Literature DB >> 30718891

A genetic model of CEDNIK syndrome in zebrafish highlights the role of the SNARE protein Snap29 in neuromotor and epidermal development.

Valeria Mastrodonato1,2, Galina Beznoussenko1, Alexandre Mironov1, Laura Ferrari3, Gianluca Deflorian4, Thomas Vaccari5.   

Abstract

Homozygous mutations in SNAP29, encoding a SNARE protein mainly involved in membrane fusion, cause CEDNIK (<span class="Disease">Cerebral Dysgenesis, Neuropathy, Ichthyosis and Keratoderma), a rare congenital neurocutaneous syndrome associated with short life expectancy, whose pathogenesis is unclear. Here, we report the analysis of the first genetic model of CEDNIK in zebrafish. Strikingly, homozygous snap29 mutant larvae display CEDNIK-like features, such as microcephaly and skin defects. Consistent with Snap29 role in membrane fusion during autophagy, we observe accumulation of the autophagy markers p62 and LC3, and formation of aberrant multilamellar organelles and mitochondria. Importantly, we find high levels of apoptotic cell death during early development that might play a yet uncharacterized role in CEDNIK pathogenesis. Mutant larvae also display mouth opening problems, feeding impairment and swimming difficulties. These alterations correlate with defective trigeminal nerve formation and excess axonal branching. Since the paralog Snap25 is known to promote axonal branching, Snap29 might act in opposition with, or modulate Snap25 activity during neurodevelopment. Our vertebrate genetic model of CEDNIK extends the description in vivo of the multisystem defects due to loss of Snap29 and could provide the base to test compounds that might ameliorate traits of the disease.

Entities:  

Mesh:

Substances:

Year:  2019        PMID: 30718891      PMCID: PMC6361908          DOI: 10.1038/s41598-018-37780-4

Source DB:  PubMed          Journal:  Sci Rep        ISSN: 2045-2322            Impact factor:   4.379


Introduction

SNAP29 (<span class="Gene">Synaptosomal-associated protein 29) is a member of the conserved SNARE (Soluble NSF, N-ethylmaleimide-sensitive factor, Attachment Protein REceptor) family[1], which regulates membrane fusion during intracellular trafficking processes[2]. Snap29 possesses an acidic NPF motif at its N-terminus followed by two SNARE domains required for fusion in association with a target-SNARE protein, such as a Syntaxin, and a vesicle-associated SNARE protein, or Vamp. Several recent studies in human cells and in Drosophila melanogaster revealed a key requirement of Snap29 in the regulation of macroautophagy (autophagy here after)[3-6]. Autophagy is a degradative pathway involved in the disposal of damaged organelles, long-lived proteins or toxic aggregates[7]. During autophagy Snap29, Syntaxin17 and VAMP8, mediate the fusion between mature autophagosomes and lysosomes[4-6]. Beyond autophagy, Snap29 is involved in a number of membrane fusion events within the cell, taking part in diverse trafficking processes, such as endocytosis, recycling and specialized forms of secretion, some of which require the NPF motif[8]. Finally, Snap29 could contribute to non-trafficking processes such as regulation of cell division. In fact, in Drosophila Snap29 is repurposed as a kinetochore component, and in both Drosophila and mammalian cells, Snap29 depletion affects chromosome segregation, ultimately leading to formation of micronuclei and to cell death[9]. Despite the widespread use of Snap29 in several trafficking and non-trafficking processes, complete loss of <span class="Species">human Snap29 (SNAP29) does not cause embryonic lethality. Indeed, homozygous inactivating mutations in the human SNAP29 gene are responsible for rebral ysgenesis, europathy, chthyosis, palmoplantar eratoderma (CEDNIK; OMIM # 609528), a rare autosomal recessive syndrome characterized by congenital neurological and dermatological alterations. These include palmoplantar keratoderma and ichthyosis, microcephaly, neurogenic muscle atrophy, reduced peripheral nerve conduction, corpus callosum abnormalities and cortical dysplasia. The severity of the traits determines a radical shortening of lifespan ranging from neonatal lethality to 12 years[10-12]. Owing to the many cellular functions of Snap29, the pathogenesis of CEDNIK is largely unknown. Skin biopsies of CEDNIK patients revealed a thickened stratum corneum (hyperkeratosis). Further ultrastructural analysis of the skin of CEDNIK mouse models and zebrafish embryos transiently depleted of Snap29, show accumulation of empty lamellar granules in upper epidermal layers[12-14]. In physiologic conditions, granules containing lipid and protein are transported from the Golgi apparatus to the surface of the epidermis, suggesting that trafficking supporting normal skin development and homeostasis might be defective in CEDNIK patients[15]. Consistent with this, CEDNIK patient-derived fibroblasts show a fragmented Golgi and an altered morphology of early and recycling endosomes[11]. CEDNIK patients also present severe nervous system development defects, including <span class="Disease">pachygyria, polymicrogyria and psychomotor retardation. The first two manifestations are thought to refer respectively to abnormal neuronal migration in the developing brain and to brain cortex malformations, due to an excessive number of small and fused cortical convolutions[12]. Since CEDNIK patient-derived neural tissue biopsies are not readily available, the nervous system defects were not investigated in CEDNIK patients. Thus, the nature and consequences of loss of SNAP29 in nervous system development remain elusive. However, Snap29 is likely directly involved in synaptic transmission. In fact, Snap29 is found at synapses of rat hippocampal neurons, where it acts as a negative modulator of synaptic vesicle exocytosis. Indeed, Snap29 has been found to compete with α-SNAP for the binding with the SNARE complex formed by Snap25, Syntaxin1A and VAMP2, thus inhibiting SNARE complex disassembly that is required for synaptic vesicles recycling. Consistent with this, overexpression of Snap29 in presynaptic neurons inhibits synaptic transmission, whereas knockdown of Snap29 promotes it[16,17]. Here, we have established to our knowledge the first genetic model of CEDNIK in zebrafish. With it, we have investigated in vivo the cellular, tissue and organismal consequences of lack of <span class="Gene">Snap29 on vertebrate development. We described multisystemic alterations that could be explained by loss of most of Snap29 described functions. In addition, we report alteration of neuro-muscular development that might shed light on ill-explored aspects of CEDNIK.

Results

Establishment of a genetic CEDNIK disease model in zebrafish

To understand whether zebrafish could represent a suitable model organism for <span class="Species">human CEDNIK syndrome, we first analyzed protein sequence conservation of zebrafish Snap29 with its human homolog. Zebrafish Snap29 displays overall 46% identity at the amino acid level with the human counterpart. It also possesses all the domains found in SNAP29, namely an acidic NFP motif at its N-terminus and two SNARE domains (Fig. 1A). The position of reported nonsense mutations associated to CEDNIK (red triangles, Fig. 1A)[10,12] introduce stop codons that are expected to lead to the production of proteins truncated respectively within the first SNARE domain and before the second SNARE domain (Fig. 1A).
Figure 1

Snap29 conservation and expression in zebrafish. (A) Protein sequence alignment of human and zebrafish Snap29 from UniProt (http://www.uniprot.org). Red triangles refer to two SNAP29 mutations described in CEDNIK patients. Amino acid residues are shaded according to their degree of conservation, as described in the legend. (B) Whole-mount in situ hybridization with snap29 antisense and sense probes on zebrafish embryos at the indicated developmental stages.

