Literature DB >> 31245927

Silencing CDR1as enhances the sensitivity of breast cancer cells to drug resistance by acting as a miR-7 sponge to down-regulate REGγ.

Wei Yang1,2, Xiaojuan Yang2,3, Xuedong Wang2,3, Juan Gu2,3, Daoping Zhou2,4, Yueping Wang2,4,5, Bin Yin2,3, Jianmin Guo3,6, Ming Zhou3,7.   

Abstract

In our study, we aimed to investigate the role of CDR1as during competitive inhibition of miR-7 in the regulation of cisplatin chemosensitivity in breast cancer via regulating REGγ. RT-qPCR was applied to detect the expression of CDR1as and miR-7 in breast cancer tissues, breast cancer cell lines and corresponding drug-resistant cell lines. The correlation between CDR1as and miR-7 and between miR-7 and REGγ was evaluated. MCF-7-R and MDA-MB-231-R cells were selected followed by transfection of a series of mimics, inhibitors or siRNA. The effect of CDR1as on the half maximal inhibitor concentration (IC50), cisplatin sensitivity and cell apoptosis was also analysed. Furthermore, a subcutaneous xenograft nude mouse model was established to further confirm the effect of CDR1as on the chemosensitivity of breast cancer to cisplatin in vivo. Immunohistochemical staining was conducted to test the Ki-67 expression in nude mice. A positive correlation was found between the drug resistance and CDR1as expression in breast cancer. CDR1as could increase the resistance of breast cancer cells to cisplatin. miR-7 expression was low, while REGγ was highly expressed in MCF-7-R and MDA-MB-231-R cells. CDR1as competitively inhibited miR-7 and up-regulated REGγ. Overexpression of miR-7 could reverse the enhanced sensitivity of silenced CDR1as to drug-resistant breast cancer cells. Additionally, in vivo experiments demonstrated that CDR1as mediated breast cancer occurrence and its sensitivity to cisplatin. Silencing CDR1as decreased Ki-67 expression. Silencing CDR1as may inhibit the expression of REGγ by removing the competitive inhibitory effect on miR-7 and thus enhancing the sensitivity of drug-resistant breast cancer cells.
© 2019 The Authors. Journal of Cellular and Molecular Medicine published by John Wiley & Sons Ltd and Foundation for Cellular and Molecular Medicine.

Entities:  

Keywords:  CDR1as; REGγ; breast cancer; drug resistance; miR-7

Mesh:

Substances:

Year:  2019        PMID: 31245927      PMCID: PMC6652952          DOI: 10.1111/jcmm.14305

Source DB:  PubMed          Journal:  J Cell Mol Med        ISSN: 1582-1838            Impact factor:   5.310


INTRODUCTION

Breast cancer, a class of heterogeneous malignant diseases, is the second leading cause of death among women, and different factors significantly affect its treatment and prognosis, including tumour size/grade and progesterone receptor status.1, 2 Statistics revealed that 400 000 patients die from breast cancer each year, and approximately one million people are diagnosed with breast cancer around the world.3 Additionally, breast cancer is the most common cancer in Chinese women, accounting for 12.2% of the total newly diagnosed breast cancers.4 There are several factors that have been shown to induce breast cancer, including being overweight, alcohol consumption, physical inactivity, age at first birth, familial history and a long menstrual history.5, 6, 7 For treatment, neoadjuvant and systemic chemotherapy are effective in breast cancer patients.8 Furthermore, cisplatin, an alkylated compound that can cause covalent DNA adducts resulting in cell death, is widely applied in the treatment of early and metastatic breast cancer.9 However, resistance to chemotherapy remains a substantial obstacle in breast cancer treatment.10 Thus, the identification of factors associated with chemoresistance to cisplatin should enable the development of novel drugs for breast cancer treatment that do not respond to such treatment. Circular RNAs (circRNAs), a novel class of non‐coding RNA, are highly expressed in specific tissues and have a stable structure.11, 12, 13, 14 CircRNAs regulate post‐transcriptional or transcriptional gene expression by interacting with other molecules or microRNAs and potential biomarkers in several kinds of diseases, especially in cancers where they play an important role in cell proliferation, migration and invasion.15, 16, 17, 18 CDR1as (also known as ciRS‐7) acts as an oncogenic circRNAs mainly found in the human brain and is ∼1500 nucleotides in length.19 Previous evidence found that CDR1as was involved in human tumourigenesis and dysregulated in various kinds of cancers.20, 21 A recent study showed that CDR1as worked as a miR‐7 sponge/inhibitor in the embryonic zebrafish.22 In breast cancer, miR‐7 worked as a tumour suppressor through blocking invasiveness and tumourigenic potential by targeting PAK.23 REGγ (also known as PA28γ and PSME3), a nuclear protein, has been found in several kinds of human cancers, including breast cancer.24 In particular, a high expression of REGγ might result in poor prognosis of breast cancer.25 Thus, in our study, we first detected CDR1as expression in tissues and selected normal breast epithelial cells, breast cancer cells and drug‐resistant breast cancer cells to investigate the effect of CDR1as on the regulation of cisplatin chemosensitivity in breast cancer with the involvement of miR‐7 and REGγ.

MATERIALS AND METHODS

Ethical statement

The experiment was approved by an ethics committee of The Fifth People's Hospital of Wuxi, The Medical School of Jiangnan University, and all the participants signed the informed consent.

Study participants

Between January 2014 and January 2018, 90 breast cancer patients enrolled in our hospital underwent neoadjuvant chemotherapy. All patients were females with ages between 27 and 81 years old (average age: 46 years old), and their complete and definite pathological data were obtained. Among the 90 breast cancer patients, 75 patients had infiltrating ductal carcinoma, seven patients had intraductal carcinoma, five patients had infiltrating lobular carcinoma, two patients had clear cell carcinoma and one patient had mucinous adenocarcinoma. All patients underwent 2‐5 courses of preoperative vinorelbine and cisplatin (NP) chemotherapy regimen (vinorelbine 25 mg/m2 day 1 and day 8; cisplatin 75 mg/m2 day 1 and day 2 with 21 days as one cycle), and radical mastectomy was conducted after neoadjuvant chemotherapy. Breast cancer tissue samples were obtained via core needle biopsy (CNB) or incisional biopsy before chemotherapy as well as radical resection of breast cancer after chemotherapy. The efficacy of the neoadjuvant chemotherapy was evaluated according to the unified standard established by WHO. Before and after the neoadjuvant chemotherapy, all cases of CNB were examined by physical examination, coordinate mapping, breast B Ultrasound and molybdenum target to judge the curative effect. Before the neoadjuvant chemotherapy, the size of the tumour after excision was measured by B‐ultrasound, and the changes in the tumour were analysed. The curative effect was evaluated comprehensively combined with the biopsy and radical resection. The curative effect was as follows: complete remission (CR), no tumour was found by clinical means; partial remission (PR), reduction of the breast mass >50%; stable disease (SD), reduction of breast mass <50%, enlargement <25%; progressive disease (PD), enlargement of breast mass >25%; and CR + PR referred to the total effective rate. A total of 90 normal breast tissues were also collected as controls. All the breast cancer patients were first diagnosed.

