Curcumol enhances cisplatin sensitivity of gastric cancer: involvement of microRNA-7 and the nuclear factor-kappa B/snail family transcriptional repressor 1 axis.

Cisplatin is a primary chemotherapeutic drug for gastric cancer (GC) patients, but the drug resistance remains the leading cause of treatment failure and high mortality. Curcumol is a bioactive sesquiterpenoid that has reportedly been linked to cisplatin sensitivity in GC. This study focuses on the exact functions of curcumol in the cisplatin sensitivity of GC cells and the molecules of action. The curcumol treatment reduced the viability and migration and enhanced cisplatin sensitivity of GC cells in a dose-dependent manner. Microarray analysis suggested that microRNA-7 (miR-7) was the most upregulated miRNA in GC cells after curcumol treatment. The Kyoto Encyclopedia of Genes and Genomes pathway enrichment analysis showed that the curcumol-affected genes, including the target genes of miR-7, were enriched in the nuclear factor-kappa B (NF-κB) pathway, whose activity was suppressed after curcumol treatment. miR-7 was found to target and suppress RELA proto-oncogene (RELA, also known as p65), a NF-κB subunit. Downregulation of miR-7 blocked the sensitizing effects of curcumol on cells to cisplatin and led to increased expression of NF-κB p65 and snail family transcriptional repressor 1 (SNAIL). Further downregulation of RELA enhanced, whereas upregulation of SNAIL suppressed the sensitivity again. In summary, this study suggests that curcumol sensitizes GC cells to cisplatin via miR-7 and the suppression of the NF-κB/SNAIL axis. The findings may offer new thoughts that curcumol in combination with cisplatin might be a useful strategy for GC management.

Highlights

Curcumol suppresses growth and migration of GC cells and sensitizes cells to cisplatin.

Curcumol upregulates miR-7 in GC cells.

Downregulation of miR-7 blocks the function of curcumol on cells.

miR-7 targets RELA to mediate the NF-κB/SNAIL signaling pathway.

RELA and SNAIL mediates the sensitivity of GC cells to cisplatin.

Introduction

Gastric cancer (GC) represents one of the most prevailing cancers and leading causes of death with over one million new diagnoses and estimated 769,000 deaths worldwide in 2020 [1]. The patientRELA and SNAIL mediates the sensitivity of GC cells to cisplatin.s prognosis in Asia was reported to be better than that in Western countries, which is possibly thanks to the active screening program or the aggressive therapeutic regimen [2]. Surgery represents the only curative treatment, and adjuvant chemotherapy and radiotherapy can enhance outcome of resectable GC with extended lymph node dissection [2]. However, patients at advanced stages are no longer suitable for surgery, and the 5-year survival rate of these patients remains low at approximately 25% following chemotherapy [3]. Cisplatin remains a primary chemo-drug for GC, especially those at advantage stages; however, the frequent drug resistance leads to relapse and poor survival [4]. Identifying novel molecules responsible for cisplatin resistance and developing promising tools to enhance the drug sensitivity are of great significance.

Curcumol, a bioactive sesquiterpenoid extracted from multiple plants from genus Curcuma, has been demonstrated with the potential to combat against cancer, microbial infections, oxidative stress, inflammation, and neurodegeneration [5]. Interestingly, curcumol has reportedly been linked to cisplatin sensitivity of GC cells [6]. However, the exact sensitizing effect of curcumol on GC cells to cisplatin and the related molecules and pathways need further validation. MicroRNAs (miRNAs) are a large class of noncoding RNAs that govern gene expression by inhibiting mRNA translation and blocking mRNA stability, and a miRNA can possibly bind to several genes and potentially affect the activity of signaling pathways [7]. Dysregulation of miRNAs and the following protein-coding genes is frequently linked to tumorigenesis [8]. The miRNA-based treatment has been reported as a promising option for GC control and the management of drug resistance as well [4,9,10]. Curcumol was found to improve the doxorubicin sensitivity of triple-negative breast cancer cells by affecting miR-181b-2-3p and ATP binding cassette subfamily C member 3 [11]. In this research, the microarray analysis identified miR-7 as the most upregulated miRNA in GC cells after curcumol administration. miR-7 was poorly expressed in doxorubicin-resistant cancer cells, and its upregulation showed potential in overcoming the chemo resistance [12]. Likewise, miR-7 enhanced cisplatin sensitivity of breast cancer [13] and bladder cancer [14]. Moreover, miR-7 was found to suppress proliferation and motility of GC cells [15]. It is reasonable to postulate that curcumol possibly enhances the cisplatin sensitivity of GC cells with the involvement of miR-7. In addition, our further bioinformatic analyses showed that curcumol-affected genes, including the target genes of miR-7, were enriched in the nuclear factor-kappa B (NF-κB) pathway. RELA proto-oncogene (RELA, also known as p65), a NF-κB subunit, was predicted as a target transcript of miR-7. The RELA/p65 is the most important subunit in NF-kB family [16]. The NF-kB RELA/p65 has been reported as an activator of multidrug resistance 1 and leads to drug resistance in cancers [16,17]. Moreover, previous reports revealed that the transcription snail family transcriptional repressor 1 (SNAIL) was upregulated by NF-κB and NF-κB also stabilized SNAIL protein [18,19]. Interestingly, the NF-κB/SNAIL axis has also been correlated with increased cisplatin resistance in cancer cells [20]. Taken together, we hypothesized that curcumol possibly reduces cisplatin resistance in GC with the potential involvement of a miR-7/NF-κB/SNAIL axis. We administrated curcumol in two GC cell lines and induced upregulation or downregulation of miR-7, NF-κB, and SNAIL to examine their roles in cell activity. We hope this study will cover the gap in the function of curcumol in cisplatin resistance in GC and offer new thoughts in GC management.