Snap29 conservation and expression in <span class="Species">zebrafish. (A) Protein sequence alignment of human and zebrafish Snap29 from UniProt (http://www.uniprot.org). Red triangles refer to two SNAP29 mutations described in CEDNIK patients. Amino acid residues are shaded according to their degree of conservation, as described in the legend. (B) Whole-mount in situ hybridization with snap29 antisense and sense probes on zebrafish embryos at the indicated developmental stages. To characterize snap29 expression during <span class="Species">zebrafish embryogenesis, we first performed whole-mount in situ hybridization and RT-PCR. Consistent with previous evidence[18], these experiments indicated that the snap29 mRNA is ubiquitously expressed from maternal stages (2.5 hours post fertilization, hpf) onwards (Figs 1B; S1A). To reevaluate previous evidence from depletion of snap29 in <span class="Species">zebrafish, we took advantage of an already published snap29 splice-blocking Morpholino (MO)[14]. To test the efficiency of snap29 MO depletion at different developmental stages, we performed reverse transcriptase PCR (RT-PCR) of developing embryos (Fig. S1A). In MO-injected embryos, from 24 hpf onwards, we observed retention of an intron in the snap29 transcript caused by the splicing block. In agreement with our in situ experiment (Fig. 1B), but in contrast with previously published evidence[14], we observed expression of snap29 mRNA as early as 2.5 hpf (Fig. S1A). However, morphological analysis of snap29 morphants at 60 hpf produced phenotypes, such as a lighter pigmentation at the level the head and less regular distribution of melanocytes in the tail compared to uninjected embryos (Fig. S1B), which are similar to those published in Li et al.[14]. Because of the inherent limitation of Morpholino approaches[19], to attempt to establish a CEDNIK model we requested an uncharacterized <span class="Gene">snap29 ENU mutant available from the European Zebrafish International Resource Center (EZRC). Moreover, we generated a CRISPR/Cas9 mutant. Both mutants, called snap29 and snap29 respectively, introduce stop codons that lead to the production of truncated Snap29 proteins lacking the SNARE 2 domain, similar to one of the human reported CEDNIK mutations (Fig. 2A). In particular, in snap29 the stop codon after K164 is the result of a non-sense (T > A) mutation, while the stop codon of snap29 occurs after an Indel, causing a frameshift (fs) starting after the codon producing N171 (Fig. 2A). Macroscopic analysis of 5 days post fertilization (dpf) larvae revealed that in both crosses of the heterozygous fish, roughly 25% of the progeny showed an uninflated swim bladder (Fig. 2A, asterisks) and, similar to morphants, a lighter pigmentation of the head and of the trunk regions (Fig. 2A, arrowheads). In addition, larvae displaying these phenotypes die at 9 dpf. Genotyping of these animals revealed that they were homozygous respectively for snap29 and snap29 (data not shown).
Figure 2

Generation of snap29 mutants and rescue. (A) Lateral and dorsal views of 5 dpf larvae of wild type, ENU snap29 mutant and CRISPR/Cas9 snap29 mutants with schematic representation of predicted proteins. Asterisks in lateral views indicate lack of an inflated swim bladder, while arrows in dorsal views point to weaker pigmentation in mutants, compared to wild type. snap29 mRNA relative expression measured in extracts of 5 dpf wild type, snap29 and snap29 larvae, and normalized on gapdh is reported below the images. snap29 mutants show a reduction of snap29 mRNA of about 95% compared to wild type, while no significant reduction is detectable in snap29. (B) mRNA expression of snap23.1, snap23.2, snap25a, snap25b and snap47 measured in extracts of 5 dpf snap29 relative to wild type. gapdh is used as normalizer. The bars in the graph show means and standard errors of the mean (SEM) of three technical replicates. P-values were computed by multiple t-test. *P ≤ 0.05. (C) Groups of 5 dpf larvae from the progeny of snap29 heterozygous mating. Uninjected larvae were classified according to the pigmentation phenotype. The snap29 uninjected population is composed by 71.5% of wild type phenotype larvae and by 28.5% of mutant phenotype larvae. The snap29 injected population consists of the 94.5% of phenotypically wild type larvae, demonstrating that GFP-snap29 mRNA injection rescues the mutant phenotype. (C’) Survival curve of snap29 populations uninjected and injected with GFP-snap29 mRNA. The percentage of survival refers to alive zebrafish larvae or adults recovered over time from the initial number of fertilized embryos. Injected snap29 mutants show an increase of survival compared to uninjected animals.