Cell culture

Breast cancer cell lines (MCF‐7, SKBR‐3, MDA‐MB‐231, MDA‐MB‐468 and HCC‐1937) and normal breast epithelial cells (MCF10A) were all purchased from the Chinese Academy of Sciences Cell Bank (Shanghai, China). The corresponding drug‐resistant cell lines (MCF‐7‐R, SKBR‐3‐R, MDA‐MB‐231‐R, MDA‐MB‐468‐R and HCC‐1937‐R) were obtained from our laboratory. Breast cancer cells were cultured in RPMI 1640 culture medium containing 10% FBS and incubated in a 5% CO2 incubator at 37°C. The culture medium was changed every 3 days, and cell passage was performed after the cells reached 90% confluency. The adherent cells were detached by 0.25% trypsin, centrifuged and fresh culture medium was added for further incubation in a 5% CO2 incubator at 37°C. Breast cancer cells at the logarithmic growth phase were selected and made into 5 × 107 cell suspensions. The cell suspension (10 mL) was inoculated into a culture bottle for 24 hours followed by addition of cisplatin (the final concentration was 10 nmol/mL) for further incubation for 48 hours. After incubation, the culture medium was discarded, and new culture medium was added for further incubation for 48 hours. After repeated culture, the concentration of cisplatin was gradually increased, and cell lines tolerant to 500 nmol/mL cisplatin were finally obtained and named MCF‐7‐R, SKBR‐3‐R, MDA‐MB‐231‐R, MDA‐MB‐468‐R and HCC‐1937‐R, which were cultured in complete culture medium containing 10 nmol/mL cisplatin.

Cell grouping

MCF‐7 cells with the maximum difference of CDR1as expression and MDA‐MB‐231 cells with the minimum difference of CDR1as expression when compared with that of MCF10A cells were selected for the following experiments. After inducing drug resistance, MCF‐7‐R cells and MDA‐MB‐231‐R cells were divided into the following groups: blank (no treatment), empty plasmid, si‐CDR1as (cells transfected with the siRNA plasmid for CDR1as), CDR1as (cells transfected with the overexpression plasmid for CDR1as), negative control (NC, cells transfected with a negative control sequence of miR‐7), miR‐7 mimic (cells transfected with the miR‐7 mimic), miR‐7 inhibitor (cells transfected with the miR‐7 inhibitor) and si‐CDR1as + miR‐7 mimic (cells cotransfected with the siRNA plasmid for CDR1as and the miR‐7 mimic). Empty plasmid, siRNA interference plasmid, overexpression plasmid, the negative control sequence of miR‐7, miR‐7 mimic and miR‐7 inhibitor were purchased from Shanghai GenePharma Co., Ltd. (Shanghai, China). The cells were transfected with Lipofectamine 2000 (Invitrogen, Carlsbad, CA, USA) according to the manufacturer's instructions. The cells in each group were cultured in an incubator for 48 hours for further experiments.

Reverse transcription‐quantitative polymerase chain reaction (RT‐qPCR)

Tissues or cells were collected for total RNA extraction via TRIzol. Each sample (5 μL) was diluted 20 times with ultrapure water without the RNA enzyme, and the optical density (OD) value at 260 nm and 280 nm was recorded for determining the concentration and purity of RNA. The OD260/OD280 ratio between 1.7 and 2.1 indicated that the purity was high and could meet the needs of subsequent experimental research. The reverse transcription reaction was performed with the PCR amplifier to synthesize a cDNA template. The real‐time quantitative PCR experiment was carried out by the ABI7500 quantitative PCR instrument (PCR, ABI, Austin, TX, USA) with the reaction conditions as follows: pre‐denaturation at 95°C for 10 min, 50 cycles at 95°C for 15 s, 60°C for 1 min and 72°C for 40 s. The primers used are shown in Table 1. The data were analysed by the 2‐ΔΔCt method. The experiment was repeated three times.
Table 1

RT‐qPCR primer sequences

Primer sequences
CDR1as5′‐ACGTCTCCAGTGTGCTGA‐3′
5′‐CTTGACACAGGTGCCATC‐3′
GAPDH5′‐AAGGTGAAGGTCGGAGTCAAC‐3′
5′‐GGGGTCATTGATGGCAACAATA‐3′
miR‐75′‐TGGAAGACTAGTGATTTTGTTGT‐3′
U65′‐TGGAAGACTAGTGATTTTGTTGT‐3′

RT‐qPCR: Reverse transcription quantitative polymerase chain reaction

RT‐qPCR primer sequences RT‐qPCR: Reverse transcription quantitative polymerase chain reaction

Clonogenic assay

Cells in the logarithmic growth phase were detached with trypsin and lightly dissociated into a cell suspension using a straw. The cells were inoculated into 6‐cm culture dishes with each culture dish containing 200 cells and incubated with complete culture medium containing 10 nmol/mL cisplatin in a 5% CO2 incubator at 37°C for 2‐3 weeks. During this period, the culture medium needed no replacement, and the culture was stopped when the clone was visible to the naked eye. With the culture medium discarded, the cells were washed two times with PBS, 5 mL methyl alcohol was added and allowed to stand at room temperature for 15 min. The fixation liquid was absorbed via a vacuum pump, and the Giemsa dye solution (SIGMA, USA) was added to the cells for 30 min. After the dye solution was discarded, the culture dish was air‐dried. The number of clones was calculated directly by the naked eye and the clone formation rate was calculated.

Cell counting kit‐8 (CCK‐8)

After treatment for 48 hours, the cells were detached and inoculated into 96‐well plates at a density of 8 × 103 cells/well (200 µL in each well). After the cells adhered to the wall, they were treated with different concentrations of cisplatin (0, 0.05, 0.25, 1, 5, 10 and 20 mol/L). Three wells with cells were set for each concentration, and blank and control wells were also set. After administration of cisplatin, the plate was incubated in a 5% CO2 incubator at 37°C for 48 hours. The CCK‐8 was then performed to detect cell proliferation. With the culture medium discarded, fresh culture medium containing 10 µL CCK‐8 reagent (Beyotime Biotechnology, Shanghai, China) was added for incubation for 2 hours. Subsequently, an enzymatic marker (Bio‐Rad, USA) was used to detect the OD value at the wavelength of 450 nm. The cell survival rate was calculated and the cell growth curve was drawn. The experiment was repeated three times. The drug half maximal inhibitory concentration (IC50) was calculated by the Probit regression analysis in the SPSS software.