Materials and methods

Clinical samples

Thirty-three GC patients admitted into the Nanjing Jiangning TCM Hospital Affiliated to Nanjing University of Chinese Medicine from January 2015 to January 2017 were recruited into this research. All included patients were diagnosed by histopathology examination by experienced pathologists (1) and without a history of local or systemic anti-cancer treatment before surgery (2). Patients with other chronic diseases or a history of familial genetic disease (1), or the pregnant, lactating or pregnant women (2); or patients with a history of infection or immune deficiency were excluded. Among the 33 respondents, 6 patients underwent radical gastrectomy, 14 underwent radical gastrectomy and adjuvant oxaliplatin treatment, 10 underwent radical gastrectomy and adjuvant TP treatment (combined chemotherapy of paclitaxel and cisplatin), and 3 underwent palliative surgery and adjuvant TP treatment. The tumor tissues and the para-tumorous tissues (over 5 cm away) were harvested for subsequent use. This research got the approval of the Ethical Committee of the Nanjing Jiangning TCM Hospital Affiliated to Nanjing University of Chinese Medicine (Approval number: KY2015012) and conducted following the Declaration of Helsinki. All participants signed an informed consent.

Cells

A normal gastric cell line GES1 (BNCC337969) and a GC cell line AGS (BNCC338141) were procured from BeNa Culture Collection (Henan, China). GC cell lines MKN45 (1101HUM-PUMC000229), HGC27 (1101HUM-PUMC000279), and NCIN87 (1101HUM-PUMC000481) were procured from Cell Bank of Chinese Academy of Sciences (Shanghai, China). All cells were incubated in Roswell Park Memorial Institute-1640 (#11,875,119, Thermo, Scientific, Rockford, IL, USA) supplementing 10% fetal bovine serum (FBS) and 1% penicillin/streptomycin at constant 37°C in air enriched with 5% CO2 [9]. The miR-7 inhibitor, miR-7 control, small interfering (si) RNA of RELA (si-RELA) and the negative control (NC, RELA-NC), SNAIL and NC (RiboBio Co., Ltd., Guangzhou, Guangdong, China) were inserted into the pcDNA 3.1 vectors. The vectors were transfected into cells using a LipofectamineTM 2000 kit (#11,668,030, Thermo Fisher scientific) following the instruction manual. After 48 h, stably transfected cells were validated and harvested for the subsequent experiments.

Curcumol (#IC0620, racemate, purity ≥96.7%) was procured from Solarbio Science & Technology Co., Ltd. (Beijing, China). The curcumol was dissolved in anhydrous alcohol. A total of 3 × 103 MKN45/HGC27 cells were resuspended in 100 μL RPMI-1640 and cultured with 0, 20, 40, 60, 80,and 100 μM curcumol for 48 h, respectively, where 1% alcohol was used as the 0 μM treatment.

The cells were seeded in 96-well plates (6 × 103) at 37°C with 5% CO2 overnight. Thereafter, each well was filled with 10, 20, 30, 40,and 50 μg/mL cisplatin solution (P4394, Sigma-Aldrich, Merck KGaA, Darmstadt, Germany). These cells were further incubated at 37°C for 72 h for subsequent use.

Cell counting kit-8 (CCK-8) method

Transfected MKN45 and HGC27 cells (3 × 103) were cultured in 96-well plates for 96 h. Thereafter, 10 μL CCK-8 solution (CK04, Dojindo Laboratories, Kumamoto, Japan) was loaded into the wells for 1 h of incubation. Next, the optical density at 450 nm was evaluated by a microplate reader (#5670, 2016, Bio-Rad Inc., Hercules, CA, USA).

Transwell assay

MKN45 and HGC27 cells (2 × 105) were cultured in the Transwell upper chambers (Corning Glass Works, Corning, NY, USA) filled with serum-free medium. The lower chambers were filled with 500 μL 10% FBS-supplemented RPMI-1640. After 24 h of incubation at 37°C, cells migrated to the lower membrane were fixed and stained by crystal violet. The migratory cells were counted under the optical microscope (CX43, 2019, Olympus Optical Co., Ltd, Tokyo, Japan) [21].

miRNA microarray analysis

Cells were lysed in TRIzol reagent (#15596026, Thermo Fisher Scientific) to isolate total RNA. miRNA from the total RNA sample was isolated using a mirVana miRNA separation kit (AM1561, Ambion, Austin, TX, USA). The quality and concentration of the extracted miRNA were examined using a spectrophotometer (Bio-Rad Inc.) and 1% formaldehyde-agarose gel electrophoresis. miRNA expression was determined using miRNA microarray chips (Exiqon, Vedbaek, Denmark). In short, total RNA (5 μg) was subjected to Cy3 modification at the RNA 3ʹend using the T4 RNA ligase (EL0021, Thermo Fisher Scientific). This reaction was performed at 37°C for 30 min. After that, the labeled RNA was hybridized with Human miRNA Expression Microarray V4.0 (Arraystar, Rockville, MD, USA) for 24 h. The gene expression data were obtained using a GeneChipTM Scanner 3000 7 G system (#00-0210, 2008, Thermo Fisher Scientific) and analyzed by the R Language Program (Version 3.6.3, R).