Generation of <span class="Gene">snap29 mutants and rescue. (A) Lateral and dorsal views of 5 dpf larvae of wild type, ENU snap29 mutant and CRISPR/Cas9 snap29 mutants with schematic representation of predicted proteins. Asterisks in lateral views indicate lack of an inflated swim bladder, while arrows in dorsal views point to weaker pigmentation in mutants, compared to wild type. snap29 mRNA relative expression measured in extracts of 5 dpf wild type, snap29 and snap29 larvae, and normalized on gapdh is reported below the images. snap29 mutants show a reduction of snap29 mRNA of about 95% compared to wild type, while no significant reduction is detectable in snap29. (B) mRNA expression of snap23.1, snap23.2, snap25a, snap25b and snap47 measured in extracts of 5 dpf snap29 relative to wild type. gapdh is used as normalizer. The bars in the graph show means and standard errors of the mean (SEM) of three technical replicates. P-values were computed by multiple t-test. *P ≤ 0.05. (C) Groups of 5 dpf larvae from the progeny of snap29 heterozygous mating. Uninjected larvae were classified according to the pigmentation phenotype. The snap29 uninjected population is composed by 71.5% of wild type phenotype larvae and by 28.5% of mutant phenotype larvae. The snap29 injected population consists of the 94.5% of phenotypically wild type larvae, demonstrating that GFP-snap29 mRNA injection rescues the mutant phenotype. (C’) Survival curve of snap29 populations uninjected and injected with GFP-snap29 mRNA. The percentage of survival refers to alive zebrafish larvae or adults recovered over time from the initial number of fertilized embryos. Injected snap29 mutants show an increase of survival compared to uninjected animals. Quantification of snap29 mRNA level by qPCR in both mutants, selected according to the phenotype described above, showed that <span class="Gene">snap29 homozygous larvae express snap29 mRNA level comparable to control, while snap29 homozygous larvae display a reduction of its expression of more than 95% (Fig. 2A), suggesting that they are subjected to nonsense-mediated mRNA decay. Since the level of SNAP29 transcript in CEDNIK patient-derived fibroblasts is strongly reduced compared to control[12], we decided to select snap29 homozygous mutants as a valid CEDNIK model. However, since other reported patients have not been analyzed at the mRNA stability level[11], snap29 might eventually represent a model for these, or for future patients showing normal expression of SNAP29 mRNA. To understand whether snap29 paralogs might substitute for the observed loss of <span class="Gene">Snap29 in mutants, we determined their expression by qPCR. We found that, relative to control, levels of expression of snap29 paralogs are not changed in snap29 samples (Fig. 2B), suggesting that compensation or redundancy of function are unlikely. These changes in pigmentation of the skin in mutants and morphants, and in swim bladder appearance in mutants are phenotypes that do not appear to correlate to CEDNIK traits, so we analyzed them first. To this end, we visualized melanocytes of snap29 mutants. Compared to wild type, we did not appreciate any difference in melanocytes morphology. However, we noticed a reduced amount of <span class="Chemical">melanin accumulated within each melanocyte (Fig. S2). These data suggest that Snap29 might regulate pigment production, possibly at the level of trafficking to melanosomes, which are lysosomal derivatives[20]. A second, prominent feature of snap29 mutant larvae is the lack of swim bladder inflation (Figs 2C, S3A, upper row). Swim bladder inflation in zebrafish occurs after 5 dpf and is required for free feeding after yolk consumption[21], since it allows buoyancy and active swimming. To test whether mutant fish are able to feed, we administered Rhodamine Dextran-containing food to 6 dpf wild type and snap29 mutant larvae. We observed that guts of snap29 mutant larvae were empty as they are those of wild type animals that were not fed (Fig. S3A, lower row). The inability to feed can be one of the causes determining the precocious lethality observed at 9 dpf in snap29 mutants. Since the swim bladder is inflated by air gulped from the water surface through the mouth opening[22], we wondered whether snap29 mutants present normal buccal cartilages. Alcian Blue staining of ventral cranial cartilages did not highlight defects in their organization and differentiation (Fig. S3B). To validate our model, we next tested whether the lighter pigmentation, the lack of swim bladder inflation and the lethality observed in homozygous larvae were caused by <span class="Gene">snap29 mutation. To determine this, we injected mRNA encoding a zebrafish GFP-tagged snap29 mRNA, that is efficiently translated into protein (Fig. S4), in a population of one-cell embryos derived from the mating of snap29 heterozygous fish (Fig. 2C). In the uninjected population, roughly a quarter of 5 dpf larvae displayed the mutant phenotypes, while the remaining larvae were wild type-like. In sheer contrast, the vast majority of the injected population of larvae exhibited a wild type-like phenotype, as expected for Mendelian inheritance (Fig. 2C). Moreover, the injected population displayed increased survival, compared to the uninjected (Fig. 2C’). By genotyping a portion of the population, we found that homozygous larvae were still present in the injected population at 14 dpf, but not at 40 dpf (data not shown). The survival curve analysis suggests that the rescue by transient expression of GFP-Snap29, extends the lifespan of at least a pool of homozygous larvae up to 33 dpf. These data establish snap29 homozygous larvae as the first validated genetic mutant in zebrafish. We next investigated the defects caused by loss of Snap29 to test whether they correlate with loss of previously characterized Snap29 functions and whether they reproduce CEDNIK syndrome traits.

snap29 mutant larvae recapitulate aspects of loss of Snap29 function and of CEDNIK syndrome

Considering recent reports that revealed that Snap29 regulates a late step of autophagy in multiple organisms[4,5,23], we determined whether autophagy is altered in our <span class="Gene">snap29 zebrafish mutant larvae. To this end, we measured the level of the autophagy marker LC3 in protein extracts of 5 dpf larvae by Western blot. We observed a mild increase in both LC3II and the autophagy adapter p62 in snap29 mutants (Fig. S5A,B). Since LC3II is associated to mature autophagosomes[24], this result suggests an impairment in autophagy clearance, in line with previous reports[4,5]. In addition, we also found a punctate localization of the p62 in the brain of 4 dpf snap29 mutants (Fig. S5C), as previously observed in tissues and cells lacking most of Snap29[5,9]. Consistent with the presence of autophagic defects, ultra-structural analysis of the skin of 7 dpf larvae shows that snap29 mutants accumulate multilamellar organelles (MLOs), which are composed of concentric lipidic membrane layers[25], within intercellular cavities (Fig. S5D, red asterisk). The formation of MLOs is associated to pathological conditions, such as lysosomal storage diseases[26,27], and is associated with defective autophagosome clearance[28] and lysosomal cholesterol accumulation[29]. The occasional presence of MLOs in intercellular cavities suggests that defective autophagy might result in secretion of aberrant organelles, as reported in Drosophila Snap29 mutants[4]. Together, these data confirm in vivo the existence of defects in the process of autophagy in homozygous snap29 mutant zebrafish. As one of the most characteristic features of CEDNIK patients is the <span class="Disease">keratoderma and ichthyosis[12], two major skin alterations, we investigated possible defects in the epidermis of snap29 mutant. Unlike mammals, the zebrafish skin is composed of two layers of cells only, the basal layer (Fig. S6A, pseudo-coloring in magenta) resting on the basement membrane (BM; Fig. S6A, pseudo-coloring in orange) and the periderm, which will differentiate keratinocytes (Fig. S6A, pseudo-coloring in yellow)[30]. The ultra-structural analysis of 7 dpf larvae highlighted that snap29 mutants show a thinner peridermal layer composed of more elongated cells, compared to wild type, while they possess similar basal layers morphology (quantified in Fig. S6A’). In addition, the skin of a wild type sample shows an ordered pattern of structures that will originate adult scales precursors (SP; Fig. S6A, red asterisks), which is lost in the snap29 mutant (quantified in Fig. S6A”). The reduced size of the peridermal layer in snap29 mutants was further confirmed by the strongly reduced amount of the peridermal marker Keratin by Western blot analysis (Fig. S6B). Finally, higher magnifications of peridermal cells show looser adherens junctions in the snap29 mutant compared to wild type (Fig. S6C, white arrows), and increased intercellular space (Fig. S6C, red asterisk). In summary, these results are in contrast with the reported skin hyperkeratosis observed both in CEDNIK patient biopsy[12] and in conditional CEDNIK mouse mutants[13]. However, the loss of SP organization and the defective junctions are in line with the loss of skin organization integrity observed in patients[13]. Overall, these data suggest that snap29 zebrafish mutants recapitulate one major CEDNIK trait, as well as the loss of an intensely-studied function of Snap29. Despite this, some differences exist with respect to patients and mammals, in particular at the level of the skin.

