinant proteins [19, 20]. Herein, these promoters were challenged for the production in process conditions of a protein of industrial interest, the lipase CalB from Candida antarctica. For that purpose, the pro-CalB nucleic acid sequence was codon-optimized for Y. lipolytica, fused with the secretion signal from the LIP2 gene, and cloned under the control of promoters pEYD1, pEYK1-3AB, pHU8EYK, and of strong constitutive promoter pTEF used for comparison. The different CalB expression cassettes were then introduced in a novel host strain specifically developed for erythritol/erythrulose-inducible expression systems. For the different constructed strains, CalB gene expression and extracellular activity were monitored in process conditions, during cultures in bioreactor.

Methods

Media and culture conditions

Escherichia coli strains were grown at 37 °C in Luria–Bertani medium supplemented with kanamycin sulfate (50 µg mL−1). Y. lipolytica strains were grown at 28 °C in YPD medium or in YNB medium (1.7 g L−1 yeast nitrogen base without amino acids and ammonium sulfate, YNBww (BD Difco, Franklin Lakes, NJ, USA), 50 mM phosphate buffer pH 6.8 supplemented with carbon and nitrogen sources, as described in Barth and Gaillardin [21]. For YNBD medium, glucose 10 g L−1 and NH4Cl 5 g L−1 were added to YNB medium. For YNBE medium, erythritol 10 g L−1 and NH4Cl 5 g L−1 were added to YNB medium. For YNBGE medium, glycerol 10 g L−1, erythritol 10 g L−1, yeast extract 5 g L−1 (Yeast extract UF, BD Difco), soytone 5 g L−1 (Select soytone, BD Difco) were added to YNB medium. YNBG2E medium is the same as YNBGE except it contained glycerol 20 g L−1. Medium contained lysine (0.08%, w/v) and/or uracil (0.01%, w/v) to meet auxotrophic requirement. Hygromycin (200 µg mL−1) was added for transformant selection. Solid media contained agar 1.5 % (w/v). Phosphate buffered saline (PBS) contained NaCl 8 g L−1, KCl 0.2 g L−1, Na2HPO4 1.44 g L−1 and KH2PO4 0.24 g L−1. Cultures in bioreactor were inoculated at an initial optical density at 600 nm (OD600) of 0.5 with PBS washed cells from a 16-h preculture in YPD medium. Cultures in 2Mag bioREACTOR (Munich, Germany) were performed in triplicate for 48 h in 10 mL of YNBGE medium with agitation set at 800 rpm. Cultures in DASGIP bioreactor (DASbox Mini Bioreactors SR0250ODLS, Eppendorf, Hamburg, Germany) were performed in duplicate for 48 h in 150 mL of YNBG2E medium supplemented with 500 µL L−1 antifoam (Tego KS911, Evonik, Essen, Germany). Airflow was set at 1 vvm, agitation was ranged from 800 to 950 rpm to ensure a dissolved oxygen level above 20% and pH was automatically adjusted to 6.8 by addition of H3PO4 8 M or NaOH 12.5 M. Culture in Duetz deepwell plate (24-well plate with pyramidal bottom, Kühner AG, Birsfelden, Switzerland) were performed in 2 mL of YNBG2E medium for 48 h; they were inoculated with of 200 μL of a 24 h precultures carried out in 400 µL YPD in 48-well microplates (multiwell cell culture plates, flat bottom, TC-treated, VWR, Radnor, PA, USA) for 24 h.

Strains and plasmids construction

Standard molecular genetic techniques were used in this study [22]. Restriction enzymes were obtained from New England Biolabs (MA, USA). PCR amplifications were performed in an Applied Biosystems 2720 thermal cycler with GoTaq DNA polymerases (Promega, WI, USA) or Q5 High-Fidelity DNA Polymerase (New England Biolabs). PCR fragments were purified with a QIAgen Purification kit (Qiagen, Hilden, Germany) and plasmids DNA were isolated with a QIAprep Spin Miniprep kit (Qiagen). All strains and plasmids used in this study are listed in Table 1.
Table 1

