| Literature DB >> 31182737 |
Yuhuan Jin1, Fang Liu1,2, Wei Huang1, Qi Sun1, Xianzhong Huang3.
Abstract
Arabidopsis pumila, an annual ephemeral plant, plays important roles in preventing wind and sand erosion, water and soil conservation, and microhabitat improvement in the North of Xinjiang, China. Studies of adaptive mechanisms in harsh desert environments at the genetic and genomic levels can be used to more effectively develop and protect this species. The quantitative real-time polymerase chain reaction (qRT-PCR) method is one of the essential means to achieve these goals, and the selection of an appropriate reference gene is the prerequisite for qRT-PCR. In this study, 10 candidate reference genes were identified from the full-length transcriptome data of A. pumila, and their expression stabilities under four abiotic stresses (drought, heat, cold and salt) and in seven different tissues (roots, hypocotyl, cotyledon, leaves, stems, flowers and siliques) were evaluated with four programmes geNorm, NormFinder, Bestkeeper and RefFinder. Although the most stable reference genes were variable under different treatments using different software, comprehensive ranking revealed that UEP and HAF1 under drought stress, UBQ9 and GAPDH under heat stress, UBC35 and GAPDH under cold stress, GAPDH and ACT1 under salt stress, and ACT1 and GAPDH in different tissues were the most stable reference genes. Moreover, GAPDH and UBQ9 were the most suitable reference gene combinations for all samples. The expression pattern of the K+ uptake permease gene KUP9 further validated that the selected reference genes were suitable for normalization of gene expression. The identification of reliable reference genes guarantees more accurate qRT-PCR quantification for A. pumila and facilitates functional genomics studies of ephemeral plants.Entities:
Mesh:
Substances:
Year: 2019 PMID: 31182737 PMCID: PMC6557819 DOI: 10.1038/s41598-019-44849-1
Source DB: PubMed Journal: Sci Rep ISSN: 2045-2322 Impact factor: 4.379
Description of candidate reference genes and target genes.
| Gene name | Gene symbol | Homolog locus | Gene ID | |
|---|---|---|---|---|
| Actin-1 |
| AT2G37620.1 | 2–3k.c16834/1/1406 | 0.0 |
| Actin-2 |
| AT3G18780.2 | 2–3k.c6923/1/1569 | 0.0 |
| Aldehyde dehydrogenase |
| AT3G66658.1 | 1–2k.c31292/1/2035 | 0.0 |
| Translation elongation factor |
| AT5G19510.1 | 2–3k.c8091/1/833 | e-168 |
| Histone acetyltransferase |
| AT1G32750.1 | 3–6k.c17817/1/4957 | 0.0 |
| Glyceraldehyde-3-phosphate dehydrogenase |
| AT1G13440.1 | 2–3k.c18384/1/1353 | 0.0 |
| Low expression of osmotically responsive genes 1 |
| AT1G56070.1 | 1–2k.c36904/1/2756 | 0.0 |
| Polyubiquitin 9 |
| AT5G37640.1 | 1–2k.c36785/1/1730.1 | 1e-61 |
| Ubiquitin-conjugating enzyme 35 |
| AT1G78870.1 | 1–2k.c18460/1/1770.2 | 3e-84 |
| Ubiquitin extension protein |
| AT3G52590.1 | 1–2k.c21768/1/663 | 0.0 |
| K+ uptake permease 9 |
| AT4G19960.1 | 2–3k.c27754/1/2830 | 0.0 |
Primers used in this study and their amplification efficiency and amplification characteristics.