Flow cytometry

After treatment for 48 hours, cells were collected, and the cell density was adjusted into 1 × 106 cells/mL. The cell suspension (0.5 mL) was placed in a centrifuge tube and 1.25 µL Annexin V‐FITC (Keygen Biotech, Nanjing, China) was added for 15 min in the dark. The cells were then centrifuged at 1000 rpm for 5 min and the supernatant was discarded. The cells were then resuspended in 0.5 µL of pre‐chilled binding buffer, and 10 µL propidium iodide (PI) was added for detection via flow cytometry (BD, USA). The results were analysed as follows: left lower quadrant (Q4) represented healthy living cells, FITC‐/PI‐; right lower quadrant (Q3) represented early apoptotic cells, FITC+/PI‐; right upper quadrant (Q2) represented necrotic cells and advanced apoptotic cells, FITC+/PI+. The apoptosis rate = percentage of early apoptosis (Q3) + percentage of late apoptosis (Q2).

Western blot analysis

The total protein was extracted from the cells in each group or transplanted tumour tissue in nude mice via protein lysis buffer and quantified via the Bradford method (Thermo Fisher Scientific, Waltham, MA, USA). Protein (50 μg) was isolated for conducting sodium dodecyl sulphate polyacrylamide gel electrophoresis, which was then transferred into a polyvinylidene fluoride membrane (Millipore, Billerica, MA, USA). The membrane was blocked via 5% skim milk powder for 1 hour, and mouse anti‐human REGγ (1:1000), Bcl2 (ab32124, 1:1000), Bax (ab32503, 1:1000), Caspase3 (ab32503, 1:1000), Cleaved‐Caspase‐3 (ab32042, 1:100) and β‐actin (1:1000, Abcam) were added for incubation at 4°C overnight. All antibodies were purchased from Abcam, Cambridge, MA, USA. The membrane was washed with PBST three times for 5 min, and rabbit anti‐mouse horseradish peroxidase‐labelled second antibody (1:2000; Abcam, Cambridge, MA, USA) was added for incubation at room temperature for 2 hours. Enhanced chemiluminescence (ECL; Amersham Bioscience, Uppsala, Sweden) was then added to the membrane, and the protein bands were analysed via the Scion image analysis system (Scion Corporation, Frederick, MD, USA). The relative amount of protein was expressed as the ratio of the OD value of the target protein to the β‐actin band.

Dual luciferase reporter gene assay

The TargetScan database was used to analyse the binding sites between CDR1as and miR‐7. The dual luciferase reporter gene assay was used to verify the targeting relationship between CDR1as and miR‐7. The CDR1as linear sequence (CDR1as‐WT) was cloned into the pmirGLO vector (Promega, Madison, WI, USA), and the sites that may interact with miR‐7 were mutated to construct a mutant vector (CDR1as‐MUT). The Renilla luciferase expression vector, pRL‐TK (Takara company, Japan), was used as the control. The miR‐7 mimic sequence and miR‐7 NC sequence were cotransfected with CDR1as‐WT and CDR1as‐MUT into MCF‐7 cells. The activity of the dual luciferase was detected following the manufacturer's instructions. The experiment was repeated three times for each group. The target genes of miR‐7 were evaluated by the TargetScan database, and REGγ was selected as the direct target gene of miR‐7. The dual luciferase reporter gene assay was used to verify the targeting relationship between miR‐7 and REGγ. The full length 3'UTR of REGγ was amplified (REGγ‐WT), and the PCR product was cloned into the pmirGLO vector (Promega, Madison, WI, USA). The target gene database was used to predict the binding site between miR‐7 and the target gene, and the sequence was then mutated a specific location (REGγ‐Mut). The Renilla luciferase expression vector, pRL‐TK (Takara company, Japan), was used as the control. The miR‐7 mimic sequence and miR‐7 NC sequence were cotransfected with REGγ‐WT and REGγ‐Mut into MCF‐7 cells. The activity of dual luciferase was detected following the manufacturer's instructions. The experiment was repeated three times for each group.

Subcutaneous xenograft nude mouse model

A total of 140 female BALB/C nude mice (6 weeks old, weighing 16 ~ 21 g) were purchased from the Animal Centre of Peking Union Medical College Hospital and were raised in laminar shelves without specific pathogen conditions with constant temperature, constant humidity and regular disinfection. Bedding, drinking water and feed were replaced regularly under aseptic conditions. When the MCF‐7‐R and MDA‐MB‐231‐R cell lines were at a logarithmic growth phase, they were subcutaneously injected into the armpit of the forelimb of nude mice (0.2 mL, 5 × 106 cells). The tumour growth was monitored for 2 weeks when 120 nude mice grew nodules in the armpit of their forelimbs, suggesting the model was established successfully. A total of 120 nude mice were assigned into NC, si‐CDR1as, CDR1as, miR‐7a mimic (mice were treated with agomirs, a chemically modified miRNA for in vivo experiments, which was better than the miRNA mimic), miR‐7 inhibitor (mice were treated with antagomirs) and si‐CDR1as + miR‐7 inhibitor groups. Intraluminal radial injections were performed once a week four times (30 µg/200 µL/time). At the same time, the mice in each group were given cisplatin (10 mg/kg body weight) slowly through tail vein injections to observe the size of the tumours and the reaction to chemotherapy (3 days of continuous injections). After 2 weeks of discontinuation, a course of treatment was injected. Before each group injection, the tumour length (a) and the short diameter (b) were measured, and the tumour growth curve was drawn via V = ab2/2. Two weeks after the injections, the tumour specimens were removed under aseptic conditions. Pathological sections were taken and frozen in the refrigerator at −80°C.