Snap29 is required to determine correct neuromuscular development and function

It has been reported by clinicians that CEDNIK patients dispn>lay a severe central nervous system development deficiency and suffer from neurogenic and <span class="Disease">skeletal muscle hypotonia[31]. However, the pathogenesis of these symptoms has not been investigated. By analyzing hematoxylin-eosin stained paraffin sections of the head of snap29 mutant larvae at 7 dpf, we observed a prominent microcephaly (Fig. 3A; quantified in 3A’). In contrast, we did not find significant differences in size at 5 dpf (Fig. 3A’). Head area measurements were compared to trunk areas that were not significantly different both at 5 and 7 dpf, suggesting that the effect is not due to a developmental delay. To investigate the origin of the microcephaly, we determined amounts of apoptotic cells during development. Interestingly, we found that the heads of snap29 mutants at the stage of 20 somites (19 hpf) and 3 dpf exhibit a sharp increase in the expression of the apoptotic marker cleaved Caspase 3, compared to controls, while this is not observed in 5 dpf or 7 dpf mutant animals (Fig. 3B; quantified in 3B’). To exclude that size differences are due to altered rates of proliferation, we determined the level of expression of phospho-Histone H3 (pH3) at 19 hpf and 7 dfp. We found no statistically significant difference (Fig. S7A, quantified in B). These data suggest that microcephaly, a characteristic trait of CEDNIK patients, might be caused at least partially by uncompensated elimination of defective cells during early development.
Figure 3

snap29 mutant as a CEDNIK disease model. (A) Hematoxylin-eosin stained paraffin sections of heads of 7 dpf larvae. Note the reduced size of the head in snap29 mutant animals compared to wild type. (A’) Quantification of the area of head and of the trunk sections measured in wild type and snap29 mutant respectively at 5 dpf and 7 dpf. At 7 dpf, snap29 mutants show a significant reduction of head area compared to wild type. Bars in the graph show means and standard deviations. P-values were obtained by unpaired t-test. **P ≤ 0.01, n = 3. (B) Comparable maximum projections of wild type and snap29 mutant heads at 19 hpf, 3 dpf, 5 dpf and 7 dpf stained with anti-cleaved Caspase 3 to reveal presence of apoptotic cells. White dashed-lines were drawn to highlight head morphology. (B’) Quantification of the number of apoptotic cells per 105 μm2, measured in wild type and snap29 mutants respectively at 19 hpf, 3 dpf 5 dpf and 7 dpf. 19 hpf and 3 dpf snap29 mutants show a significant increase of apoptotic cells compared to wild type. The bars in the graph show means and standard deviations. P-values were obtained unpaired t-test with Welch’s correction. *P ≤ 0.05, **P ≤ 0.01, n = 2–9.

snap29 mutant as a CEDNIK disease model. (A) <span class="Chemical">Hematoxylin-eosin stained paraffin sections of heads of 7 dpf larvae. Note the reduced size of the head in snap29 mutant animals compared to wild type. (A’) Quantification of the area of head and of the trunk sections measured in wild type and snap29 mutant respectively at 5 dpf and 7 dpf. At 7 dpf, snap29 mutants show a significant reduction of head area compared to wild type. Bars in the graph show means and standard deviations. P-values were obtained by unpaired t-test. **P ≤ 0.01, n = 3. (B) Comparable maximum projections of wild type and snap29 mutant heads at 19 hpf, 3 dpf, 5 dpf and 7 dpf stained with anti-cleaved Caspase 3 to reveal presence of apoptotic cells. White dashed-lines were drawn to highlight head morphology. (B’) Quantification of the number of apoptotic cells per 105 μm2, measured in wild type and snap29 mutants respectively at 19 hpf, 3 dpf 5 dpf and 7 dpf. 19 hpf and 3 dpf snap29 mutants show a significant increase of apoptotic cells compared to wild type. The bars in the graph show means and standard deviations. P-values were obtained unpaired t-test with Welch’s correction. *P ≤ 0.05, **P ≤ 0.01, n = 2–9. Because CEDNIK patients are <span class="Disease">hypotonic, we then analyzed the pattern of the muscle fibers in the trunk muscles of snap29 mutant larvae. These show less compacted and ordered filaments compared to wild type (Fig. 4A, red asterisks, quantified in A’). Consistent with muscle fiber disorganization, EM analysis of muscles revealed the presence of intracellular cavities with MLO (Fig. 4B, black asterisk and white arrowhead) within muscle fibers, between myofibrils (M) and the basement membrane (BM) of snap29 mutants. Furthermore, snap29 mutants possess mitochondria (Mit) that are included in a double membrane (Fig. 4B, black arrowhead), suggesting a potential alteration of mitophagy. These phenotypes, possibly due to defects in membrane trafficking processes, were recently observed in muscular atrophy patients[32].
Figure 4

Snap29 supports correct muscle development and function. (A) Lateral views of muscles in the trunk of 4 dpf wild type and snap29 mutant larvae, stained with anti-Myosin heavy chain antibody. Compared to wild type, snap29 mutants present less compacted and ordered filaments (red asterisk). (A’) Quantification of the length of the profile of superficial myofibrils measured in wild type and snap29 mutant 4 dpf larvae. snap29 mutants show a significant increase in myofibril length compared to wild type. The bars in the graph show means and standard deviations. P-values were derived from Mann-Whitney test. ***P ≤ 0.001, n = 41–45. (B) Electron microscopy cross-sections of muscle fibers. snap29 contain MLO (white arrowhead) within extracellular spaces (asterisks) just beneath the basement membrane and a mitochondria surrounded by a double membrane (black arrowhead), which are not present in wild type animals. M: myofibrils, Mit: mitochondria, BM: basement membrane. (C) Selected frames from movies of a wild type and a snap29 mutant larva at 6 dpf recorded for 1 minute after a touch stimulus on the tail. (C’) Quantification of the number of touches required to evoke an escape response. Most of the analyzed snap29 mutants require two or more touches to respond. The graph reports means and standard deviations. P-values were obtained by Mann-Whitney test. ***P ≤ 0.001, n = 6.