Strains and plasmids used in this study

Strain (plasmid)GenotypeReferences
E. coli
 JME547 (JMP547)pUB4-Cre-Hyg[23]
 JME1046 (JMP1046)JMP62-URA3ex-pTEF[34]
 JME3267 (JMP3267)PUT lys5::URA3exThis work
 JME3739 (JMP3739)JMP62-URA3ex-pTEF-CalBThis work
 RIE124 (RIP124)PUT eyk1::URA3ex[33]
 JME4001 (JMP4001)JMP62-URA3ex-pHU8EYK-YFPUnpublished
 JME4123 (JMP4123)pUC57-pEYK1-3AB[19]
 JME4230 (JMP4230)JMP62-URA3ex-pHU8EYKThis work
 JME4243 (JMP4243)JMP62-URA3ex-pHU8EYK CalBThis work
 RIE132 (RIP132)pGEMT-easy-Cre-EYK1[33]
 JME4266 (JMP4266)JMP62-URA3ex-pEYK1-3ABThis work
 JME4365 (JMP4365)JMP62-URA3ex-pEYK1-3AB-CalBThis work
 JME4579 (JMP4579)JMP62-LYS5ex-pEYK1-3AB-CalBThis work
 JME4590 (JMP4590)JMP62-URA3ex-pEYD1-CalBThis work
 RIE279 (RIP279)JMP62-LYS5exThis work
Y. lipolytica
 JMY1212MATA ura3-302 leu2-270-LEU2-Zeta, xpr2-322, lip2Δ, lip7Δ, lip8Δ[30]
 JMY5207MATA ura3-302 leu2-270-LEU2-Zeta, xpr2-322, lip2Δ, lip7Δ, lip8Δ, lys5::URA3exThis work
 JMY7121MATA ura3-302 leu2-270-LEU2-Zeta, xpr2-322, lip2Δ, lip7Δ, lip8Δ, lys5ΔThis work
 JMY7123MATA ura3-302 leu2-270-LEU2-Zeta, xpr2-322, lip2Δ, lip7Δ, lip8Δ, lys5Δ, eyk1::URA3exThis work
 JMY7126MATA ura3-302 leu2-270-LEU2-Zeta, xpr2-322, lip2Δ, lip7Δ, lip8Δ, lys5Δ, eyk1ΔThis work
 JMY7536JMY7126 + pTEF-CalB-URA3exThis work
 JMY7539JMY7126 + pEYK1-3AB-CalB-URA3exThis work
 JMY7544JMY7126 + pHU8EYK-CalB-URA3exThis work
 JMY7548JMY7126 + pEYD1-CalB-URA3exThis work
 RIY368JMY7539 + LYS5exThis work
 RIY394JMY7536 + LYS5exThis work
 RIY406JMY7126 + pEYK1-3AB-CalB-URA3ex + pEYK1-3AB-CalB-LYS5exThis work
Strains and plasmids used in this study For the construction of JMY7126 (Fig. 1), LYS5 and EYK1 were disrupted using PUT cassettes according to Fickers et al. [23]. For LYS5 disruption, the promoter (P) and terminator (T) regions of the gene were amplified by PCR with primer pairs LYS5-P1/LYS5-P2 and LYS5-T1/LYS5-T2, respectively. Primers LYS5-P1 and LYS5-T2, contained sequence of NotI restriction site while primers LYS5-P2 and LYS5-T1 contained the sequence of the I-SceI restriction (Table 2). The corresponding amplicons were purified and used as a template for the second PCR step resulting PT fragment, that was subsequently cloned to pCR4Blunt-TOPO plasmid after purification (Invitrogen, CA, USA). Finally, URA3ex marker from JMP1046 was introduced at the I-SceI site of this plasmid, yielding plasmid JMP3267. The LYS5 PUT cassette obtained by NotI digestion of JMP3267 was used to transform Y. lipolytica strain JMY1212 to yield JMY5207 (Fig. 1). The disruption of LYS5 was verified by auxotrophy check on YNBD and YNBD-lysine. In that strain, URA3ex marker was rescued by transient expression of Cre recombinase using the replicative plasmid JMP547 as described previously [23]. In the resulting strain JMY7121, EYK1 was disrupted using a PUT cassette obtained from plasmid RIE124 by NotI digestion. The disruption of EYK1 was verified by colony PCR with primers pair preTEYK Fw/postPEYK Rv and growth on YNBD-lysine and YNBE-lysine. This yielded to strain JMY7123 that was further transformed with plasmid RIE132 in order to excise the URA3ex marker. This yielded to the final strain JMY7126 (Table 1, Fig. 1). The loss of the replicative plasmid was checked by replica plating on YPD supplemented or not with hygromycin for JME547, or on YNBD and YNBE for RIE132. To restore LYS5 prototrophy, strains were transformed with the expression cassette of plasmid RIE279 obtained by NotI digestion, and gene integration was verified by colony PCR using primer LPR-R and LYS5PR.
Fig. 1

Construction of Y. lipolytica strain JMY7126. The auxotrophic strain JMY1212 [27] was used as parental strain. LYS5 and EYK1 genes were successively disrupted with the corresponding purified disruption cassette obtained from JMP3267 and RIP124 by NotI digestion, respectively. URA3ex auxotrophy marker was excised from strains using Cre-Hyg or Cre-EYK1 replicative plasmids (JME547 and RIE132, respectively) as described in [23, 33]