Immunohistochemical staining

Sections of transplanted tumour tissues were obtained, and endogenous peroxidase was blocked with 30% H2O2. An antigen repair solution was added to the sections before boiling. After cooling for 5 min, the processes of boiling and cooling were repeated two times. After cooling at room temperature, the sections were incubated with 5% BSA at room temperature for 20 min, followed by the removal of the excess liquid. Subsequently, the sections were incubated with rabbit anti‐mouse Ki‐67 primary antibody (ab15580, 1:1000; Abcam, Cambridge, MA, USA) at 4°C overnight. The sections were incubated in biotinylated sheep anti‐rabbit IgG (ab6721; Abcam, Cambridge, MA, USA) at 37°C for 40 min. After washing with PBS, the sections were developed with diaminobenzidine (DAB; ZSGB‐Bio, Beijing, China). The Multifunctional True Color Cell Image Analysis and Management system (Media Cybernetics, Rockville, MD, USA) was applied for analysis. Three sections were selected from each sample, and three fields were selected from each section. Quantitative analysis of the images was performed with the Image‐pro Plus Software (Media Cybernetics, Rockville, MD, USA). The integral optical density (IOD) of the Ki‐67 positive staining was measured, and the IOD value was used to represent the expression of Ki‐67.

Statistical analysis

The data in our study were analysed using SPSS 22.0 software (SPSS, Chicago, IL, USA). All data are presented as the means ± standard deviation. Pairwise comparison was conducted using the least significant difference method, while multiple group comparison was performed via one‐way ANOVA. Comparison between two groups of measured data from normal distribution was conducted using Student's t test, while correlation analysis of counting data was done using spearman method. P < 0.05 indicates a significant difference.

RESULTS

Positive correlation between drug resistance and CDR1as expression in breast cancer

The CDR1as expression in breast cancer tissues and normal breast tissues before and after neoadjuvant chemotherapy was detected by RT‐qPCR. The results showed that a higher expression of CDR1as in breast cancer tissues before neoadjuvant chemotherapy than in normal breast tissues was found. After chemotherapy, 24 cases of CR, 46 cases of PR, 15 cases of SD and four cases of PD were found with a total effective rate of 77.78%. Compared with breast cancer tissues before neoadjuvant chemotherapy, the expression of CDR1as in the residual tissues after chemotherapy was higher (Figure 1A). The relationship between the expression of CDR1as before chemotherapy and the total effective rate of neoadjuvant chemotherapy was analysed by the Spearman correlation analysis. The results showed that the expression of CDR1as was negatively correlated with the efficacy of neoadjuvant chemotherapy in breast cancer patients (P < 0.05) (Figure 1B), indicating that the lower the expression of CDR1as, the better the effect of chemotherapy. Compared with the MCF10A cell line, MCF‐7, SKBR‐3, MDA‐MB‐231, MDA‐MB‐468 and HCC‐1937 cells had higher expression of CDR1as with the highest expression found in MCF‐7 cells and the lowest found in MDA‐MB‐231 cells. Thus, the two cells were selected for the following experiment (Figure 1C). Compared with MCF‐7, SKBR‐3, MDA‐MB‐231, MDA‐MB‐468 and HCC‐1937 cells, the MCF‐7‐R, SKBR‐3‐R, MDA‐MB‐231‐R, MDA‐MB‐468‐R and HCC‐1937‐R cells had elevated CDR1as expression (P < 0.05) (Figure 1C). The results suggested that CDR1as may play a role in the development of drug resistance in breast cancer.
Figure 1

Correlation analysis between drug resistance and CDR1as expression in breast cancer. Note: A, The expression of CDR1as in clinical tissues: 90 were normal breast tissues, 90 were breast cancer tissues before neoadjuvant chemotherapy, and 66 were breast cancer tissues after neoadjuvant chemotherapy; * P < 0.05 compared with normal breast tissues; # P < 0.05 compared with breast cancer tissues before neoadjuvant chemotherapy; B, The correlation between the effect of neoadjuvant chemotherapy and the expression of CDR1as by Spearman analysis; C, Expression of CDR1as in breast cancer cells and their corresponding drug‐resistant cell lines; * P < 0.05 compared with MCF10A cells; # P < 0.05 compared with the relevant breast cancer parent cells

Correlation analysis between drug resistance and CDR1as expression in breast cancer. Note: A, The expression of CDR1as in clinical tissues: 90 were normal breast tissues, 90 were breast cancer tissues before neoadjuvant chemotherapy, and 66 were breast cancer tissues after neoadjuvant chemotherapy; * P < 0.05 compared with normal breast tissues; # P < 0.05 compared with breast cancer tissues before neoadjuvant chemotherapy; B, The correlation between the effect of neoadjuvant chemotherapy and the expression of CDR1as by Spearman analysis; C, Expression of CDR1as in breast cancer cells and their corresponding drug‐resistant cell lines; * P < 0.05 compared with MCF10A cells; # P < 0.05 compared with the relevant breast cancer parent cells

CDR1as can increase the sensitivity of breast cancer‐resistant cells to cisplatin

MCF‐7‐R and MDA‐MB‐231‐R cells were transfected with si‐CDR1as and CDR1as plasmids, respectively, followed by treatment of different concentrations of cisplatin (0, 0.05 mol/L, 0.25 mol/L, 1 mol/L, 5 mol/L, 10 μmol/L and 20 mol/L). Cell proliferation was detected by the CCK‐8 assay. The drug IC50 was calculated by Probit regression analysis with the SPSS software, and the results revealed that the survival rate of each group decreased significantly with the increase of cisplatin concentration. In the blank group, the IC50 of MCF‐7‐R and MDA‐MB‐231‐R cells was 6.8 mol/L and 5.7 mol/L respectively. After transfection with si‐CDR1as, the sensitivity to cisplatin of MCF‐7‐R and MDA‐MB‐231‐R cells was increased with an IC50 of 0.76 mol/L and 0.53 mol/L, respectively, while those were decreased after transfection with CDR1as with IC50 of 16.5 mol/L and 13.3 mol/L, respectively. There was a significant difference in the IC50 between the blank group and the si‐CDR1as and CDR1as groups (P < 0.05). There was no significant difference in the cell survival rate between the empty plasmid group and the blank group (Figure 2A). The clonogenic assay results showed that the clone formation rate of MCF‐7‐R and MDA‐MB‐231‐R cells was 44.77 ± 5.52% and 33.73 ± 4.12% respectively. After transfection with si‐CDR1as, the clone formation rate of MCF‐7‐R and MDA‐MB‐231‐R cells was decreased to 24.77 ± 3.11% and 14.73 ± 2.13%, respectively, while it was increased after transfection with CDR1as with a clone formation rate of 64.77 ± 7.41% and 54.73 ± 2.65% respectively. There was no significant difference in the clone formation rate between the empty plasmid group and the blank group (Figure 2B and C).
Figure 2