| Genes | Primer sequence (5′-3′) | Tm (°C) | R2 | E (%) | Amplicon size (bp) |
|---|---|---|---|---|---|
|
| F: CGACAATGGAACTGGAATGGTTA | 59 | 0.997 | 0.936 | 296 |
| R: GTGCCTCGGTAAGTAGAATAGGA | 59 | ||||
|
| F: TGTGCCAATCTACGAGGGTT | 59 | 0.988 | 0.934 | 137 |
| R:TTTCCCGTTCTGCTGTTGTG | 59 | ||||
|
| F: ACAACGGCACTACTGGATCA | 59 | 0.994 | 0.920 | 224 |
| R: CCAATGCAAGCCTGTCCATT | 59 | ||||
|
| F: GCAACAATGGCCGTTACCT | 59 | 0.996 | 0.903 | 153 |
| R: ATCGCTGGGTTTCACTGGA | 59 | ||||
|
| F:CTCCCATGTTTGTTGTTGGTGTCA | 62 | 0.997 | 0.951 | 217 |
| R: CTTCCACCTCTCCAGTCCTTCATT | 62 | ||||
|
| F: TAAGTCCACGTCTAAGATCAGCA | 59 | 0.997 | 0.938 | 186 |
| R: GCCTGGTTTCTCTCTGTACTAGA | 59 | ||||
|
| F: GGCAAGAGACTGTGGAGGA | 59 | 0.999 | 0.909 | 162 |
| R: CAGCAACACGAACAACAGGA | 59 | ||||
|
| F: GAGGATCACGTCAGATTCGAG | 58 | 0.998 | 0.907 | 163 |
| R: AGTTTCCTTGATGATTCTTCGCG | 60 | ||||
|
| F: GTGCTGAGAGATGCGGATTG | 59 | 0.998 | 0.908 | 252 |
| R: CCTCTCCTCCTCCAACAGTC | 59 | ||||
|
| F: GAGGTCGAGAGCAGTGACAC | 60 | 0.998 | 0.991 | 178 |
| R: CCCTGAGCCTCAACACAAGA | 60 | ||||
|
| F: TGTTCTTTCGGCAACTGGTG | 59 | 1.000 | 0.979 | 284 |
| R: AAATCCAACCATCCCGACCT | 59 |
Figure 1Distribution of Ct values for 10 candidate reference genes across all A. pumila samples using qRT-PCR data. The solid line within each box represents the median Ct values, and boxes denote the 25th and 75th percentiles. Circles and black dots represent the mean Ct values and potential outliers, respectively.
Figure 2geNorm analysis of the stability values (M) of 10 candidate reference genes under different treatments and in different tissues. (a) Drought treatment. (b) Heat treatment. (c) Cold treatment. (d) Salt treatment. (e) Tissues. (f) All samples. The most stable genes are arranged on the right, while the least stable genes are on the left.
Figure 3Optimal number of reference genes for normalization under the test experimental conditions. geNorm was used to calculate the pairwise variation (Vn/Vn+1, n represents reference gene numbers) to evaluate the number of reference genes in each experimental group.
Expression stability values (M) of 10 candidate reference genes calculated by NormFinder.
| Rank | Drought | Heat | Cold | Salt | Tissues | All samples |
|---|---|---|---|---|---|---|
| 1 |
|
|
|
|
|
|
| Stability | 0.214 | 0.196 | 0.269 | 0.162 | 0.299 | 0.479 |
| 2 |
|
|
|
|
|
|
| Stability | 0.271 | 0.451 | 0.291 | 0.380 | 0.375 | 0.601 |
| 3 |
|
|
|
|
|
|
| Stability | 0.323 | 0.463 | 0.295 | 0.439 | 0.442 | 0.670 |
| 4 |
|
|
|
|
|
|
| Stability | 0.398 | 0.556 | 0.421 | 0.507 | 0.445 | 0.858 |
| 5 |
|
|
|
|
|
|
| Stability | 0.451 | 0.610 | 0.519 | 0.557 | 0.560 | 0.871 |
| 6 |
|
|
|
|
|
|
| Stability | 0.474 | 0.612 | 0.698 | 0.603 | 0.612 | 1.173 |
| 7 |
|
|
|
|
|
|
| Stability | 0.490 | 0.673 | 0.725 | 0.640 | 0.617 | 1.253 |
| 8 |
|
|
|
|
|
|
| Stability | 0.513 | 0.715 | 0.780 | 0.647 | 0.773 | 1.340 |
| 9 |
|
|
|
|
|
|
| Stability | 0.529 | 0.868 | 0.917 | 0.729 | 0.911 | 1.344 |
| 10 |
|
|
|
|
|
|
| Stability | 0.629 | 0.922 | 1.047 | 0.735 | 1.492 | 1.777 |
Expression stability values (M) of 10 candidate reference genes calculated by BestKeeper.