Table 2

Primers used in this study

PrimersSequence (5′ to 3′)Restriction site/utilisation
LYS5-P1ATAAGAATGCGGCCGCCGACTAAATTTCGACCCACNotI, LYS5 disruption
LYS5-P2CGATTACCCTGTTATCCCTAGCGTAACTCGCTACTAGGCCGCCACCI-SceI, LYS5 disruption
LYS5-T1CGTAGGGATAACAGGGTAATATAGCGTAACTATAACGGTCCTAAGGTAGCGAAGGCGTTGGTGCTCTCTCGGAAGTAGI-SceI, LYS5 disruption
LYS5-T2ATAGTTTAGCGGCCGCAAAAATGTCCGCCATTGAGTGTTGNotI, LYS5 disruption
LPR-RGCTAGATAGAGTCGAGAATTACCCTGLYS5 prototrophy
LYS5PRTCGGTGCGTGTGAAAGACACLYS5 prototrophy
preTEYK FwGTGTTTGACATTTTGTTTTGTGTGAGT Verification of EYK1 disruption
postPEYK RvTACACACTCACACTCACCAGAACATC Verification of EYK1 disruption
ClaI-pEYD1-FwCCCATCGATGGAAACCTTAATAGGAGACTACTTCCpEYD1 cloning
no AvrII-pEYD1-FwCCTCGTGTCCGGGCTAGGGCAGAAACAGCTCpEYD1 cloning, pEYD1 verification
no AvrII-pEYD1-RevGAGCTGTTTCTGCCCTAGCCCGGACACGAGGpEYD1 cloning
BamHI-pEYD1-RevTGTGTATGTGTGTGTGTGTGTGTGTGTGTGTTTGpEYD1 cloning
pTEF-internal-FwTCTGGAATCTACGCTTGTTCApTEF verification
EYK300-FwGCATCTACTTTTCTCTATACTGTACGTTTCAATCTGGGpEYK1-3AB, pHU8EYK verification
CalB-prepro-FwATGAAGCTGCTGTCTCTGACCCalB verification
CalB-internal-Rev1CCACCTTAGATCGAATAGAAGGGCalB verification
CalB-RevTTAAGGGGTGACAATACCAGAACCalB verification
ACT-FTCCAGGCCGTCCTCTCCCqPCR
ACT-RGGCCAGCCATATCGAGTCGCAqPCR
CalB-internal-FwTCTCTGCTCCTTCTGTGTGGqPCR
CalB-internal-Rev2GTCGAACAGAGGTCCACAGAqPCR
Construction of Y. lipolytica strain JMY7126. The auxotrophic strain JMY1212 [27] was used as parental strain. LYS5 and EYK1 genes were successively disrupted with the corresponding purified disruption cassette obtained from JMP3267 and RIP124 by NotI digestion, respectively. URA3ex auxotrophy marker was excised from strains using Cre-Hyg or Cre-EYK1 replicative plasmids (JME547 and RIE132, respectively) as described in [23, 33] Primers used in this study The erythritol-inducible plasmids were constructed from JMP1046 by replacing the pTEF by inducible promoters (namely pEYK1-3AB, pHU8EYK1, plasmid JMP4123 and JMP4001, respectively) by digestion with ClaI and BamHI and subsequent ligation. Here, pEYK300A3B described in Trassaert et al. [19] was renamed pEYK1-3AB according to Park et al. [20]. The Y. lipolytica LIP2 pre-CalB pro-CalB gene was codon-optimized by Biocatalysts LTD, (Cardiff, UK) and synthesized by Geneart (Regensburg, Germany). The sequence of the optimized synthetic gene (15ACCYPP_1762989_LIP2-CalB-Yl-Opt) is displayed in Additional file 1: Table S1. LIP2pre-CalBpro-CalB gene (CalB) was cloned into the vectors JME1046 (pTEF), JME4266 (pEYK1-3AB) and JME4230 (pHU8EYK) at BamHI/AvrII restriction sites (Fig. 2 and Table 1). To obtain a pEYD1-CalB construct, promoter pEYK1-3AB from plasmid JMP4365 was exchanged by pEYD1 obtained by PCR on genomic DNA of Y. lipolytica using primer ClaI-pEYD1-Fw and BamHI-pEYD1-Rev and subsequent enzyme digestion with ClaI and BamHI. For the construction of plasmid JME4579, the URA3ex marker was exchanged with the LYS5ex marker by I-SceI digestion and ligation. Gene expression cassettes were obtained by NotI digestion of the corresponding plasmid and used to transform Y. lipolytica strains JMY7126 by the lithium acetate method as described previously [24].
Fig. 2

Maps of expression plasmids. a The erythritol inducible plasmids JME4230 containing pHU8EYK and JME4266 containing pEYK1-3AB. b CalB expressing plasmids JME4243 (pHU8EYK), JME4365 (pEYK1-3AB), and JME4590 (pEYD1)

Maps of expression plasmids. a The erythritol inducible plasmids JME4230 containing pHU8EYK and JME4266 containing pEYK1-3AB. b CalB expressing plasmids JME4243 (pHU8EYK), JME4365 (pEYK1-3AB), and JME4590 (pEYD1)

Analytical methods

Cell growth monitoring

Cell growth was monitored by optical density at 600 nm (OD600). 1 unit of OD600 corresponds to 0.29 g of dry cell weight (DCW).