Inhibition of CDR1as expression may increase the sensitivity of drug‐resistant breast cancer cells to cisplatin. Note: A, Growth curve of MCF‐7‐R and MDA‐MB‐231‐R cells treated with different concentrations of cisplatin; B, Clonogenic assay for the MCF‐7‐Rand MDA‐MB‐231‐R cells; C, Clone formation rate of MCF‐7‐R and MDA‐MB‐231‐R cells treated with different concentrations of cisplatin; D, Detection of apoptosis in MCF‐7‐R and MDA‐MB‐231‐R cells by flow cytometry; E, Apoptosis rate of MCF‐7‐R and MDA‐MB‐231‐R cells in each group; F, Grey value analysis of apoptosis‐related factors in MCF‐7‐R and MDA‐MB‐231‐R cells in each group; G, Expression of apoptosis‐related factors in MCF‐7‐R and MDA‐MB‐231‐R cells in each group; * P < 0.05 compared with the blank group

Inhibition of CDR1as expression may increase the sensitivity of drug‐resistant breast cancer cells to cisplatin. Note: A, Growth curve of MCF‐7‐R and MDA‐MB‐231‐R cells treated with different concentrations of cisplatin; B, Clonogenic assay for the MCF‐7‐Rand MDA‐MB‐231‐R cells; C, Clone formation rate of MCF‐7‐R and MDA‐MB‐231‐R cells treated with different concentrations of cisplatin; D, Detection of apoptosis in MCF‐7‐R and MDA‐MB‐231‐R cells by flow cytometry; E, Apoptosis rate of MCF‐7‐R and MDA‐MB‐231‐R cells in each group; F, Grey value analysis of apoptosis‐related factors in MCF‐7‐R and MDA‐MB‐231‐R cells in each group; G, Expression of apoptosis‐related factors in MCF‐7‐R and MDA‐MB‐231‐R cells in each group; * P < 0.05 compared with the blank group The cell apoptosis results showed that, compared with the blank group (MCF‐7‐R: 8.16 ± 0.92; MDA‐MB‐231‐R: 9.73 ± 1.03), the cell apoptosis rate was increased in the si‐CDR1as group (MCF‐7‐R: 24.13 ± 2.42; MDA‐MB‐231‐R: 31.34 ± 3.09), while it was decreased in the CDR1as group (MCF‐7‐R: 2.15 ± 0.26; MDA‐MB‐231‐R: 3.03 ± 0.32) (Figure 2D and E). Further detection of apoptosis‐related factors revealed that in the MCF‐7‐R and MDA‐MB‐231‐R cells, expression of Bax/Bcl2 and cleaved‐Caspase‐3/Caspase‐3 increased after transfection with si‐CDR1as, while their expression decreased after transfection with CDR1as (Figure 2F and G). It was suggested that inhibition of CDR1as expression could increase the sensitivity of breast cancer‐resistant cells to cisplatin.

Low expression of miR‐7 and high expression of REGγ in breast cancer‐resistant cells

Several studies have shown that circRNA can play a regulatory role as a miRNA sponge.11 CDR1as, derived from an antisense transcript of the CDR1 protein‐coding gene, contains 71 binding sites or 26 clusters corresponding to miR‐7 sites.26 The target gene of miR‐7 was evaluated using the TargetScan database, and REGγ was selected as the direct target gene of miR‐7 (Figure 3A). The dual luciferase reporter gene assay results showed that, in the wild type, compared with the REGγ‐WT + miR‐7 NC group, the luciferase activity decreased in the REGγ‐WT + miR‐7 mimic group (P < 0.05), while in the mutant, compared with the REGγ‐MUT + miR‐7 NC group, no significant difference was found in the REGγ‐MUT + miR‐7 mimic group (P > 0.05) (Figure 3B), suggesting that miR‐7 could inhibit the expression of REGγ. miR‐7 and REGγ expression in breast cancer tissues and normal breast tissues before and after neoadjuvant chemotherapy were detected by RT‐qPCR. The result showed that compared with normal breast tissues, the expression of miR‐7 decreased and the expression of REGγ was increased in breast cancer before neoadjuvant chemotherapy. Compared with breast cancer tissues before neoadjuvant chemotherapy, the expression of miR‐7 in residual tissues after chemotherapy was further reduced and the expression of REGγ was further increased (Figure 3C). Compared with MCF‐7 and MDA‐MB‐231 cells, decreased miR‐7 and increased REGγ expression were found in MCF‐7‐R and MDA‐MB‐231‐R cells (Figure 3D).
Figure 3

Expression of miR‐7 and REGγ in drug‐resistant breast cancer cells. Note: A, TargetScan predicted that REGγ was a target gene of miR‐7; B, Identification of REGγ as a target gene of miR‐7 by dual luciferase reporter gene assay; * P < 0.05 compared with the miR‐7 NC group; C, The expression of miR‐7 and REGγ in clinical tissues, 90 were normal breast tissues, 90 were breast cancer tissues before neoadjuvant chemotherapy and 66 were breast cancer tissues after neoadjuvant chemotherapy; * P < 0.05 compared with normal breast tissues; # P < 0.05 compared with breast cancer tissues before neoadjuvant chemotherapy; D, Expression of miR‐7 and REGγ in breast cancer cell lines; # P < 0.05 compared with the relevant breast cancer parent cells

Expression of miR‐7 and REGγ in drug‐resistant breast cancer cells. Note: A, TargetScan predicted that REGγ was a target gene of miR‐7; B, Identification of REGγ as a target gene of miR‐7 by dual luciferase reporter gene assay; * P < 0.05 compared with the miR‐7 NC group; C, The expression of miR‐7 and REGγ in clinical tissues, 90 were normal breast tissues, 90 were breast cancer tissues before neoadjuvant chemotherapy and 66 were breast cancer tissues after neoadjuvant chemotherapy; * P < 0.05 compared with normal breast tissues; # P < 0.05 compared with breast cancer tissues before neoadjuvant chemotherapy; D, Expression of miR‐7 and REGγ in breast cancer cell lines; # P < 0.05 compared with the relevant breast cancer parent cells

CDR1as competitively inhibits miR‐7 and up‐regulates REGγ expression

The analysis of the correlation between CDR1as and miR‐7 expression in breast cancer tissues before chemotherapy revealed that the expression of CDR1as and miR‐7 was negatively correlated (Figure 4A). In this study, we speculated that CDR1as may play a regulatory role in drug resistance of breast cancer by regulating miR‐7. The bioinformatics software, TargetScan, analysis showed that CDR1as has miR‐7 binding sites (Figure 4B). The dual luciferase reporter gene assay results showed that the miR‐7 mimic could decrease luciferase activity in the CDR1as‐Wt group, but did not affect luciferase activity in the CDR1as‐MUT group, indicating that CDR1as competitively bind miR‐7. miR‐7 and REGγ expression in MCF‐7‐R and MDA‐MB‐231‐R cells were detected by RT‐qPCR and western blot analysis (Figure 4D‐F). The result showed that compared with the blank group, increased miR‐7 and decreased REGγ expression were found after transfection of si‐CDR1as, while the opposite trend was found after transfection of CDR1as. It was further demonstrated that CDR1as could competitively inhibit miR‐7 and up‐regulate the expression of REGγ.
Figure 4