Reverse transcription quantitative polymerase chain reaction (RT-qPCR)

RNA samples were extracted using the TRIzol reagent again. After concentration and quality determination using a Nanodrop spectrophotometer (Thermo Fisher Scientific), reverse transcription was performed by the PrimeScript RT master mix (RR036Q, TaKaRa Holdings Inc., Kyoto, Japan) or the Mir-X™ miRNA First-Strand Synthesis Kit (638,313, TaKaRa). Thereafter, qPCR was carried out using TB Green Premix Ex Taq (RR420Q, TaKaRa) on a 7900 HT Real-Time PCR System (2014, Applied Biosystems Inc., Foster City, CA, USA). Table 1 lists the primer sequences. GAPDH serves as the endogenous loading for mRNA, while U6 serves as the loading for miRNA. Values were calibrated according to the 2−ΔΔCt method.

Table 1.

Primer sequences for RT-qPCR

Gene	Primer sequence (5’-3’)
U6	F: CTCGCTTCGGCAGCACAT
	R: TTTGCGTGTCATCCTTGCG
GAPDH	F: GAAGGTGAAGGTCGGAGTC
	R: GAAGATGGTGATGGGATTTC
miR-7	F: TGGAAGACTAGTGATTTTG
	R: GAACATGTCTGCGTATCTC
DDX3Y	F: CGGCAGTAACTGTCCTCCACAT
	R: CTGGAGTAGGACGAGTATAGCG
WASF2	F: CAAGACACGTAAGGAAGAGTGG
	R: CACTGGGTAACTGAATTCTGCTG
MEAF6	F: CAGCCCGTCTGGCATGTTTG
	R: GCCAGTTTTGGGGGAGACAT
RELA	F: TGGCCCCTATGTGGAGATCA
	R: TCCCCACGCTGCTCTTCTAT
MYCBP	F: AGGAATGTGGCTATGGCTGG
	R: AGCACTTAGTCCACTGCTGC
ATPAF1	F: CAGTGCATCGCCAATCAGGTTCAG
	R: CGTTTCAGTTCGGCTCCAAGTCCA
MYSM1	F: GATGCAGAAGCAGCATACCA
	R: CCTCCACAGACAAATGCTCA
WLS	F: TCATGGTATTTCAGGTGTTTCG
	R: GCATGAGGAACTTGAACCTAAAA

Note: RT-qPCR, reverse transcription quantitative polymerase chain reaction; miR-7, microRNA-7; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; DDXEY, DEAD-box helicase 3 Y-linked; WASF2, WASP family member 2; MEAF6, MYST/Esa1 associated factor 6; RELA, RELA proto-oncogene; MYCBP, MYC binding protein; ATPAF1, ATP synthase mitochondrial F1 complex assembly factor 1; MYSM1, Myb like, SWIRM and MPN domains 1; WLS, Wnt ligand secretion mediator; F: forward; R, reverse.

Flow cytometry

Transfected cells were washed by PBS and centrifuged at 1,500 r/min for 5 min to discard the supernatant. Apoptosis of cells was examined using the apoptosis detection kit (C1062S, Beyotime Biotechnology Co. Ltd., Shanghai, China). In brief, cells were resuspended and adjusted to 1 × 106 cells/mL. After that, 500 μL cell suspension was reacted with 5 μL Annexin V-fluorescein isothiocyanate and 10 μL propidium iodide avoiding light exposure at 23–25°C for 10 min. After that, the apoptosis rate was analyzed using a FACS flow cytometer (FACSAria III, 2010, Becton Dickinson, NJ, USA).

Western blot analysis

Total protein was collected using radio-immunoprecipitation assay lysis buffer (Beyotime). After that, the protein sample was separated by 12% sodium dodecyl sulfate-polyacrylamide gel electrophoresis and transferred on polyvinylidene fluoride membranes (Millipore Corp., Billerica, MA, USA). After blockage in 5% nonfat milk for 1.5 h, the membranes were hybridized with the antibodies including anti-E-cadherin (1:1,000, 13–1700, Thermo Fisher Scientific), anti-Vimentin (1:2,000, MA5-11883, Thermo Fisher Scientific), anti-NF-κB (NF-κB, 1:500, ab207297, Abcam Inc., Cambridge, MA, USA), anti-SNAIL (1:1,000, ab216347, Abcam), and anti-GAPDH (glyceraldehyde-3-phosphate dehydrogenase, 1:3,000, ab8245, Abcam) at 4°C overnight. After that, the membranes were hybridized with horseradish peroxidase-labeled goat anti-mouse IgG (1:5,000, ab205719, Abcam) or goat anti-rabbit IgG (1:2,000, ab205718, Abcam) at 23–25°C for 2 h. The immunoblots were developed by the enhanced chemiluminescence kit (Bio-Rad Inc.) [22]. The Image J software (National Institutes of Health, Bethesda, MD, USA) was used for the semi-quantitative analysis for proteins.