Quantification of CalB gene expression

RNA extraction and cDNA synthesis were performed as described previously [17] on 2.2 × 107 cells of strains JMY7536, JMY7539, JMY7544, and JMY7548 after 24 h of culture in 2Mag bioREACTOR. qPCR was performed with primer pairs CalB-internal-Fw/CalB-internal-R2 and ACT-F/ACT-R (Table 2) for CalB and actin genes, respectively. CalB gene expression levels were standardized relative to the expression level of the actin gene [17]. Experiments were performed in triplicate.

Lipase activity

Lipase activity in culture supernatants was determined by monitoring the hydrolysis of para-nitrophenyl butyrate (p-NPB), according to Fickers et al. [25]. p-NPB dissolved in acetonitrile (20% v/v) was added to a final concentration of 1 mM into 100 mM phosphate buffer, pH 7.2, containing 100 mM NaCl. The resulting solution was sonicated for 2 min on ice. The reaction was initiated by addition of 20 µL of culture supernatant to 1 mL of p-NPB solution. The release of para-nitrophenol (P-NP) was monitored for 3 min at 405 nm (A405), considering the molar extinction coefficient of P-NP (εPNP) equal to 0.0148 µM−1 cm−1. When necessary, supernatant samples were diluted to obtain initial velocities below OD405 of 0.3 U min−1. All lipase activity assays were performed at least in duplicate from two independent cultures. One unit of lipase activity was defined as the amount of enzyme releasing 1 µmol p-NPB per minute at 25 °C and pH 7.2 (U mL−1). Specific lipase activity was defined as lipase activity per gram of dry cell weight (U gDCW−1). Lipase volumetric production rate was defined as lipase activity per hour of culture (U mL−1 h−1), while lipase specific production rate was defined as unit of lipase activity per gram of DCW and per hour (U gDCW−1 h−1).

Protein electrophoresis

Proteins were subjected to sodium dodecyl sulfate (SDS)-polyacrylamide gel electrophoresis (PAGE) on a Novex™ 12% Tris–Glycine Mini Gel (Thermo Fisher Scientific), according to Laemmli [26]. Four milliliter of prestained Protein Marker IV (AppliChem GmbH, Darmstadt, Germany) were used as molecular weight standards, and a supernatant sample contained 40 U of lipase in a volume 5 µL.

Carbon source concentration

Polyol concentrations in culture supernatants were determined by HPLC (Agilent 1200 series, Agilent Technologies, Santa Clara, CA, USA). Compounds were eluted from an Aminex HPX-87H column (300 × 7.8 mm, BioRad, Hercules, CA, USA) at 65 °C, using a mobile phase consisting of 5 mM H2SO4 solution at a flow rate of 0.5 mL/min. Glycerol and erythritol were detected using refractive index and erythrulose was detected using UV absorption at 210 nm. Specific glycerol uptake rate was defined as gram of glycerol per gram of DCW and hour (g gDCW−1 h−1).

Results and discussion

Construction of the host strain JMY7126 for erythritol-inducible based expression system

Yarrowia lipolytica strain JMY1212 was previously developed to target integration of an expression cassette at a zeta docking platform located at the LEU2 locus [27]. With such a strain, any variability of recombinant gene expression related to the integration locus could be avoided, which is a prerequisite for this study. Moreover, such a feature leads to precisely genetically characterized recombinant strains, which is of importance when developing an industrial chassis. Strain JMY1212 is also disrupted for gene XPR2 encoding AEP alkaline protease and for LIP2, LIP7 and LIP8 encoding the main extracellular lipases in Y. lipolytica [10, 28]. Despite strain JMY1212 has been used successfully for heterologous gene expression [27, 29–31], it suffers from several drawbacks: (i) it possesses only a single auxotrophy based on uracil metabolism (ura3), impairing thus multiple genome editions; (ii) it is able to metabolize erythritol and erythrulose, preventing thus their utilization as free inducer. To adapt the potentialities of JMY1212 to the requirements of a versatile, erythritol/erythrulose-inducible expression system, the strain was further genetically engineered. Firstly, gene LYS5 encoding saccharopine dehydrogenase [32] was disrupted with the URA3ex cassette. The resulting lysine auxotroph strain was named JMY5207 (Fig. 1). In order to use erythritol as a free inducer, it is requested to dispose of a host strain unable to metabolize this polyol. We demonstrated in a previous study that erythrulose, the first intermediate of the erythritol catabolic pathway [18] is a better inducer than erythritol [19]. Therefore, the second step of JMY1212 strain improvement was to disrupt gene EYK1. Practically, the gene was disrupted in strain JMY7121, an auxothroph derivative of JMY5207 (Fig. 1) using a PUT cassette obtained from RIP124 by NotI digestion. This yielded finally to strain JMY7126, after URA3ex marker excision in strain JMY7123. With such a strain, we obtained a useful system to generate autonomously erythrulose from low-cost erythritol, and allowing the use of these polyols as free inducers. Moreover, in that strain, a Cre-EYK1 replicative vector can be used for transient expression of Cre recombinase [33], which faster delivers transformants without the drawbacks of using Cre-Hyg (hygromycin resistance gene) vector [23]. In summary, JMY7126 contains three auxothrophies (Ura-, Lys-, Eyk-), is compatible with Cre-EYK1 (RIE132) marker rescue, and with the set of erythritol-inducible promoters deriving from pEYK1 and pEYD1 (Trassaert and Vandermies [19, 20], unpublished observations).