Expression of CDR1as, miR‐7 and REGγ in drug‐resistant breast cancer cells. Note: A, Analysis of the correlation between CDR1as and miR‐7 expression in breast cancer tissues by the Pearson correlation; B, Prediction of binding sites between CDR1as and miR‐7 by TargetScan; C, Identification of the interaction between CDR1as and miR‐7 by the dual luciferase reporter gene assay; * P < 0.05 compared with the miR‐7 NC group; D, Expression of CDR1as and miR‐7 in MCF‐7‐R and MDA‐MB‐231‐R cells via RT‐qPCR; E, Grey value analysis of REGγ in MCF‐7‐R and MDA‐MB‐231‐R cells; F, Expression of REGγ in MCF‐7‐R and MDA‐MB‐231‐R cells

Expression of CDR1as, miR‐7 and REGγ in drug‐resistant breast cancer cells. Note: A, Analysis of the correlation between CDR1as and miR‐7 expression in breast cancer tissues by the Pearson correlation; B, Prediction of binding sites between CDR1as and miR‐7 by TargetScan; C, Identification of the interaction between CDR1as and miR‐7 by the dual luciferase reporter gene assay; * P < 0.05 compared with the miR‐7 NC group; D, Expression of CDR1as and miR‐7 in MCF‐7‐R and MDA‐MB‐231‐R cells via RT‐qPCR; E, Grey value analysis of REGγ in MCF‐7‐R and MDA‐MB‐231‐R cells; F, Expression of REGγ in MCF‐7‐R and MDA‐MB‐231‐R cells

Inhibition of miR‐7 can reverse the enhanced sensitivity of silenced CDR1as to drug‐resistant breast cancer cells

Cell proliferation was detected by the CCK‐8 assay. The drug IC50 was calculated by the Probit regression analysis with the SPSS software, and the results revealed that the survival rate of each group decreased significantly with the increase of cisplatin concentration (Figure 5A). No significant difference was found in the IC50 between the NC and blank groups (P > 0.05). Compared with the NC group, the miR‐7 mimic group had decreased IC50, while the miR‐7 inhibitor group had increased IC50. Compared with the si‐CDR1as group, the si‐CDR1as + miR‐7 inhibitor group had increased IC50. The clonogenic assay results (Figure 5B and C) showed that no significant difference was found in the clone formation rate between the NC and blank groups (P > 0.05). Compared with the NC group, the miR‐7 mimic group had decreased clone formation rate, while the miR‐7 inhibitor group had increased clone formation rate. Compared with the si‐CDR1as group, the si‐CDR1as + miR‐7 inhibitor group had increased clone formation rate. The cell apoptosis rate results (Figure 5D and E) revealed that compared with the NC group, the miR‐7 mimic group had an increased cell apoptosis rate, while the miR‐7 inhibitor group had a decreased cell apoptosis rate. Compared with the si‐CDR1as group, the si‐CDR1as + miR‐7 inhibitor group had decreased cell apoptosis rate. Further detection of apoptosis‐related factors revealed that compared with the NC group, expression of Bax/Bcl2 and cleaved‐Caspase‐3/Caspase‐3 increased in the miR‐7 mimic group (Figure 5F and G), while their expression decreased in the miR‐7 inhibitor group. Compared with the si‐CDR1as group, the si‐CDR1as + miR‐7 inhibitor group had decreased expression of Bax/Bcl2 and cleaved‐Caspase‐3/Caspase‐3. These results suggested that inhibition of miR‐7 expression could reverse the enhanced sensitivity of silenced CDR1as to drug‐resistant breast cancer cells.
Figure 5

Overexpression of miR‐7 can reverse the enhanced sensitivity of silenced CDR1as to drug‐resistant breast cancer cells. Note: A, Growth curve of MCF‐7‐R and MDA‐MB‐231‐R cells treated with different concentrations of cisplatin; B, Clonogenic assay for the MCF‐7‐R and MDA‐MB‐231‐R cells; C, The clone formation rate of MCF‐7‐R and MDA‐MB‐231‐R cells treated with different concentrations of cisplatin; D, Detection of apoptosis in MCF‐7‐R and MDA‐MB‐231‐R cells by flow cytometry; E, Apoptosis rate of MCF‐7‐R and MDA‐MB‐231‐R cells in each group; F, Grey value analysis of apoptosis‐related factors in MCF‐7‐R and MDA‐MB‐231‐R cells in each group; G, Expression of apoptosis‐related factors in MCF‐7‐R and MDA‐MB‐231‐R cells in each group

Overexpression of miR‐7 can reverse the enhanced sensitivity of silenced CDR1as to drug‐resistant breast cancer cells. Note: A, Growth curve of MCF‐7‐R and MDA‐MB‐231‐R cells treated with different concentrations of cisplatin; B, Clonogenic assay for the MCF‐7‐R and MDA‐MB‐231‐R cells; C, The clone formation rate of MCF‐7‐R and MDA‐MB‐231‐R cells treated with different concentrations of cisplatin; D, Detection of apoptosis in MCF‐7‐R and MDA‐MB‐231‐R cells by flow cytometry; E, Apoptosis rate of MCF‐7‐R and MDA‐MB‐231‐R cells in each group; F, Grey value analysis of apoptosis‐related factors in MCF‐7‐R and MDA‐MB‐231‐R cells in each group; G, Expression of apoptosis‐related factors in MCF‐7‐R and MDA‐MB‐231‐R cells in each group

Silencing CDR1as in vivo can improve the sensitivity of drug‐resistant transplanted tumour tissues to cisplatin in breast cancer