Xenograft tumors

Sixty female BALB/c nude mice (6–9 weeks old, Shanghai Laboratory Animal Center, Chinese Academy of Sciences, Shanghai, China). Animal experiments were ratified by the Animal Ethical Committee of the Nanjing Jiangning TCM Hospital Affiliated to Nanjing University of Chinese Medicine (Approval number: 1804006) and adhered to the tenets of Guidelines for animal care and use (NIH, Bethesda, Maryland, USA). The mice were allocated into 12 groups (MKN45 and HGC27 cells injected with miR-7 control, miR-7 inhibitor, miR-7 inhibitor + RELA-NC, miR-7 inhibitor + si-RELA, si-RELA + NC, and si-RELA + SNAIL, respectively), 5 in each group. All animals were fed in specific pathogen-free animal rooms in a 12-h dark/light cycle and given feed and water freely. A total of 6 × 106 MKN45 cells resuspended in serum-free RMPI-1640 were injected into nude mice through subcutaneous injection, the injection was performed twice in two days. Ten days later, the mice were treated with 10 mg/kg cisplatin solution through an intraperitoneal injection. Thereafter, the tumor volume (V) in mice was detected every 7 d: V = 0.5 × length × width2. The mice were sacrificed by overdosed barbiturate (150 mg/kg, intraperitoneal injection) 4 weeks later. The xenograft tumors were collected, weighed, and sectioned for histological examination [23].

Fluorescence in situ hybridization (FISH)

The tumor tissues were fixed for 4 h, routinely embedded, and made into 5-μm sections. After that, the sections were rehydrated and treated with 15 mg/mL proteinase K (Exiqon, Woburn, MA, USA) for 10 min at 37°C. The miR-7 probes (Sangon Biotech Co., Ltd., Shanghai, China) were labeled with double-digoxigenin. The sections were hybridized with 500 ng/mL probe at 37°C for 18 h, incubated with the blocking agent containing 2% goat serum (Solarbio) at 23–25°C for 4 h, and then labeled using 4’, 6-diamidino-2-phenylindole (E607303, Sangon) for 1 min. The miR-7 concentration in tissues was determined using Virtua (2012, Aperio Scanscope FLGL, Aperio, Vista, CA, USA).

Bioinformatics analyses

The data were analyzed utilizing the R Language Program (version 3.6.3, R). The miRNA microarray scanning data were loaded in the edge R Package (Bioconductor, Seattle, WA, USA). Genes with differential expression were screened with |Fold Change| >2 and false discovery rate <0.01 as the criteria. A heatmap package (version 3.6.3, R) was used to produce the heatmap for genes. The median value of gene expression was examined by the Survival Program (version 3.6.3, R), according to which the patients were assigned into low- and high-expression groups. The patient’s prognosis was analyzed by the Kaplan–Meier method. Target genes of miR-7 were predicted on the StarBase system (http://starbase.sysu.edu.cn/index.php). Enriched signaling pathways were analyzed by the Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway enrichment analysis using mirPath v.3 (http://snf-515788.vm.okeanos.grnet.gr/).

Luciferase assay

The 3ʹuntranslated region of RELA containing the binding sequence with miR-7 was cloned to pmirGLO (Promega Corp., Madison, WI, USA) luciferase vectors to construct RELA wild-type (WT) reporter vectors (RELA-WT). The mutated binding sequence was established to construct mutant-type (MT) vectors (RELA-MT). HEK293T cells were incubated in 24-well plates until reaching an 80%–90% confluence. The constructed RELA-WT and RELA-MT vectors were transfected with miR-7 control or miR-7 inhibitor into the HEK293T cells. After 48 h, the activity of luciferase vectors in cells was examined by the dual-luciferase reporter gene assay system [24] (2014, Promega Corporation, Madison, WI, USA).

Immunohistochemical staining

The xenograft tumors were fixed and cut into 5-μm sections, which were dewaxed, rehydrated, and fixed on glass slides. Each slide was dropped with 3% H2O2 for 15 min and then blocked with normal goat-serum (Solarbio) at 23–25°C for 15 min. After that, the sections were reacted with the antibodies against NF-κB p65 (1:100, sc-8008, Santa Cruz Biotechnology, Santa Cruz, CA, USA) and SNAIL (1:500, ab224731, Abcam) overnight at 4°C, and then with IgG (1:2,000, ab205719, Abcam) for 15 min at 37°C. The sections were further reacted with 40 μL horseradish peroxidase-labeled streptavidin-working solution at 23–25°C for 15 min. Thereafter, the sections were counter-stained by hematoxylin, dehydrated, sealed, and observed under the microscope.

Statistical analysis

SPSS22.0 (IBM Corp. Armonk, NY, USA) was used for statistical analyses. Three replications were performed. Measurement data were presented as the mean ± standard deviation. Differences were analyzed by the t test (two groups) or by one- or two-way analysis of variance (ANOVA, over two groups). The patient’s survival was analyzed by Kaplan–Meier analysis. Pearson’s correlation analysis was used to analyze correlations between gene expression. The log rank test was applied for post-statistical analysis. *p < 0.05 was set as the cutoff value for statistically significant difference.