Construction of expression vectors and CalB production strains

In most of recombinant protein production processes, protein synthesis occurs in a growth phase decoupled manner. For that purpose, promoters based on LIP2 and POX2 genes, strongly induced by oleic acid, have been developed (pLIP2 and pPOX2) [17, 34]. The main drawback of these systems is the utilization of water-insoluble inducers, which is not convenient at large scale due to the lower mixing efficiency of industrial bioreactors. To overcome this problem, we recently developed a set of strong and tightly regulated promoters derived from EYK1 and EYD1 genes and induced by hydrophilic substances such as erythritol and erythrulose (Trassaert and Vandermies [19, 20], unpublished observations). Some of these promoters, namely pEYK1-3AB, pHU8EYK, and pEYD1, were selected for this study based on previous experiments (Trassaert and Vandermies [19, 20], unpublished observations) (Fig. 2). The industrially relevant lipase CalB from C. antarctica was used as a model protein to assess the ability of these promoters to drive protein production in process conditions (i.e. in bioreactor). For that purpose, the CalB gene sequence, together with its pro-region was codon-optimized and fused with the signal peptide of LIP2 (pre-region). With the resulting construct (preLIP2-proCalB-CalB, here after CalB, Additional file 1) different expression vectors were obtained, namely JME3739 (pTEF-CalB), JME4365 (pEYK1-3AB-CalB), JME4243 (pHU8EYK-CalB) and JME4590 (pEYD1-CalB) and JME3739 (pTEF-CalB) used for comparison. They were used to transform strain JMY7126, after NotI digestion and purification of the expression cassette. The resulting mono-copy strains, respectively JMY7536, JMY7539, JMY7544, and JMY7548, harbor a single copy of CalB expression cassette integrated at their zeta-docking platform. As stated above, the docking system prevents variability caused by random genomic integration, allowing here to compare the three selected erythritol/erythrulose-inducible promoters with the constitutive promoter pTEF used as a reference.

Comparison of erythritol-inducible promoters

CalB gene expression and protein production in function of the erythritol-inducible promoters used

As a first characterization, CalB expression were determined after 24 h (i.e. at the end of the exponential growth phase) for strains JMY7536, JMY7539, JMY7544 and JMY7548 grown in YNBGE medium in 2Mag bioREACTOR. The culture medium employed here appears more industrially relevant, as compared to defined media previously used for CalB production [30] and more generally for recombinant protein production [35]. Rather than glucose, glycerol was selected as a main carbon source since it is a cheap by-product of the biodiesel industry that has been demonstrated suitable for recombinant protein production [36-43]. Yeast extract and soytone were added at a low concentration to the culture medium to enhance cell growth and protein production. Soytone, a peptone from soy origin, efficiently replaces casein tryptone in bioprocesses mandatorily devoid of components of animal origin [44-47]. Moreover, erythritol is a perfectly affordable inducer, especially when it could be obtained in a bioprocess from glycerol with a Y. lipolytica metabolically engineered strain [5] and used in combination with a eyk1Δ derivatives that are no longer able to consume it [18, 19]. As shown in Fig. 3a, the highest expression were obtained for pEYK1-3AB and pHU8EYK. Although, the CalB expression level obtained with the two promoters were not significantly different, they were, respectively, 2.5 and 2.7-fold higher than the one obtained with pTEF considered as a strong constitutive promoter. By contrast, pEYD1 led to a similar expression level than the one obtained with pTEF.
Fig. 3

CalB gene expression level and lipase specific activity of strains JMY7536 (pTEF), JMY7539 (pEYK1-3AB), JMY7544 (pHU8EYK), and JMY7548 (pEYD1). Cells were grown at 28 °C in YNBGE medium in 2Mag bioREACTOR. Values are mean and standard deviation of triplicate experiments. a CalB gene expression level at the end of the exponential growth phase (after 24 h). Expression levels were normalized to that the one of actin. b Specific lipase activity after 48 h