Snap29 supports correct muscle development and function. (A) Lateral views of muscles in the trunk of 4 <span class="Chemical">dpf wild type and snap29 mutant larvae, stained with anti-Myosin heavy chain antibody. Compared to wild type, snap29 mutants present less compacted and ordered filaments (red asterisk). (A’) Quantification of the length of the profile of superficial myofibrils measured in wild type and snap29 mutant 4 dpf larvae. snap29 mutants show a significant increase in myofibril length compared to wild type. The bars in the graph show means and standard deviations. P-values were derived from Mann-Whitney test. ***P ≤ 0.001, n = 41–45. (B) Electron microscopy cross-sections of muscle fibers. snap29 contain MLO (white arrowhead) within extracellular spaces (asterisks) just beneath the basement membrane and a mitochondria surrounded by a double membrane (black arrowhead), which are not present in wild type animals. M: myofibrils, Mit: mitochondria, BM: basement membrane. (C) Selected frames from movies of a wild type and a snap29 mutant larva at 6 dpf recorded for 1 minute after a touch stimulus on the tail. (C’) Quantification of the number of touches required to evoke an escape response. Most of the analyzed snap29 mutants require two or more touches to respond. The graph reports means and standard deviations. P-values were obtained by Mann-Whitney test. ***P ≤ 0.001, n = 6. To evaluate the neuromuscular activity of wild type and mutant larvae, we performed a touch-evoked escape response assay. By stimulating tails of 6 dpf mutants with a pipette tip, we observed on average swim-away response of wild type larvae 70 milliseconds (ms) after a single touch, while <span class="Gene">snap29 mutants responded very poorly (Fig. 4C, Movies S1 and 2). Quantification of touch stimuli required to trigger escape, revealed that most of snap29 mutant larvae require two or more touches to swim away (Fig. 4C’). To investigate whether neuromotor development is altered in snap29 mutants, we next used a <span class="Species">zebrafish strain derived from crossing the transgenic line Tg(isl1:GFP), in which GFP is expressed in motor neurons[33], with snap29 heterozygous fish. By analyzing the brain of 6 dpf larvae derived from the incross of such strain, we observed that homozygous snap29 mutants lack a group of cells located between the third and fourth rhombomere (Fig. 5A, upper panels, r3, r4). These cells correspond to the trigeminal anterior and posterior motor nuclei (Fig. 5A, upper panels Va and Vp) of neurons that innervate mandibular arch muscles controlling mouth opening[34]. We then analyzed motor neuron projections of Tg(isl1:GFP) snap29 mutants at the level of developing muscles in the trunk and we detected the presence of an altered branching pattern, compared to the reported “loop” structure[35] observed in wild type (Fig. 5A, lower panels, white arrows; quantified in 5A’). These results suggest that Snap29 is required to ensure correct neuromuscular system development in zebrafish.
Figure 5

Snap29 impairment causes neuro-developmental defects. (A, upper row) Head dorsal views of the motor neuron reporter Tg(isl1:GFP) in a wild type and a snap29 mutant larva at 6 dpf. (r) rhombomere, (III), (IV), (Va) anterior, (Vp) posterior, (VII), (X) cranial nerves. snap29 mutant larvae lack a group of nuclei (white dashed circles) located between the third and fourth rhombomere (r3, r4). (A, lower row) Lateral views of trunks of Tg(isl1:GFP)-expressing wild type and snap29 mutants at 6 dpf. Compared to the “loop” structures observed in wild type (white arrow), snap29 mutants present an altered motor neuron projection pattern (arrowheads), and extra branching (white asterisk). (A’) Quantification of motor neuron branching in wild type and snap29 mutant larvae at 4, 5 and 6 dpf. Compared to wild type, snap29 mutants larvae show a significant increase of unlooped branches and hyperbranching. The bars show means and standard deviations of the percentage of the phenotypic categories. P-values were obtained by unpaired t test with Welch’s correction. **P ≤ 0.01, ****P ≤ 0.0001, n = 6–10. (B) Quantification of the number of twitches per minute performed respectively by 26 hpf embryos treated as described in figure. snap29 morphants show an increase in the number of twitches per minute compared to wild type embryos. Co-injection of snap29 Morpholino with GFP-snap29 mRNA rescues the increased number of twitches per minute observed in snap29 morphants, while GFP-snap29 mRNA injection per se has no effect on twitching frequency. The graph shows medians, 25th and 75th percentiles. P-values were obtained by Kruskal-Wallis, ****P ≤ 0.0001, n = 69–73. (C) Quantification of the number of twitches as in B. snap29 morphants show an increase twitches frequency per minute compared to wild type embryos, while both snap25 and bdnf morphants show a significant decrease. The graph shows medians, 25th and 75th percentiles. P-values were derived from Kruskal-Wallis, *P ≤ 0.05 ***P ≤ 0.001, n = 20–44. (D) Motor neuron projections in 4 dpf Tg(isl1:GFP)-expressing uninjected larvae and in snap29, snap25 and bdnf morphant larvae. Uninjected embryos show normal motor neuron projection towards the ventral part of the trunk (yellow arrows). snap29 morphants show less elongated projections (yellow arrows) and extrabranching (yellow asterisk), while both snap25 and bdnf morphants show truncated projections.

Snap29 impairment causes <span class="Disease">neuro-developmental defects. (A, upper row) Head dorsal views of the motor neuron reporter Tg(isl1:GFP) in a wild type and a snap29 mutant larva at 6 dpf. (r) rhombomere, (III), (IV), (Va) anterior, (Vp) posterior, (VII), (X) cranial nerves. snap29 mutant larvae lack a group of nuclei (white dashed circles) located between the third and fourth rhombomere (r3, r4). (A, lower row) Lateral views of trunks of Tg(isl1:GFP)-expressing wild type and snap29 mutants at 6 dpf. Compared to the “loop” structures observed in wild type (white arrow), snap29 mutants present an altered motor neuron projection pattern (arrowheads), and extra branching (white asterisk). (A’) Quantification of motor neuron branching in wild type and snap29 mutant larvae at 4, 5 and 6 dpf. Compared to wild type, snap29 mutants larvae show a significant increase of unlooped branches and hyperbranching. The bars show means and standard deviations of the percentage of the phenotypic categories. P-values were obtained by unpaired t test with Welch’s correction. **P ≤ 0.01, ****P ≤ 0.0001, n = 6–10. (B) Quantification of the number of twitches per minute performed respectively by 26 hpf embryos treated as described in figure. snap29 morphants show an increase in the number of twitches per minute compared to wild type embryos. Co-injection of snap29 Morpholino with GFP-snap29 mRNA rescues the increased number of twitches per minute observed in snap29 morphants, while GFP-snap29 mRNA injection per se has no effect on twitching frequency. The graph shows medians, 25th and 75th percentiles. P-values were obtained by Kruskal-Wallis, ****P ≤ 0.0001, n = 69–73. (C) Quantification of the number of twitches as in B. snap29 morphants show an increase twitches frequency per minute compared to wild type embryos, while both snap25 and bdnf morphants show a significant decrease. The graph shows medians, 25th and 75th percentiles. P-values were derived from Kruskal-Wallis, *P ≤ 0.05 ***P ≤ 0.001, n = 20–44. (D) Motor neuron projections in 4 dpf Tg(isl1:GFP)-expressing uninjected larvae and in snap29, snap25 and bdnf morphant larvae. Uninjected embryos show normal motor neuron projection towards the ventral part of the trunk (yellow arrows). snap29 morphants show less elongated projections (yellow arrows) and extrabranching (yellow asterisk), while both snap25 and bdnf morphants show truncated projections. As previously demonstrated by Menelaou et al.[36], during early stages of development spontaneous movements of <span class="Species">zebrafish embryos within the chorion (twitches) correlate with correct motor neurons axonal pathfinding. We thus compared spontaneous movements of 26 hpf snap29 morphants with those of uninjected embryos. We found that twitching frequency increased in snap29 morphants, compared to uninjected controls, or to embryos injected with GFP-snap29, or co-injected with snap29 MO and GFP-snap29 (quantified in Fig. 5B; Movie S3–6), indicating that the twitching phenotype is due to loss of Snap29. In cultured hippocampal neurons of rats, <span class="Gene">SNAP29 is known to exert a function in synaptic transmission, but unlike the neuronal SNAP family member SNAP25, it appears to act as a negative regulator[17]. Interestingly, we found that while the snap29 mutant exhibits extra branching within the normal motor neuron projection pattern, snap25 morphants are reported to show an opposite phenotype, namely a strongly reduced motor neuron arborization[37]. In agreement with this evidence, we observed that in our hands snap25 morphants show a frequency of ∼1 twitches/minute, which is significantly different from those of snap29 morphants and uninjected controls (Fig. 5C; Movies S7–9). Similarly, bdnf morphants are almost motionless (Fig. 5C; Movies S10). BDNF (Brain-Derived Neutrophic Factor), a secreted molecule belonging to neurotrophin family, together with the nerve growth factors neurotrophin 3,4 and 6[38], are known to control axonal growth and pathfinding[39]. Consistent with the results of the twitching assay, finally we show that 4 dpf Tg(isl1:GFP) expressing snap29 morphants display altered branching, with extra projections (Fig. 5D, yellow asterisk), while snap25 and bdnf morphants exhibit respectively truncated and thinner projections, not extending ventrally (Fig. 5D, yellow arrows). Overall, these data suggest that perturbation of Snap29 causes an increase in spontaneous movements of embryos, as well as abnormal motor neuron branching. Such phenotypes are for the most part opposite to those observed in snap25 and bdnf morphants, suggesting that Snap29 could act as a negative modulator of motor neuron development.