After successful tumour xenografts in nude mice, the volume of the transplanted tumour in each group gradually increased, and the body mass gradually decreased. According to the size of the transplanted tumour, the growth curve was made (Figure 6). The result showed that the growth rate of the transplanted tumour in the CDR1as and miR‐7 inhibitor groups was significantly faster than that of the NC group, while the growth rate was lower in the si‐CDR1as and miR‐7 mimic groups when compared with that of the NC group. The volume of the transplanted tumour in the si‐CDR1as + miR‐7 inhibitor group was larger than that in the si‐CDR1as group at the same time point, and the growth rate of the transplanted tumour in the si‐CDR1as + miR‐7 inhibitor group was faster than that in the si‐CDR1as group. The results of the immunohistochemical staining showed that compared with the NC group, the CDR1as and miR‐7 inhibitor groups had higher expression of Ki‐67, while the si‐CDR1as and miR‐7 mimic groups had decreased expression of Ki‐67 (Figure 6B and C). Compared with the si‐CDR1as group, the si‐CDR1as + miR‐7 inhibitor group showed higher Ki‐67 expression. The RT‐PCR results represented that, compared with the NC group, the CDR1as and miR‐7 inhibitor groups had increased REGγ expression, while the si‐CDR1as and miR‐7 mimic groups had decreased REGγ expression (Figure 6D). Compared with the si‐CDR1as group, the si‐CDR1as + miR‐7 inhibitor group showed higher REGγ expression. It was suggested that silencing CDR1as in vivo could increase the sensitivity of drug‐resistant transplanted tumours to cisplatin in breast cancer, while inhibition of miR‐7 expression could reverse the effect of silencing CDR1as on the sensitivity of drug‐resistant transplanted tumours to cisplatin in breast cancer.
Figure 6

The effect of CDR1as on the development of breast cancer and cisplatin sensitivity in nude mice. Note: A, Changes in tumour volume in nude mice in each group; B, Immunohistochemical staining for Ki‐67; C, Expression of Ki‐67 in each group; D, Expression of REGγ in each group

The effect of CDR1as on the development of breast cancer and cisplatin sensitivity in nude mice. Note: A, Changes in tumour volume in nude mice in each group; B, Immunohistochemical staining for Ki‐67; C, Expression of Ki‐67 in each group; D, Expression of REGγ in each group

DISCUSSION

The treatment of breast cancer has been developed from the initial surgical method on local area control to multidisciplinary management, focusing on systemic treatment, thus significantly improving survival rates.27 However, the response of breast cancer patients to chemotherapy is very different, despite the initial clinical response, patients developed a certain degree of resistance.28 In our study, CDR1as was found to be highly expressed in 90 breast cancer patients. Further analysis in breast cancer cells revealed that silencing of CDR1as increased miR‐7 expression, inhibited REGγ expression and enhanced the sensitivity of drug‐resistant breast cancer cells to cisplatin. Previous evidence has shown that circRNAs are highly expressed and evolutionarily conserved across the eukaryotic tree of life, thus, indicating potential biological functions.29 Additionally, reports revealed that circRNAs may be involved in the development and progression of cancer.30, 31 First, our study found that a higher CDR1as expression was observed in breast cancer samples; CDR1as may play a role in the development of drug resistance in breast cancer, and a positive correlation was observed between drug resistance and CDR1as expression in breast cancer. Zheng et al identified more than 27 000 circRNA candidates from the sequencing data of seven human cancers, including breast cancer, gastric cancer, kidney clear cell carcinoma, prostate adenocarcinoma, bladder cancer, colorectal cancer and hepatocellular carcinoma (HCC).32 For the role of CDR1as in cancer, CDR1as was up‐regulated in HCC tissues and the knockdown of CDR1as suppressed the progression of HCC.33 Accumulating evidence reported that circRNAs play an important role in many kinds of biological processes, including cell proliferation, metastasis, migration and invasion.18, 34 In our study, we observed that inhibition of CDR1as expression may increase the sensitivity of breast cancer drug‐resistant cells to cisplatin; breast cancer cells presented decreased clone formation rate, and breast cancer cells had increased apoptosis as well as up‐regulated Bax/Bcl2 and cleaved‐Caspase‐3/Caspase‐3. In line with our results, Lei et al also revealed that knockdown of CDR1as could work as an oncogene in HCC via the suppression of HCC cell proliferation and invasion through targeting miR‐7.21 Bax/Bcl2 and cleaved‐Caspase‐3/Caspase‐3 are commonly used indicators of apoptosis.35 Interestingly, CDR1as up‐regulated the Caspase‐3 activity and apoptosis of cells, while overexpression of miR‐7a reversed CDR1as‐induced phenotypes, leading to decreased Caspase‐3 activity and apoptosis,36 which were consistent with our findings. Furthermore, we also concluded that miR‐7 expression was low, and REGγ was highly expressed in breast cancer drug‐resistant cells. miR‐7 is reported to be a tumour suppressor miRNA in various kinds of malignancies such as breast, head and neck and colon.23, 37, 38 The conclusions obtained from previous study also proved that the overexpression of miR‐7 might serve as a suitable method for the treatment of highly invasive breast cancer.39 In addition, REGγ has been found in several types of human cancer, and high expression of REGγ as correlated with metastasis and poor prognosis of breast cancer patients.25 circRNAs could regulate gene expression at different levels by interacting with different DNA, miRNA, lncRNA or proteins to modulate different kinds of cell physiological and pathological processes.40, 41 Furthermore, we also found that CDR1as competitively inhibits miR‐7 and down‐regulates REGγ expression, and inhibition of miR‐7 can reverse the enhanced sensitivity of silenced CDR1as to drug‐resistant breast cancer cells. Partly in line with our study, miR‐7 was also found to regulate cetuximab sensitivity, and lowly expressed miR‐7 was regarded as an independent prognostic factor for poor survival of patients with colorectal cancer.42 REGγ plays an important role in breast cancer through inducing proteolysis with up‐regulated expression found in breast cancer, and REGγ was negatively correlated with miR‐7‐5p.24 Ectopic expression of CDR1as may trigger midbrain brain defects, which was similar to the phenotypes discovered in the knockdown of miR‐7.29 Additionally, the expression of CDR1as was inversely related to miR‐7 expression in HCC tissues.33 This study demonstrated that CDR1as overexpression is associated with adverse chemotherapeutic effects and that CDR1as competitive inhibition of miR‐7 enhanced the sensitivity of drug‐resistant breast cancer cells to cisplatin. In addition, we found that REGγ was a direct target of the CDR1as/miR‐7 axis, and REGγ was positively associated with CDR1as expression in breast cancer samples. Based on these observations, we suggested that the aberrant CDR1as/miR‐7 axis may serve as a promising target for finding novel therapies to alleviate drug resistance in breast cancer.