| Rank | Drought | Heat | Cold | Salt | Tissues | All samples |
|---|---|---|---|---|---|---|
| 1 |
|
|
|
|
|
|
| r value | 0.983 | 0.956 | 0.966 | 0.966 | 0.966 | 0.929 |
| 2 |
|
|
|
|
|
|
| r value | 0.980 | 0.935 | 0.896 | 0.952 | 0.965 | 0.916 |
| 3 |
|
|
|
|
|
|
| r value | 0.975 | 0.910 | 0.895 | 0.934 | 0.933 | 0.909 |
| 4 |
|
|
|
|
|
|
| r value | 0.971 | 0.901 | 0.873 | 0.919 | 0.921 | 0.901 |
| 5 |
|
|
|
|
|
|
| r value | 0.955 | 0.882 | 0.869 | 0.916 | 0.910 | 0.892 |
| 6 |
|
|
|
|
|
|
| r value | 0.950 | 0.802 | 0.862 | 0.874 | 0.878 | 0.788 |
| 7 |
|
|
|
|
|
|
| r value | 0.947 | 0.792 | 0.837 | 0.866 | 0.853 | 0.782 |
| 8 |
|
|
|
|
|
|
| r value | 0.925 | 0.775 | 0.746 | 0.846 | 0.833 | 0.751 |
| 9 |
|
|
|
|
|
|
| r value | 0.908 | 0.752 | 0.584 | 0.730 | 0.746 | 0.748 |
| 10 |
|
|
|
|
|
|
| r value | 0.871 | 0.727 | 0.001 | 0.717 | 0.001 | 0.563 |
Ranking of expression stability for the 10 candidate reference genes.
| Methods | 1 | 2 | 3 | 4 | 5 | 6 | 7 | 8 | 9 | 10 |
|---|---|---|---|---|---|---|---|---|---|---|
|
| ||||||||||
| geNorm |
|
|
|
|
|
|
|
|
| |
| NormFinder |
|
|
|
|
|
|
|
|
|
|
| Bestkeeper |
|
|
|
|
|
|
|
|
|
|
| ∆CT |
|
|
|
|
|
|
|
|
|
|
| Comprehensive |
|
|
|
|
|
|
|
|
|
|
|
| ||||||||||
| geNorm |
|
|
|
|
|
|
|
|
| |
| NormFinder |
|
|
|
|
|
|
|
|
|
|
| Bestkeeper |
|
|
|
|
|
|
|
|
|
|
| ∆CT |
|
|
|
|
|
|
|
|
|
|
| Comprehensive |
|
|
|
|
|
|
|
|
|
|
|
| ||||||||||
| geNorm |
|
|
|
|
|
|
|
|
| |
| NormFinder |
|
|
|
|
|
|
|
|
|
|
| Bestkeeper |
|
|
|
|
|
|
|
|
|
|
| ∆CT |
|
|
|
|
|
|
|
|
|
|
| Comprehensive |
|
|
|
|
|
|
|
|
|
|
|
| ||||||||||
| geNorm |
|
|
|
|
|
|
|
|
| |
| NormFinder |
|
|
|
|
|
|
|
|
|
|
| Bestkeeper |
|
|
|
|
|
|
|
|
|
|
| ∆CT |
|
|
|
|
|
|
|
|
|
|
| Comprehensive |
|
|
|
|
|
|
|
|
|
|
|
| ||||||||||
| geNorm |
|
|
|
|
|
|
|
|
| |
| NormFinder |
|
|
|
|
|
|
|
|
|
|
| Bestkeeper |
|
|
|
|
|
|
|
|
|
|
| ∆CT |
|
|
|
|
|
|
|
|
|
|
| Comprehensive |
|
|
|
|
|
|
|
|
|
|
|
| ||||||||||
| geNorm |
|
|
|
|
|
|
|
| ||
| NormFinder |
|
|
|
|
|
|
|
|
|
|
| Bestkeeper |
|
|
|
|
|
|
|
|
|
|
| ∆CT |
|
|
|
|
|
|
|
|
|
|
| Comprehensive |
|
|
|
|
|
|
|
|
|
|
Figure 4Relative expression levels of KUP9 across all experimental sets normalized by the most stable reference gene combination, the most stable gene and the most unstable gene. (a) Drought stress. (b) Heat stress. (c) Cold stress (d) Salt stress. (e) Tissues. Error bars represent the standard deviation of three biological replicates. Different lowercase letters represent statistically significant differences as determined by one-way ANOVA (P < 0.05, Duncan’s multiple range tests).