Results

Brief introduction

The cisplatin drug resistance remains the leading cause of treatment failure and high mortality. Curcumol is a bioactive sesquiterpenoid that has reportedly been linked to cisplatin sensitivity in GC. Microarray analysis suggested that microRNA-7 (miR-7) was the most upregulated miRNA in GC cells after curcumol treatment, and the KEGG pathway enrichment analysis showed that the curcumol-affected genes, including the target genes of miR-7, were enriched in the nuclear factor-kappa B (NF-κB) pathway. We hypothesized that curcumol possibly reduces cisplatin resistance in GC with the potential involvement of a miR-7/NF-κB/SNAIL axis. We administrated curcumol in two GC cell lines and induced upregulation or downregulation of miR-7, NF-κB, and SNAIL to examine their roles in cell activity in vitro and in vivo.

Curcumol suppresses growth and migration of GC cells and enhances cisplatin sensitivity

The GC cell lines MKN45, HGC27, AGS, and NCIN87, and normal gastric cells GES1 in good growth condition were incubated with 0, 20, 40, 60, 80, and 100 μM curcumol for 48 h. After that, the proliferation ability of cells was evaluated by the CCK-8 method. It was found that the curcumol significantly suppressed the proliferation ability of GC cell lines in a dose-dependent manner, but the curcumol showed no impact on the viability of NCIN87 cells. In addition, the MKN45 and HGC27 cells showed higher sensitivity to curcumol than the rest cells (Figure 1(a)). According to the Transwell assay, the migration ability of MKN45 and HGC27 cells was significantly suppressed by curcumol in a dose-dependent manner, but 100 μM curcumol treatment led to little changes in cell migration compared to 80 μM curcumol treatment (Figure 1(b)). Therefore, MKN45 and HGC27 cells were selected for the following experiments, with 80 μM curcumol treatment for 48 h as a standard procedure. Cells treated with 1% alcohol were used as control. To probe the impact of curcumol in the drug sensitivity of cells to cisplatin, the cells were further treated with 10, 20, 30, 40, 50 μg/mL cisplatin. The CCK-8 assay showed that the sensitivity of cells to cisplatin was significantly increased after curcumol treatment, and the proliferation of cells was suppressed at the highest degree by 40 μg/mL cisplatin treatment (Figure 1(c)). Likewise, 40 μg/mL cisplatin treatment significantly suppressed the migration ability of MKN45 and HGC27 cells, and the curcumol treatment enhanced the inhibitory property of cisplatin on cell migration (Figure 1(d)). Collectively, these results suggest that curcumol suppresses growth and migration and increases the cisplatin sensitivity of cells.

Figure 1.

Curcumol suppresses growth and migration of GC cells and enhances cisplatin sensitivity. a, proliferation activity of GC cell lines MKN45, HGC27, AGS and NCIN87 and normal gastric cells after different doses of curcumol treatment evaluated by CCK-8 method (*p < 0.05, **p < 0.01; two-way ANOVA); b, migration ability of MKN45 and HGC27 cells after curcumol treatment examined by Transwell assay (*p < 0.05, **p < 0.01; two-way ANOVA); c, proliferation activity of MKN45 and HGC27 cells after co-treatment of curcumol and cisplatin evaluated by CCK-8 method (*#p < 0.05, **##p < 0.01; two-way ANOVA; * vs. 1% alcohol; * vs. the previous dose of curcumol); d, migration of MKN45 and HGC27 cells after co-treatment of curcumol and cisplatin examined by Transwell assay (*#p < 0.05, **##p < 0.01; two-way ANOVA; * vs. 1% alcohol; * vs. the previous dose of curcumol).

Curcumol upregulates miR-7 in GC cells

We next explored the potential molecules involved. The miRNA microarray analysis was performed to identify key miRNAs affected by curcumol treatment, and the heatmap for differentially expressed miRNAs is presented in Figure 2(a), in which miR-7 was suggested as the most upregulated miRNA by curcumol according to the Fold Change value. Thereafter, we examined miR-7 expression in cells. RT-qPCR showed that curcumol treatment significantly upregulated the miR-7 expression in cells (Figure 2(b)). Moreover, decreased miR-7 expression was detected in the tumor tissues compared to the adjacent normal tissues from clinical patients (Figure 2(c)). The patients were assigned into low- and high-miR-7-expression groups based on the median expression value. The follow-up study showed that patient’s survival was better for those with high miR-7 expression (Figure 2(d)). Moreover, the correlation between the dose of curcumol administration and the miR-7 expression in cells was further analyzed. Of note, the miR-7 expression was increased with the rise of curcumol concentrations (Figure 2(e)). We therefore speculated that miR-7 is responsible for the curcumol-mediated cisplatin sensitivity in cells.

Figure 2.