CalB gene expression level and lipase specific activity of strains JMY7536 (pTEF), JMY7539 (pEYK1-3AB), JMY7544 (pHU8EYK), and JMY7548 (pEYD1). Cells were grown at 28 °C in YNBGE medium in 2Mag bioREACTOR. Values are mean and standard deviation of triplicate experiments. a CalB gene expression level at the end of the exponential growth phase (after 24 h). Expression levels were normalized to that the one of actin. b Specific lipase activity after 48 h As a further characterization, biomass and extracellular lipase activity were determined in the same experimental conditions after 48 h of growth, and the specific activities were calculated. As shown in Fig. 3b, strain JMY7539 (pEYK1-3AB) and JMY7544 (pHU8EYK) yielded to the highest lipase specific activities (2041 ± 78 and 1852 ± 487 U mgDCW−1, respectively). For those two strains, the specific enzymatic activities were, respectively, 2.8-fold and 2.5-fold higher than that obtained with strain JMY7536 (pTEF; 733 ± 88 U mgDCW−1). By contrast, specific lipase activity of strain JMY7548 (pEYD1) was 1.3-fold lower than that of strain JMY7536. The enzymatic productivities obtained here with strain JMY7539 (pEYK1-3AB) and JMY7544 (pHU8EYK) were 1.7 and 1.6-fold higher than the lipase productivity obtained with strain JMY1105 (pLIP2-LIP2) in 20-L batch fermentation [48]. The results obtained with strains JMY7539 (pEYK1-3AB) and JMY7544 (pHU8EYK) were, however, somewhat unexpected. Indeed, in previous experiments performed with fluorescent reporter system, pHU4EYK [19] and pHU8EYK (Trassaert and Vandermies, unpublished observations), bearing respectively four and eight copies of UAS1XPR2, significantly higher fluorescence level were obtained (4.9 and 9.8 fold, respectively) as compared to that obtained for pEYK1-3AB. However, these experiments were performed in microplate cultures that are known to be not representative of process conditions, notably in terms of oxygen transfer. Based on the results obtained for CalB gene expression and lipase specific activity, strain JMY7539 (pEYK1-3AB-CalB) was selected for further characterizations in batch bioreactor.

Culture of strain RIY368 in DASGIP bioreactor

To challenge the pEYK1-3AB-based expression system to process conditions, the strain RIY368, a prototroph derivative of strain JMY7539 was grown for 48 h in YNBG2E medium in DASGIP bioreactor, with pH and pO2 regulation. Samples were collected over time, and biomass together with lipase activity were determined. The exponential growth phase lasted for 12 h with specific growth rate of 0.29 ± 0.00 h−1 and final biomass of 6.96 ± 0.04 gDCW L−1 (Fig. 4, Table 3). Within the first 24 h, glycerol, the main carbon source, had been entirely consumed, and inducer (i.e. erythritol) assimilated by the cells (Additional file 2: Fig. S1). Lipase activity reached its highest titer (28,024 ± 743 U mL−1) after 24 h of culture (Fig. 4). It decreased slightly then after until the end of the culture (until 20150 ± 1060 U mL−1). Analysis of culture supernatant by SDS-PAGE clearly highlighted that CalB is the only secreted protein in those conditions (Fig. 4b). During the enzyme production phase (between 3.5 and 24 h of culture), the lipase volumetric productivity was of 1357 ± 34 U mL−1 h−1 (Table 3). Culture of strain RIY394 (pTEF-CalB prototroph) in the same experimental conditions yielded to a 6.2 fold lower lipase activity after 24 h (data not shown). Here, we demonstrated that a high CalB production level could be achieved in bioreactor by a combined strategy of codon optimization, and suitable inducible promoter and host strain use. In a previous bioreactor study, the native CalB sequence under the control of promoter POX2 had been cloned in the Y. lipolytica strain JMY1212 (parent strain of JMY7126). The resulting lipase activity was about 5 U mL−1 after 102 h of cultivation [30]. Other studies in bioreactor using K. phaffii as a host strain for CalB production under the control of methanol-inducible promoter pAOX1 yielded 83 U mL−1 in 68 h, without codon optimization [49], and 6100 U mL−1 in 110 h with codon optimization [50]. Here, about 28,000 U mL−1 of lipase CalB were obtained in 24 h. To our knowledge, this process is the most efficient identified for CalB production in yeast, and it can be safely hypothesized that such efficiency will be reflected in the production of other recombinant proteins.
Fig. 4

Dynamics of culture of strains RIY368 (mono-copy) and RIY406 (multi-copy) in DASGIP bioreactors. Cells were grown for 48 h at 28 °C in YNBG2E medium. a Growth curve and lipase activity of strains RIY368 and RIY406. Values are means and standard deviations of duplicate experiments. b SDS-PAGE gel of 5 µL of supernatant (containing 40 U of lipase CalB, sample taken at 24 h). Protein sizes are indicated on the left-hand side

Table 3

Dynamics of CalB production for DASGIP bioreactor cultures of strains RIY368 (mono-copy) and RIY406 (multi-copy)

ParametersStrains
RIY368RIY406
Specific cell growth rate (h−1)0.29 ± 0.000.27 ± 0.01
Specific glycerol uptake rate (g gDCW−1 h−1)0.37 ± 0.060.44 ± 0.00
Maximum lipase activity (U mL−1)28,024 ± 74345,125 ± 2144
Lipase volumetric production rate (U mL−1 h−1)1357 ± 342179 ± 104

Cells were grown for 48 h at 28 °C in YNBG2E medium, in DASGIP bioreactors. Displayed means and standard deviations are the result of duplicate experiments

