| Literature DB >> 30083182 |
Lifeng Zhou1, Fengmao Chen1, Jianren Ye1, Hongyang Pan1.
Abstract
Quantitative reverse transcription polymerase chain reaction (RT-qPCR), a sensitive technique for gene expression analysis, depends on the stability of the reference genes used for data normalization under different experimental conditions. Bursaphelenchus mucronatus, a pine-parasitic nematode varying in virulence, is widely distributed in natural pine forests throughout the northern hemisphere, but has not been investigated with respect to the identification of reference genes suitable for the normalization of RT-qPCR data. In the present study, eight candidate reference genes were analyzed in B. mucronatus under different habitat conditions and at different developmental stages. The expression stability of these genes was assessed by geNorm, NormFinder, BestKeeper, delta Cq, and RefFinder algorithms. In general, our results identified encoding beta-tubulin as the most stable gene. Moreover, pairwise analysis showed that three reference genes were sufficient to normalize the gene expression data under each set of conditions, with genes encoding beta-tubulin, 18S ribosomal RNA and ubiquitin-conjugating enzyme being the most suitable reference genes for different habitat conditions, whereas genes encoding beta-tubulin, histone, and 18S ribosomal RNA exhibited the most stable expression at different developmental stages. Validation of the selected reference genes was performed by profiling the expression of the fatty acid- and retinol-binding protein gene in different habitats, and by profiling the expression of the arginine kinase gene at different developmental stages. This first systematic analysis for the selection of suitable reference genes for RT-qPCR in B. mucronatus will facilitate future functional analyses and deep mining of genetic resources in this nematode.Entities:
Keywords: Bursaphelenchus mucronatus; RT-qPCR; normalization; reference gene; validation
Year: 2018 PMID: 30083182 PMCID: PMC6064934 DOI: 10.3389/fgene.2018.00269
Source DB: PubMed Journal: Front Genet ISSN: 1664-8021 Impact factor: 4.599
Primer sequences and amplification efficiency of candidate reference genes.
| Gene symbol | Primer sequence (5′ to 3′) | Amplicon length (bp) | ||
|---|---|---|---|---|
| F: CTCCCAGCCGAACTAACAAACC | 178 | 95.3 | 0.999 | |
| R: CTTCTGTCCCATACCGACCATG | ||||
| F: TCAGGCTGATTGTGCTGTCTTG | 199 | 96.7 | 0.999 | |
| R: TTCGTTGACCACTTCGGTGTAA | ||||
| F: GCCATTCGTCGTCTCGCTCGTC | 106 | 95.9 | 0.999 | |
| R: CACGGATCACATTCTCCAAGAAC | ||||
| F: TGGAGGACGGAAGATACGAG | 176 | 95.3 | 0.999 | |
| R: TTGGGAGTGACCAGTGGAAC | ||||
| F: TGACAACGAAGCCCTTTACGAC | 200 | 99.3 | 0.999 | |
| R: CAGGCATGAAGAAGTGGAGACG | ||||
| F: ATCGCCTACGGTCTACGGGTAC | 124 | 95.9 | 0.999 | |
| R: TAACGGCAGATAAATTGCTGGA | ||||
| F: CTTCGTCTCCGTGGAGGTAT | 109 | 96.7 | 0.999 | |
| R: GGATCTTGGCTTTGACATTCT | ||||
| F: TTCTGACCGTAAACGATGCCAACT | 169 | 93.5 | 0.999 | |
| R: ATTAAGCCGCAAGCTCCACTCC | ||||
Expression stability ranking under different habitat conditions of the eight candidate reference genes using five algorithms.
| Gene | RefFinder | geNorm | NormFinder | BestKeeper | Delta Cq | |||||
|---|---|---|---|---|---|---|---|---|---|---|
| Rank | GM | Rank | MV | Rank | SV | Rank | Rank | |||
| 1 | 1.41 | 1 | 0.72 | 2 | 0.09 | 2 | 0.43 | 1 | 0.69 | |
| 2 | 1.57 | 2 | 0.73 | 1 | 0.07 | 3 | 0.53 | 2 | 0.71 | |
| 3 | 3.22 | 3 | 0.97 | 3 | 0.44 | 4 | 0.59 | 3 | 0.89 | |
| 4 | 3.31 | 5 | 1.01 | 5 | 0.50 | 1 | 0.32 | 5 | 0.98 | |
| 5 | 4.47 | 4 | 0.98 | 7 | 0.60 | 5 | 0.74 | 4 | 0.97 | |
| 6 | 6.19 | 6 | 1.03 | 4 | 0.45 | 7 | 0.97 | 6 | 1.01 | |
| 7 | 6.48 | 7 | 1.09 | 8 | 0.82 | 6 | 0.92 | 7 | 1.03 | |
| 8 | 8.00 | 8 | 1.13 | 6 | 0.57 | 8 | 1.04 | 8 | 1.06 | |
Stability of the eight candidate genes under different habitat conditions of B. mucronatus based on Cq values evaluated by BestKeeper software.
| 1.04 | 0.97 | 0.43 | 0.32 | 0.92 | 0.59 | 0.74 | 0.53 | |
| CV | 4.90 | 2.94 | 1.85 | 1.48 | 3.85 | 2.62 | 3.54 | 2.81 |
| 0.772 | 0.831 | 0.953 | 0.181 | 0.746 | 0.521 | 0.727 | 0.968 | |
| 0.001 | 0.001 | 0.001 | 0.001 | 0.001 | 0.001 | 0.001 | 0.001 | |
Stability of the eight candidate genes at different developmental stages of B. mucronatus based on Cq values evaluated by BestKeeper software.
| 1.16 | 0.98 | 0.61 | 0.78 | 1.49 | 1.17 | 0.98 | 0.64 | |
| CV | 5.11 | 3.12 | 2.70 | 3.42 | 6.13 | 5.08 | 4.60 | 3.30 |
| 0.746 | 0.690 | 0.987 | 0.931 | 0.411 | 0.990 | 0.986 | 0.853 | |
| 0.001 | 0.001 | 0.001 | 0.001 | 0.001 | 0.001 | 0.001 | 0.001 | |
Expression stability ranking at different developmental stages of the eight candidate reference genes using five algorithms.
| Gene | RefFinder | geNorm | NormFinder | BestKeeper | Delta Cq | |||||
|---|---|---|---|---|---|---|---|---|---|---|
| Rank | GM | Rank | MV | Rank | SV | Rank | Rank | |||
| 1 | 1.00 | 1 | 0.88 | 2 | 0.17 | 1 | 0.61 | 1 | 0.80 | |
| 2 | 1.86 | 2 | 0.92 | 1 | 0.09 | 3 | 0.78 | 2 | 0.83 | |
| 3 | 3.08 | 3 | 0.99 | 3 | 0.38 | 2 | 0.64 | 3 | 0.87 | |
| 4 | 3.94 | 8 | 1.48 | 8 | 0.91 | 4 | 0.98 | 4 | 0.88 | |
| 5 | 5.32 | 4 | 1.07 | 4 | 0.45 | 7 | 1.17 | 5 | 0.89 | |
| 6 | 5.42 | 6 | 1.35 | 7 | 0.82 | 6 | 1.16 | 6 | 1.17 | |
| 7 | 7.00 | 7 | 1.39 | 6 | 0.81 | 5 | 0.99 | 7 | 1.28 | |
| 8 | 7.44 | 5 | 1.32 | 5 | 0.73 | 8 | 1.49 | 8 | 1.34 | |