Curcumol upregulates miR-7 expression in GC cells. a, miRNAs with differential expression in cells after curcumol treatment identified by microarray analysis; b, miR-7 expression in cells after 80 μM curcumol treatment examined by RT-qPCR (*p < 0.05; two-way ANOVA); c, miR-7 expression in tumor and the paired normal tissues evaluated by RT-qPCR (n = 33; *p < 0.05; the unpaired t test); d, correlation between miR-7 expression and the patient’s survival (*p < 0.05; Kaplan-Meier analysis); e, miR-7 expression in MKN45 and HGC27 cells after different doses of curcumol treatment examined by RT-qPCR (*p < 0.05, **p < 0.01; two-way ANOVA).

miR-7 inhibition blocks the function of curcumol in cells

To validate the accountability of miR-7 in the curcumol-mediated cisplatin sensitivity, miR-7 inhibitor was used in MKN45 and HGC27 cell lines after 80 μM curcumol, and the successful downregulation of miR-7 was detected by RT-qPCR (Figure 3(a)). Thereafter, the cells were administrated with 40 μg/mL cisplatin. The subsequent CCK-8 results suggested showed that the cell proliferation suppressed by cisplatin was recovered after miR-7 downregulation (Figure 3(b)). Likewise, the migration ability inhibited by cisplatin was increased by miR-7 inhibitor as well (Figure 3(c)). In addition to proliferation and migration, we further investigated apoptosis and levels of epithelial–mesenchymal transition (EMT)-related factors in cells. The flow cytometry showed that miR-7 inhibition reduced cell apoptosis induced by cisplatin (Figure 3(d)). Moreover, the protein level of the epithelial marker E-cadherin in cells was reduced, whereas the level of the mesenchymal marker Vimentin was increased after miR-7 inhibition (Figure 3(e)). This body of evidence suggests that miR-7 inhibition suppresses the sensitivity of cells to cisplatin.

Figure 3.

miR-7 inhibition blocks the function of curcumol in cells. a, transfection of miR-7 inhibitor in cells determined by RT-qPCR (*p < 0.05; two-way ANOVA); b, proliferation of cells evaluated by the CCK-8 method (*p < 0.05; two-way ANOVA); c, migration of cells evaluated by the Transwell assay (*p < 0.05; two-way ANOVA); d, apoptosis of cells detected by the flow cytometry (*p < 0.05; two-way ANOVA); e, E-cadherin and Vimentin protein levels in cells detected by western blot assays (*p < 0.05; two-way ANOVA).

Downregulation of miR-7 blocks the function of curcumol in cisplatin sensitization in vivo

To further validate the functions of miR-7 and curcumol in the cisplatin sensitivity, MKN45 cells treated with curcumol and transfected with miR-7 inhibitor were injected into mice, followed by cisplatin treatment. It was observed that miR-7 inhibition increased the volume of xenograft tumors formed by cells (Figure 4(a)). The tumors were collected and weighed on the 28th d after animal euthanasia. Likewise, miR-7 inhibition elevated the tumor weight that was inhibited by cisplatin (Figure 4(b)). The subsequent FISH assay suggested that the positive expression of miR-7 was lower in the tumor tissues with higher degree of cancer (Figure 4(c)). Therefore, it can be concluded that miR-7 inhibition blocks the sensitivity of MKN45 cells to cisplatin treatment in vivo.

Figure 4.

miR-7 inhibition blocks the function of curcumol in cisplatin sensitization in vivo. a, volume change of the xenograft tumors in nude mice (*p < 0.05; two-way ANOVA); b, tumor weight on the 28th d (*p < 0.05; two-way ANOVA); c, miR-7 concentration in the collected tumor tissues determined by the FISH assay.

miR-7 targets RELA to mediate the NF-κB/SNAIL signaling pathway

The microarray analysis above suggested that 14 miRNAs were significantly differentially expressed in cells after curcumol treatment. The KEGG enrichment analysis suggested that the target mRNAs of these 14 miRNAs, including the target genes of miR-7, were enriched in the NF-κB pathway (Figure 5(a)). We then speculated that miR-7 might regulate a specific gene to mediate the NF-κB pathway. We then explored the expression of eight candidate target mRNAs of miR-7 enriched in the NF-κB pathway in MKN45 cells (Figure 5(b)). RT-qPCR results presented that only the expression of RELA mRNA in cells was increased after miR-7 downregulation. Thereafter, the binding between miR-7 and RELA mRNA was confirmed by the luciferase assay. The co-transfection of miR-7 inhibitor and RELA-WT vector led to a decline in the luciferase activity in 293 T cells (Figure 5(c)). Moreover, the RELA expression was significantly elevated in the tumor tissues compared to that in the adjacent normal tissues (Figure 5(d)), which presented an inverse correlation with miR-7 (Figure 5(e)). The RELA expression in the curcumol-treated MKN45 and HGC27 cells was examined as well. RT-qPCR showed that the RELA expression in cells was decreased with the increase of curcumol concentrations (figure 5(f)). As RELA is a major subunit of NF-κB, the above results showed that miR-7 was closely relevant to the E-cadherin expression in cells. E-cadherin, NF-κB, and SNAIL compose a complex signaling network and impact each other in the process of carcinogenesis [25]. We supposed that miR-7 might regulate the NF-κB/SNAIL axis to mediate the cisplatin sensitivity of GC. After that, the NF-κB p65 and SNAIL protein levels in cells were examined. Western blot assays showed that the NF-κB p65 and SNAIL levels were declined in cells treated with curcumol but then recovered after miR-7 inhibition (Figure 5g). However, the roles of NF-κB and SNAIL need further validation.