Discussion

In this study, we show that zebrafish represents an excellent model organism to study how certain traits of CEDNIK syndrome arise during embryonic development. In particular, we demonstrate for the first time that Snap29 is required to sustain neuromuscular system development and to enable its correct functioning. Both snap29 and snap29 mutants, generated respectively by ENU treatment and CRISPR/Cas9 technology, as well as Morpholino treatment, recapitulate the poor life expectancy observed in CEDNIK patients[10], and show altered skin pigmentation and neuromuscular development. In particular, snap29 ENU mutants express very low levels of snap29 mRNA, as is the case of the few CEDNIK patients that have been analyzed molecularly[10]. Importantly, snap29 paralogs do not appear to be overexpressed in snap29 ENU mutants, suggesting that their phenotypes are unlikely to be mitigated by functional redundancy. However, it remains to be determined whether wild type levels of snap29 paralogs might suffice to provide enough proteins to compensate, at least partially, for the loss of snap29. The specificity of these phenotypes was confirmed since we were able to completely rescue pigmentation defects, as well as changes in twitching frequency, a phenotype that has been previously associated to altered neurodevelopment. We also partially rescued precocious lethality by injecting mRNA encoding GFP-tagged Snap29. Importantly, pigmentation defects have never been reported neither in human patients, nor in mouse models. However, it might be difficult to evaluate depigmentation considering the presence of ichthyosis and of keratoderma affecting CEDNIK patients[11,12]. Interestingly, melanocytes of the snap29 mutants do not show migration problems, but they are partially devoid of melanin. The SNARE complex regulating fusion to melanosomes is known to include Syntaxin13 and VAMP7[40]. Since the third SNARE component of this SNARE complex has not yet been identified, based on the pigmentation phenotype, we hypothesize that fusion of enzyme-containing vesicles to melanosomes might depend on Snap29. Thus, we propose that Snap29 could be the third SNARE protein involved in fusions ultimately required for melanin biosynthesis. Similar to autophagosome accumulation previously observed in Drosophila <span class="Gene">Snap29 mutants[4], extracts of homozygous mutants of snap29 show increase level of adapter autophagy p62 and of the autophagosome markers LC3II, a phenotype characteristic of impaired autophagy. Whether and how alteration of autophagy contributes to CEDNIK pathogenesis is unclear. Interestingly, mutations in human EPG5 (ectopic P-granules autophagy protein 5) cause a severe neurodevelopmental disease called Vici syndrome, which shares with CEDNIK many clinical manifestations in pediatric patients, such as microcephaly, brain development abnormalities, atrophy of the retina and muscle hypotonia[41]. Importantly, EPG5 was recently reported to regulate the autophagosome-lysosome fusion step[42]. Moreover, similarly to snap29 mutant zebrafish, Vici patients exhibit hypopigmentation and muscle biopsies from Vici patients show accumulation of p62. Thus, based on the similarity with Vici syndrome, it is likely that aspects of CEDNIK pathogenesis might also derive from impaired autophagic clearance. Other congenital neurodevelopment syndromes like Roberts syndrome and <span class="Disease">Primary microcephaly (MCPH) are caused by mutations in genes that regulate cell division[43,44]. Importantly, a very recent work demonstrated that Snap29 is required to prevent cell division defects and apoptosis in both Drosophila and human cells[9]. Consistent with this, snap29 mutants present a high number of apoptotic cells during early development. It is thus possible that the massive cell death occurring in the head of snap29 mutants at 19 hpf and 3 dpf could contribute to the microcephaly that becomes apparent at 7 dpf, as well as to reduction in thickness of the skin peridermal layer. In such scenario, neuronal and peridermal proliferation might be reduced by early loss of cells that might behave as progenitors, with surviving cells incompletely able to compensate in mutant animals. Consistent with this, we have observed that at 19 hpf the amounts of proliferating cells in mutant animals is not increased when compared to controls, suggesting that the increased apoptosis in mutants is not compensated by an increase in proliferation. CEDNIK patients suffer also from <span class="Disease">neurogenic atrophy, which is loss of muscle tone caused by wasting of nerves controlling muscles[12]. Similarly, snap29 mutants show defective muscle fibers organization, which could be the cause of the observed reduced larval motility. Their muscles also contain mitochondria enveloped in a double-membrane organelle. Recent reports pointed out that Snap29, together with Syntaxin17 and VAMP7, is required for the fusion of mitochondrial-derived vesicles (MDVs) with endolysosomal compartments to promote eventually mitochondrial degradation in lysosomes[45,46]. Thus, mitochondria efficiency in supporting muscle activities could be affected by a failure in clearance of mitochondrially-derived vesicles. In addition to be due to potentially impaired muscle functionality, reduced touch-evoked responses of snap29 mutant larvae might echo nervous system manifestations of CEDNIK <span class="Species">patients, which include psychomotor retardation[12]. In addition, absence of trigeminal motor neurons, which control mandibular arch muscles and mouth opening[33] in mutant fish, suggests a further cause for lack of swim bladder inflation and feeding impairment, the latter phenotype echoing the inability to feed of CEDNIK infants[31]. Whichever the case, the analysis of motor neurons innervating skeletal muscles of the trunk of mutant larvae, revealed abnormal axon projections branching at different developmental stages. Importantly, SNAP25 and <span class="Gene">SNAP47 regulate neuronal circuit development and axon branching by mediating the membrane fusion events required for release of neurotransmitters and of the brain-derived neurotrophic factor (BDNF), which is normally stored in dense core vesicles (DCVs)[47-49]. Considering that overexpression of Snap29 in Snap25 KO neurons is able to restore DVCs release[50], it is possible that the lack of Snap29 results in uncontrolled release of neurotransmitters and BDNF, eventually affecting axon branching. This hypothesis is supported by the increase in spontaneous twitches within the chorion observed in 26 hpf snap29 morphants compared to uninjected embryos, a specific phenotype which is rescued by ectopic expression of GFP-Snap29. In contrast, as previously reported[37,51], we observed an opposite phenotype in snap25 and bdnf morphants, consisting in decreased twitches per minute. Spontaneous movements have been shown as required for normal motor neuron development and axonal branching. Indeed, their decrease, induced in 24 hpf embryos by the treatment with the anesthetic tricaine, also determines motorneuronal axonal pathfinding defects[36]. Accordingly, snap29 morphants present a motorneuron hyperbranching (as observed for of snap29 mutant), while snap25 and bdnf morphants show, respectively, truncated and thinner projections compared to uninjected embryos. Overall, we surmise that Snap29 might be fundamental, possibly, for normal neuromuscular development as a regulator of membrane fusion, which is controlled by a finely-tuned release of BDNF. In summary, our <span class="Species">zebrafish mutant analysis provides the base for future study of the pathogenesis of CEDNIK, especially regarding the unexplored neuromotor features of the syndrome. Mutant larvae could be also used to test new compounds that might mitigate the consequences of the most deleterious traits of the disease.