Dynamics of culture of strains RIY368 (mono-copy) and RIY406 (multi-copy) in DASGIP bioreactors. Cells were grown for 48 h at 28 °C in YNBG2E medium. a Growth curve and lipase activity of strains RIY368 and RIY406. Values are means and standard deviations of duplicate experiments. b SDS-PAGE gel of 5 µL of supernatant (containing 40 U of lipase CalB, sample taken at 24 h). Protein sizes are indicated on the left-hand side Dynamics of CalB production for DASGIP bioreactor cultures of strains RIY368 (mono-copy) and RIY406 (multi-copy) Cells were grown for 48 h at 28 °C in YNBG2E medium, in DASGIP bioreactors. Displayed means and standard deviations are the result of duplicate experiments

Additional genome edition

Construction and screening of multi-copy CalB expressing strains

Another goal of this study was to endow the recipient strain with the possibility of additional genome editions. For that purpose an additional auxotrophy based on lysine metabolism (lys5) was introduced in strain JMY7126. Indeed, for some recombinant proteins, the process productivity could be enhanced by co-expression of specific chaperone as demonstrated for K. phaffii (see [51-53]) or by cloning an additional copy of the expression cassette [54]. To highlight this possibility of additional genome editions, strain JMY7539 (pEYK1-3AB-CalB) was transformed with the expression cassette of plasmid JMP4579 (LYS5ex-pEYK1-3AB-CalB, rescued beforehand by NotI digestion). Since the second expression cassette was integrated randomly in the yeast genome, six independent transformants were tested for their lipase activity. They were cultivated in YNBG2E medium in Duetz-System deepwell microplates, alongside with strain RIY368 (mono-copy). After 48 h of culture, supernatants were screened for lipase activity and it was found that the lipase productivity spanned over 3.2-fold of intensity (data not shown). The transformant presenting the highest specific lipase activity was named RIY406 and used for further experiments.

Culture of strain RIY406 in DASGIP bioreactor

Strain RIY406 was grown in DASGIP bioreactors under the same conditions as previously adopted for culture of mono-copy strain RIY368, in order to compare cell growth, carbon source uptake and lipase production. Cell growth kinetics of strain RIY406 was found similar to that of RIY368 (see Fig. 4 and Table 3), demonstrating that this additional recombinant gene expression did not affect cell growth capacity. Similarly to what was observed for strain RIY368, the exponential growth phase lasted for 12 h, with a specific growth rate and a final biomass of 0.27 ± 0.01 h−1 and 6.51 ± 0.02 gDCW L−1, respectively. Growth and lipase production were sustained by similar glycerol consumption in strains RIY406 and RIY368 (Additional file 2). From these data, it can be concluded that the additional metabolic load resulting from the expression of a second recombinant gene does not alter host strain metabolism. As shown in Fig. 4 and Table 3, lipase activity of RIY406 reached its highest level (45,125 ± 2144 U mL−1) after 24 h of culture, again after glycerol entire consumption and erythritol entire assimilation (Additional file 2). At the maximal value, RIY406 lipase activity was 1.6-fold higher than the one of RIY368. This result is consistent with the ratios of volumetric and specific production rates, which are both of 1.6 (Table 3). In conclusion, the addition of a second expression cassette based on lysine auxotrophy properly increases protein production without negative effect on the host strain. Such results confirm the opportunity of co-expression of two genes, based on two selection markers (URA3 and LYS5), under the control of an erythritol/erythrulose-inducible promoter in strain JMY7126.

Conclusions

An efficient expression system relies on four mains properties: it depends on the vector used to express the gene of interest, on the host strain used to produce the compound of interest, and on the production and downstream processing steps. The design of a given expression system arises from its use and intended versatility. Here, we developed an expression system suitable for recombinant protein production in the yeast Y. lipolytica. It is based on erythritol/erythrulose-inducible promoters and a dedicated host strain, JMY7126, which enables multi-copy integration of expression cassettes and prevents erythritol complete metabolization. As a proof of concept, lipase CalB was expressed in mono-copy in strain JMY7126 under the control of three types of inducible promoters. The most appropriate promoter (namely pEYK1-3AB) for the production of this given protein was selected for demonstration of multi-copy expression. Under these conditions, about 45,000 U mL−1 of lipase CalB were obtained in 24 h in batch bioreactor, which represents to date the most efficient process identified for CalB production in yeast. Process development shall expand the potentialities of the proposed expression system even further, and the combination may greatly improve the production of other recombinant proteins in Y. lipolytica. Additional file 1. Nucleic and amino acid sequence of codon optimized CalB. Bold sequences correspond to the pre sequence of the extracellular lipase Lip2p encoded by the LIP2 gene, and underlined sequences correspond to the pro CalB targeting sequence. Additional file 2. Carbon source consumption of strains RIY368 (mono-copy) and RIY406 (multi-copy). Cells were grown for 48 h at 28 °C in YNBG2E medium, in DASGIP bioreactors. Displayed means and standard deviations are the result of duplicate experiments.
  49 in total