Figure 5.

miR-7 targets RELA to mediate the NF-κB/SNAIL signaling pathway. a, the signaling pathway enriched by the target genes of miR-7 analyzed by the KEGG enrichment analysis; b, expression of the target mRNAs of miR-7 in MKN45 cells after miR-7 inhibition examined by RT-qPCR (*p < 0.05; two-way ANOVA); c, binding between miR-7 and RELA confirmed by luciferase assay (*p < 0.05; two-way ANOVA); d, mRNA expression of RELA in tumor and the adjacent tissues determined by RT-qPCR (n = 33) (*p < 0.05; the paired t test); e, correlation between miR-7 and RELA expression (*p < 0.05; Pearson’s correlation analysis); f, mRNA expression of RELA in MKN45 and HGC27 cells after curcumol treatment detected by RT-qPCR (*p < 0.05, **p < 0.01; two-way ANOVA); g, protein levels of NF-κB p65 and SNAIL in cells after curcumol and miR-7 inhibitor treatments examined by western blot analysis (*#p < 0.05; two-way ANOVA; * vs. 1% alcohol; * vs. the previous dose of curcumol).

RELA and the NF-κB/SNAIL axis mediates the sensitivity of GC cells to cisplatin in vitro

To further confirm the functions of the RELA/NF-κB/SNAIL in cisplatin sensitivity in cells, the curcumol-treated MKN45 and HGC cells were administrated with miR-7 inhibitor + si-RELA or si-RELA + SNAIL and the corresponding NC, followed by 40 μg/mL cisplatin treatment. The protein levels of NF-κB and SNAIL in cells after transfection were examined by western blot analysis. The protein levels of p65 and SNAIL enhanced by miR-7 inhibitor were suppressed by further RELA silencing, and transfection of SNAIL successfully elevated the protein level of SNAIL, though it had little effects on NF-κB (Figure 6(a)). The CCK-8 results showed that the proliferation of MKN45 and HGC27 cells, which was initially increased after miR-7 inhibition, was suppressed after further RELA silencing, but the proliferation of cells was then restored after SNAIL overexpression (Figure 6(b)). Likewise, the migration ability of cells, according to the Transwell assay results, was reduced after RELA knockdown but then restored by SNAIL upregulation (Figure 6(c)). In addition, silencing of RELA elevated the apoptosis rate of cells, but upregulation of SNAIL decreased the number of apoptotic MKN45 and HGC27 cells (Figure 6(d)). The western blot assay suggested that RELA silencing increased the E-cadherin levels, whereas decreased Vimentin levels in cells. Still, SNAIL overexpression elevated the Vimentin levels whereas reduced the E-cadherin levels in cells (Figure 6(e)).

Figure 6.

RELA and the NF-κB/SNAIL axis mediates the sensitivity of GC cells to cisplatin in vitro. a, protein levels of NF-κB p65 and SNAIL in cells detected by western blot assays (*#p < 0.05; two-way ANOVA); b, proliferation activity of cells evaluated by the CCK-8 method (*#p < 0.05; two-way ANOVA); c, migration of cells evaluated by the Transwell assay (*#p < 0.05; two-way ANOVA); d, apoptosis of cells examined by the flow cytometry (*#p < 0.05; two-way ANOVA); e, protein level of E-cadherin and Vimentin in cells detected by western blot analysis (*#p < 0.05; two-way ANOVA).  

RELA and the NF-κB/SNAIL axis mediates the sensitivity of GC cells to cisplatin in vivo

The relevance of miR-7/RELA/SNAIL to the cisplatin-resistance of cells was further determined in vivo as well. MKN45 cells transfected with miR-inhibitor + si-RELA and si-RELA + SNAIL were injected into the mice, followed by cisplatin treatment. On the 4th week, the volume of tumors showed significant difference. Downregulation of RELA suppressed the growth of xenograft tumors in vivo, whereas further upregulation of SNAIL restored the tumor growth rate (Figure 7(a)). Similar trends were found in the tumor weight. Downregulation of RELA reduced the tumor weight on the 28th day while further upregulation of SNAIL encouraged tumor growth (Figure 7(b)). Moreover, immunohistochemical staining of tumor tissues suggested that the p65 concentration was notably lower in tissues showing higher sensitivity to cisplatin (Figure 7(c)), whereas the SNAIL activity was higher in tissues showing less sensitivity to cisplatin (Figure 7(d)). These suggest that RELA blocks the inhibitory function of miR-7 in the NF-κB/SNAIL axis.

Figure 7.

RELA and the NF-κB/SNAIL axis mediates the sensitivity of GC cells to cisplatin in vivo. a, volume change of the xenograft tumors in mice (*#p < 0.05; two-way ANOVA); b, tumor weight on the 28th d (*#p < 0.05; two-way ANOVA); c, positive NF-κB p65 and SNAIL expression in the tumor tissues determined by the immunohistochemical staining.