Materials and Methods

Zebrafish strains

Adult zebrafish were maintained in a commercial system (Aquatic Habitat) at a <span class="Chemical">water temperature of 28.5 °C, pH 7 and conductivity 500 μS. Zebrafish embryos and larvae not older than 5 dpf are maintained at 28 °C in E3 water (50 mM NaCl, 0.17 mM KCl, 0.33 mM CaCl, 0.33 mM MgSO4, 0.05% methylene blue). Zebrafish strains used in this study are AB (referred to as wild type), sa13359 obtained from European Zebrafish Resource Center referred to as snap29, snap29 generated by CRISPR/Cas9 technology (see details below), and Tg(isl1:GFP)[33]. All the strains were maintained and bred according to the national guidelines (Italian decree ‘4 March 2014, n.26’). All experimental procedures were approved by the FIRC Institute of Molecular Oncology Institutional Animal Care and Use Committee and Italian Ministry of Health.

In situ hybridization

Zebrafish embryos were fixed in 4% <span class="Chemical">PFA at 4 °C O/N. Digoxigenin (DIG)-labeled antisense probes were synthesized with DIG RNA labelling MIX kit (Roche) using a DNA template amplified from cDNA using specific primers: snap29 T3 5′-taatacgactcactatagggagaATGTCTGCCTACCCCAAATC-3′, snap29 T7 5′-attaaccctcactaaagggagaACATCTCATCCAGGTTTCT-3′. After hybridization, detection was performed with anti-DIG antibody coupled to alkaline phosphatase (Roche) and specimen were imaged with Olympus SZX12 stereomicroscope.

CRISPR/Cas9 snap29 mutagenesis in zebrafish and sa13359 genotyping

The short guide (sg) RNA AGGCCAGTCATCCAAACCTCAGG targeting the exon 4 of snap29 <span class="Species">zebrafish gene, was synthetized in vitro starting from the annealing of oligonucleotide 1 5′-TAGGCCAGTCATCCAAACCTC-3′ and oligonucleotide 2 5′-AAACGAGGTTTGGATGACTGG-3′ previously diluted in annealing buffer (10 mM Tris, pH 7.5–8, 50 mM NaCl, 1 mM EDTA) to reach the final concentration of 100 mM. After having mixed the oligos together in equal proportion, they were heated at 95 °C for 3–5 minutes and cooled at room temperature for 60 minutes. The resulting sgRNA was cloned in a DR274 vector (Addgene) and RNA in vitro transcription was performed with a standard kit (MEGAscript T7 Transcription Kit, Ambion) using the linearized DR274 plasmid as template. The sgRNA was injected together with the Cas9 purified protein (prepared by IFOM Biochemistry unit) in zebrafish embryos and mosaic animals were obtained. To monitor the presence of mutations, mosaic animals were subjected to the mismatch sensitive endonuclease T7 (T7E) (NEB) assay. Briefly, genomic DNA (gDNA) was extracted from caudal fin biopsies (fin clip) of adult animals, and a fragment of 500 bp containing the sgRNA complementary region was amplified by PCR with the specific primers forward 5′-ACCCCAAATCCCACAATCCT-3′ and reverse 5′-GGCGTAACTAGGTTCATTAGGG-3′. The resulting PCR products were subjected to denaturing/annealing steps (95 °C 2 min, −2 °C/s to 85 °C, −0.1 °C/s to 25 °C, 16 °C) and digested by T7E. To isolate potential founders bearing mutations in the germline, mosaic animals were outcrossed to wild type (AB) animals. A pool of 10 embryos derived from each single cross were subjected to T7E assay. To establish <span class="Gene">snap29 mutant strains, founder animals were then crossed with AB animals. When heterozygous offspn>ring reached adulthood by fin clip, gDNA from 20 animals was extracted, amplified with the primers above, and sequenced (Cogentech Sequencing Facility). gDNA extracted from heterozygous animals obtained from the outcross of the <span class="Gene">snap29 mutant strain <span class="Chemical">sa13359 (generated with ENU at Sanger Institute)[52] with AB animals was sequenced using the same procedure described above.