CONFLICT OF INTEREST

The authors declare no potential conflict of interest.
  43 in total

1.  Risk factors for breast cancer in women residing in urban and rural areas of eastern China.

Authors:  Feng Wang; LiXiang Yu; Fei Wang; LiYuan Liu; MingMing Guo; DeZong Gao; Qiang Zhang; YuYang Li; Liang Li; QinYe Fu; ZhiGang Yu
Journal:  J Int Med Res       Date:  2015-10-16       Impact factor: 1.671

2.  Identification of the receptor tyrosine kinase AXL in breast cancer as a target for the human miR-34a microRNA.

Authors:  Mark Mackiewicz; Konrad Huppi; Jason J Pitt; Tiffany H Dorsey; Stefan Ambs; Natasha J Caplen
Journal:  Breast Cancer Res Treat       Date:  2011-08-04       Impact factor: 4.872

3.  Anti-miR-203 Upregulates SOCS3 Expression in Breast Cancer Cells and Enhances Cisplatin Chemosensitivity.

Authors:  Peng Ru; Robert Steele; Eddy C Hsueh; Ratna B Ray
Journal:  Genes Cancer       Date:  2011-07

4.  High expression of REGγ is associated with metastasis and poor prognosis of patients with breast cancer.

Authors:  Fan Chai; Yan Liang; Jiong Bi; Li Chen; Fan Zhang; Youhong Cui; Xiuwu Bian; Jun Jiang
Journal:  Int J Clin Exp Pathol       Date:  2014-10-15

Review 5.  Detection and characterization of ciRS-7: a potential promoter of the development of cancer.

Authors:  X B Zheng; M Zhang; M Q Xu
Journal:  Neoplasma       Date:  2017       Impact factor: 2.575

6.  MicroRNA-7 expression in colorectal cancer is associated with poor prognosis and regulates cetuximab sensitivity via EGFR regulation.

Authors:  Toshinaga Suto; Takehiko Yokobori; Reina Yajima; Hiroki Morita; Takaaki Fujii; Satoru Yamaguchi; Bolag Altan; Souichi Tsutsumi; Takayuki Asao; Hiroyuki Kuwano
Journal:  Carcinogenesis       Date:  2014-12-10       Impact factor: 4.944

Review 7.  Circular RNA participates in the carcinogenesis and the malignant behavior of cancer.

Authors:  Zhen-Jun Zhao; Jun Shen
Journal:  RNA Biol       Date:  2015-12-09       Impact factor: 4.652

Review 8.  Circular RNAs as potential biomarkers for cancer diagnosis and therapy.

Authors:  Fengling Wang; Adil J Nazarali; Shaoping Ji
Journal:  Am J Cancer Res       Date:  2016-06-01       Impact factor: 6.166

9.  Knockdown of the Inhibitor of Apoptosis BRUCE Sensitizes Resistant Breast Cancer Cells to Chemotherapeutic Agents.

Authors:  Jason B Garrison; Chunmin Ge; Lixiao Che; Derek A Pullum; Guang Peng; Sohaib Khan; Nira Ben-Jonathan; Jiang Wang; Chunying Du
Journal:  J Cancer Sci Ther       Date:  2015-04

10.  Overexpressed circPVT1, a potential new circular RNA biomarker, contributes to doxorubicin and cisplatin resistance of osteosarcoma cells by regulating ABCB1.

Authors:  Zhu Kun-Peng; Ma Xiao-Long; Zhang Chun-Lin
Journal:  Int J Biol Sci       Date:  2018-02-12       Impact factor: 6.580

View more
  22 in total

1.  Upregulated circRAD18 promotes tumor progression by reprogramming glucose metabolism in papillary thyroid cancer.

Authors:  Wenkuan Chen; Tingting Zhang; Yanfang Bai; Hong Deng; Fang Yang; Renjie Zhu; Yingle Chen; Zheng He; Qi Zeng; Ming Song
Journal:  Gland Surg       Date:  2021-08

Review 2.  miRNAs as therapeutic predictors and prognostic biomarkers of neoadjuvant chemotherapy in breast cancer: a systematic review and meta-analysis.

Authors:  Zhuo Zhang; Hanxu Zhang; Jiao Yu; Ling Xu; Xiaocong Pang; Qian Xiang; Qianxin Liu; Yimin Cui
Journal:  Breast Cancer Res Treat       Date:  2022-06-21       Impact factor: 4.624

3.  Curcumol enhances cisplatin sensitivity of gastric cancer: involvement of microRNA-7 and the nuclear factor-kappa B/snail family transcriptional repressor 1 axis.

Authors:  Ying Hu; Ruitong Xu; Jinxia Ma; Zhanpeng Yan; Jun Ma
Journal:  Bioengineered       Date:  2022-05       Impact factor: 6.832

4.  The Use of circRNAs as Biomarkers of Cancer.

Authors:  Carla Solé; Gartze Mentxaka; Charles H Lawrie
Journal:  Methods Mol Biol       Date:  2021

5.  Cancer-Associated circRNA-miRNA-mRNA Regulatory Networks: A Meta-Analysis.

Authors:  Shaheerah Khan; Atimukta Jha; Amaresh C Panda; Anshuman Dixit
Journal:  Front Mol Biosci       Date:  2021-05-12

Review 6.  Role of microRNA-7 in liver diseases: a comprehensive review of the mechanisms and therapeutic applications.

Authors:  Sen Han; Ting Zhang; Praveen Kusumanchi; Nazmul Huda; Yanchao Jiang; Suthat Liangpunsakul; Zhihong Yang
Journal:  J Investig Med       Date:  2020-08-24       Impact factor: 3.235

7.  Silencing CDR1as enhances the sensitivity of breast cancer cells to drug resistance by acting as a miR-7 sponge to down-regulate REGγ.

Authors:  Wei Yang; Xiaojuan Yang; Xuedong Wang; Juan Gu; Daoping Zhou; Yueping Wang; Bin Yin; Jianmin Guo; Ming Zhou
Journal:  J Cell Mol Med       Date:  2019-06-27       Impact factor: 5.310

8.  Hydrogen gas represses the progression of lung cancer via down-regulating CD47.

Authors:  Jinghong Meng; Leyuan Liu; Dongchang Wang; Zhenfeng Yan; Gang Chen
Journal:  Biosci Rep       Date:  2020-04-30       Impact factor: 3.840

9.  Circular RNA circKIF4A facilitates the malignant progression and suppresses ferroptosis by sponging miR-1231 and upregulating GPX4 in papillary thyroid cancer.

Authors:  Wenkuan Chen; Jianchang Fu; Yingle Chen; Yudong Li; Li Ning; Dou Huang; Shumei Yan; Quan Zhang
Journal:  Aging (Albany NY)       Date:  2021-06-21       Impact factor: 5.682

Review 10.  Functions and mechanisms of circular RNAs in cancer radiotherapy and chemotherapy resistance.

Authors:  Chaochu Cui; Jianbo Yang; Xiao Li; Dongling Liu; Liwu Fu; Xianwei Wang
Journal:  Mol Cancer       Date:  2020-03-14       Impact factor: 27.401

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.