Discussion

Incidence and deaths of GC in China alone were suggested to exceed over a half of all cases in the world due to the large population and the high smoking prevalence [26]. Although the clinical practice has witnessed significant advances, the mortality of GC remains high due to the late diagnosis and the acquired chemo-resistance that represents a major hindrance to the efficacy of the GC treatment [27]. In the present research, we report that curcumol enhances the cisplatin sensitivity of GC cells by regulating miR-7 and suppressing the RELA/NF-κB/SNAIL axis.

Natural products are excellent and boundless sources of chemical diversity triggering pharmaceutical discovery [28]. The anti-oncogenic role of the Zingiberaceae plant-derived sesquiterpenoid curcumol has been well established [29-31]. First, we found that treatment of curcumol suppressed the growth activity and migration ability of GC cell lines in a dose-dependent manner, whereas it showed little impact on the normal gastric cells. In addition, in the presence of curcumol, the suppressive effects of cisplatin on GC cell proliferation and migration were strengthened. This body of evidence suggested that curcumol plays a cisplatin-sensitizing role in GC cells, which has also been reported by Huang et al. [6]. Similarly, curcumol has been demonstrated to strengthen the anti-tumor property of metformin on the breast cancer cells and to reduce the EMT activity [32]. Likewise, curcumol was found to potentiate the doxorubicin sensitivity in breast cancer cells [11].

The study by Huang et al. demonstrated that curcumol increased cisplatin sensitivity in GC by activating the phosphatidyl inositol 3-kinase/protein kinase B (PI3K/AKT) pathway [6]. However, they only found that the changes in PI3K/AKT proteins in cells after curcumol treatment, but the exact involvement of the pathway was not examined. In this work, we focused on the potential molecules implicated in curcumol-mediated events. The microarray analysis showed that miR-7 was upregulated at the highest degree in cells after curcumol treatment. miR-7 has been recognized as a tumor inhibitor that suppresses tumor proliferation and metastasis [,33-36,37]. In this work, miR-7 inhibition was introduced in cells after curcumol treatment. Importantly, it was found that the sensitizing effects of curcumol were blocked since the proliferation and migration of MKN45 and HGC27 cells suppressed by curcumol and cisplatin were recovered when miR-7 was suppressed. Moreover, silencing of miR-7 reduced apoptosis but promoted EMT of cells under cisplatin treatment. High expression of miR-7 was found to be relevant to optimized pathological complete response of patients with breast cancer underwent chemotherapies, and miR-7 sensitized cancer cells to the chemo drugs in vitro [38]. Previous reports showed that poor miR-7 expression was linked to increased cisplatin sensitivity of breast cancer cells [13] and bladder cancer cells [14]. More relevantly, increased expression of miR-7 after CDR1as downregulation led to increased death of GC cells induced by the chemo drug Diosbulbin-B [39]. Here, we validated that miR-7 is accountable for the curcumol-mediated cisplatin sensitivity in GC cells.

The subsequent KEGG enrichment analysis suggested that the activity of the NF-κB pathway was changed in cells after curcumol treatment. Among the target mRNAs of miR-7 that were enriched on the NF-κB pathway, only RELA showed an increase in cells after miR-7 inhibition. We therefore speculated that miR-7 targets RELA to suppress the NF-κB pathway, and the binding between miR-7 and RELA was validated by luciferase assay. Interestingly, miR-7 has been found to negatively regulate RELA and reduce the stem cell property of breast cancer cells [40]. Importantly, poor miR-7 expression and while high RELA (NF-κB p65) expression has been confirmed to be linked to the carcinogenesis of GC and unfavorable prognosis in patients, leaving miR-7 as a promising tool to reduce the NF-κB-driven distant metastasis of GC cells [41,42]. In addition, RELA/NF-κB pathway activation is frequently correlated with drug resistance in cancers [43,44], including GC [45]. Since we have found that miR-7 inhibition reduced E-cadherin expression in GC cells, and the E-cadherin, NF-κB, and SNAIL compose a complex signaling network and impact each other in the process of carcinogenesis [25], we therefore examined the involvement of SNAIL in the events above. SNAIL is an important EMT-marker protein as well, indicating increased metastasis of cancer cells [46,47]. The NF-κB/SNAIL pathway rendered cisplatin resistance to lung adenocarcinoma cells [20]. In this research, miR-7 knockdown led to increased NF-κB p65 and SNAIL protein levels in GC cells. Importantly, the subsequent rescue experiments suggested that RELA downregulation suppressed, whereas SNAIL upregulation promoted the cisplatin resistance of GC cells. These results suggested that miR-7 possibly suppresses the RELA/NF-κB/SNAIL axis to enhance the cisplatin sensitivity in GC cells. Intriguingly, in concert with the results above, curcumol has been demonstrated to negatively regulate the NF-κB pathway as well [5,48].

Conclusion

In conclusion, the present study demonstrates that curcumol enhances cisplatin sensitivity of GC cells through miR-7 and the suppression of the RELA/NF-κB/SNAIL axis. This work validates that curcumol indeed plays a cisplatin-sensitizing effect in GC. The findings may shed new lights on the treatment of GC that co-treatment of curcumol and cisplatin might enhance the effectiveness of the conventional chemotherapy. The miR-7 mimic or specific inhibition of the NFκB/SNAIL axis may also help to overcome cisplatin resistance in cells.