1.  High cell density culture of Yarrowia lipolytica using a one-step feeding process.

Authors:  J W Kim; T J Park; D D Ryu; J Y Kim
Journal:  Biotechnol Prog       Date:  2000 Jul-Aug

2.  Functional analysis of upstream regulating regions from the Yarrowia lipolytica XPR2 promoter.

Authors:  Catherine Madzak; Sylvie Blanchin-Roland; Ricardo R Cordero Otero; Claude Gaillardin
Journal:  Microbiology       Date:  1999-01       Impact factor: 2.777

3.  The yeast Yarrowia lipolytica as a generic tool for molecular evolution of enzymes.

Authors:  Sophie Duquesne; Florence Bordes; Franck Fudalej; Jean-Marc Nicaud; Alain Marty
Journal:  Methods Mol Biol       Date:  2012

4.  Cleavage of structural proteins during the assembly of the head of bacteriophage T4.

Authors:  U K Laemmli
Journal:  Nature       Date:  1970-08-15       Impact factor: 49.962

5.  Evaluation of heterologous α-amylase production in two expression platforms dedicated for Yarrowia lipolytica: commercial Po1g-pYLSC (php4d) and custom-made A18-pYLTEF (pTEF).

Authors:  Ewelina Celińska; Monika Borkowska; Wojciech Białas
Journal:  Yeast       Date:  2016-01-27       Impact factor: 3.239

6.  Transcriptomics-based identification of novel factors enhancing heterologous protein secretion in yeasts.

Authors:  Brigitte Gasser; Michael Sauer; Michael Maurer; Gerhard Stadlmayr; Diethard Mattanovich
Journal:  Appl Environ Microbiol       Date:  2007-08-31       Impact factor: 4.792

7.  A new recombinant protein expression system for high-throughput screening in the yeast Yarrowia lipolytica.

Authors:  Florence Bordes; Franck Fudalej; Valérie Dossat; Jean-Marc Nicaud; Alain Marty
Journal:  J Microbiol Methods       Date:  2007-06-27       Impact factor: 2.363

8.  Multiple-copy integration in the yeast Yarrowia lipolytica.

Authors:  M T Le Dall; J M Nicaud; C Gaillardin
Journal:  Curr Genet       Date:  1994-07       Impact factor: 3.886

9.  Deciphering how LIP2 and POX2 promoters can optimally regulate recombinant protein production in the yeast Yarrowia lipolytica.

Authors:  Hosni Sassi; Frank Delvigne; Tambi Kar; Jean-Marc Nicaud; Anne-Marie Crutz-Le Coq; Sebastien Steels; Patrick Fickers
Journal:  Microb Cell Fact       Date:  2016-09-20       Impact factor: 5.328

Review 10.  Filamentous fungi-like secretory pathway strayed in a yeast system: peculiarities of Yarrowia lipolytica secretory pathway underlying its extraordinary performance.

Authors:  Ewelina Celińska; Jean-Marc Nicaud
Journal:  Appl Microbiol Biotechnol       Date:  2018-10-23       Impact factor: 4.813

View more
  5 in total

1.  A Single-Component Blue Light-Induced System Based on EL222 in Yarrowia lipolytica.

Authors:  Zhiqian Wang; Yunjun Yan; Houjin Zhang
Journal:  Int J Mol Sci       Date:  2022-06-06       Impact factor: 6.208

2.  Impact of overproduced heterologous protein characteristics on physiological response in Yarrowia lipolytica steady-state-maintained continuous cultures.

Authors:  Paulina Korpys-Woźniak; Piotr Kubiak; Wojciech Białas; Ewelina Celińska
Journal:  Appl Microbiol Biotechnol       Date:  2020-10-06       Impact factor: 4.813

3.  Comprehensive comparison of Yarrowia lipolytica and Pichia pastoris for production of Candida antarctica lipase B.

Authors:  Chrispian W Theron; Marie Vandermies; Samuel Telek; Sebastien Steels; Patrick Fickers
Journal:  Sci Rep       Date:  2020-02-03       Impact factor: 4.379

4.  Identifying carbohydrate-active enzymes of Cutaneotrichosporon oleaginosus using systems biology.

Authors:  Tobias Fuchs; Felix Melcher; Zora Selina Rerop; Jan Lorenzen; Pariya Shaigani; Dania Awad; Martina Haack; Sophia Alice Prem; Mahmoud Masri; Norbert Mehlmer; Thomas B Brueck
Journal:  Microb Cell Fact       Date:  2021-10-28       Impact factor: 5.328

5.  A unique, newly discovered four-member protein family involved in extracellular fatty acid binding in Yarrowia lipolytica.

Authors:  Djamila Onésime; Léa Vidal; Stéphane Thomas; Céline Henry; Véronique Martin; Gwenaëlle André; Piotr Kubiak; Philippe Minard; Ewelina Celinska; Jean-Marc Nicaud
Journal:  Microb Cell Fact       Date:  2022-10-01       Impact factor: 6.352

  5 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.