Generation and injection of GFP-snap29

To generate the GFP-<span class="Gene">snap29 plasmid used for snap29 mutant rescue, the zebrafish snap29 coding sequence was amplified using as template 24 hpf embryo cDNA and as primers BglII-Snap29 forward 5′-TCGAGAAGATCTATGTCTGCCTACCCCAAATCCC-3′ and XhoI-Snap29 reverse 5′-ATCGCCCTCGAGCTATTTAAGGCTTTTGAGCTG-3′. Both the PCR product and the pEGFP plasmid (Addgene) were digested using BglII and XhoI restriction enzymes (New England Biolab, NEB), purified using QIAquick Gel Extraction Kit protocol (QIAGEN) and subjected to ligation with T4 DNA ligase (NEB) according with manufacturer instructions. The plasmid obtained was used as a template for a second PCR using as primers BamHI-GFP forward 5′-ATCGCGGGATCCATGTGAGCAAGGGCGAGG-3′ and XhoI-Snap29 reverse. Both PCR product and pCS2 plasmid (Addgene) were digested with BamHI and XhoI restriction enzymes, purified and subjected to ligation with T4 DNA ligase (NEB). pCS2 GFP-<span class="Gene">snap29 was used as templates to synthesize mRNAs using MAXIscript <span class="Chemical">SP6 Transcription Kit (Ambion). 200 pg of mRNA were injected in one-cell stage embryos.

RNA extraction from zebrafish, cDNA synthesis, qPCR and RT-PCR

Wild type zebrafish larvae (AB strain) were collected at 96 hpf and RNA was extracted using <span class="Chemical">TRIZOL Reagent (Invitrogen) and RNAse Mini kit (QIAGEN). To avoid genomic DNA contamination, samples were digested with RQ1 RNase-Free DNase (Promega). The cDNA was retrotranscribed from 1 μg of RNA using SuperScript VILO cDNA Synthesis kit (Invitrogen), according to manufacturer instructions. 500 ng of cDNA were used as template for real time PCR (qPCR) reactions performed by Cogentech Real Time Quantitative PCR service using the following primers: snap29 forward 5′-ATCTGGGACAACTTGGGCAACT-3′, snap29 reverse 5′-GAGCGTCCAGAGAAATGTCC-3′, GAPDH forward 5′-TCAGTCCACTCACACCAAGTG-3′, GAPDH reverse 5′-CGACCGAATCCGTTAATACC-3′, snap23.1 forward 5′-TGTATCCAGCCAACCGACTG-3′, snap23.1 reverse 5′-GAAGTTTGTTGGCTCGCTGG-3′, snap23.2 forward 5′-AATCCCAGTCCAGCGTGATG-3′, snap23.2 reverse 5′-GTGGGCTTCAGTCTGGAACA, snap25a forward 5′-AGCAGCTCAGTCCCTACAGA-3′, snap25a reverse 5′-TGGTCCATTCCCTCCTCGAT-3′, snap25b forward 5′-GCTGGGCGATGAATCTTTGG-3′, snap25b reverse 5′-CCCGACCTGCTCCAAATTCT-3′, snap47 forward 5′-CTTATCTCGCACCACCCTCC-3′, snap47 reverse 5′-CAGACTTGGCCTCCTGATGG-3′.

Genomic DNA extraction from zebrafish embryos

24 hpf embryos were dechorionated with 1 mg/ml Pronase (Sigma-Aldrich) for 15 minutes at 37 °C. To dechorionate 50 embryos, 50 μl of lysis buffer (Tris-HCl 10 mM pH 8.0, <span class="Chemical">EDTA 1 mM, 0.3% Tween, 0.3% NP40) were added. Incubation lasted 10 minutes at 98 °C followed by the ice cooling. 5 μl of Proteinase K 10 mg/ml (Sigma-Aldrich) were added and embryos were incubated at 55 °C O/N. The second day, 145 μl of sterile water were added, followed by 20 μl of Sodium Acetate and 200 μl of Phenol. Samples were mixed by inverting them and centrifuged at 13000 rpm for 1 minute. Supernatant was collected and precipitated O/N with 100% ethanol at −20 °C. The third day, samples were centrifuged for 30 minutes at 4 °C and recovered pellets were washed with 75% ethanol, centrifuged again for 5 minutes and resuspended in 20 μl of DNAse-free water.

Hematoxylin and eosin staining and immunostaining on paraffin sections

Larvae were fixed O/N at 4 °C in 4% PFA diluted in PBS and positioned in a 7 × 7 × 6 mm plastic base-molds (Kaltek) containing 1.2% low-melting agarose in PBS. Before agarose solidification, larvae were correctly oriented. After agarose block solidification, larvae were removed from the base mold and immersed in 70% ethanol. After dehydration, agarose blocks were subjected to paraffin embedding by Leica ASP300 S Fully Enclosed Tissue Processor and 5 μm thick sections were cut using a manual rotatory microtome (Leica). Sections were deparaffinized in histolemon for 5 minutes, hyd<span class="Species">rated with 100%, 95% and 80% ethanol, respectively for 5 minutes each for 3 times, and finally rinsed with distilled water. Sections were stained with Harris hematoxilin solution for 2 minutes, washed in running <span class="Chemical">water for 5 minutes, counterstained with Eosin-Y solution for 7 seconds and washed in running tap water for 5 minutes. Sections were dehydrated with 95% ethanol and 100% ethanol for 5 minutes two times. Then, they were cleared two times with xylene for 5 minutes and mounted on a glass slide. Sections were finally imaged using a Nikon Eclipse 9i microscope, respectively with 20× and 100× objectives. For immunostaining, sections were incubated in sodium citrate buffer (2.94 mg/ml <span class="Chemical">tri-sodium citrate pH 6, 0.05% Tween 20) at 95 °C for 45 minutes and cooled at RT for 1 hour under chemical hood. Sections were then incubated in blocking solution (2% fetal bovine serum, 2 g bovine serum albumin, 0.05% Tween 20 in PBS 1X adjusted at 7.2 pH) for 1 hour at RT followed by primary antibodies diluted in blocking solution O/N. Samples were rinsed in PBS 1X three times for 5 minutes. Secondary antibodies diluted in PBS 1X were added and incubated for 1 hour and then washed three times with PBS 1X. Slides were incubated with DAPI for 5 minutes at RT, rinsed in PBS 1X three times for 5 minutes and mounted on a glass slide in 50% glycerol. The following primary antibodies were used: rabbit anti-p62 1:1000 (Enzo Life Science), mouse anti-pH3 1:1000 (Abcam), rabbit anti-cleaved Caspase 3 1:100 (Cell Signaling). Alexa fluor 488 and 647 conjugated (Invitrogen) were used as secondary antibodies.

Zebrafish whole-mount immunostaining

Embryos or larvae were fixed O/N at 4 °C with 4% PFA diluted in <span class="Chemical">PBS 1X and rinsed 3 times with PBS 1X. Embryos older than 24 hpf were treated with 0.25% trypsin (Sigma-Aldrich) at RT for a range of time between 2 minutes (for 24 hpf embryos) up to 60 minute (for 5 dpf larvae). Samples were then rinsed 3 times for 5 minutes with washing buffer (1% Triton-X100, 0.2% DMSO in PBS 1X) and incubated for at least 1 hour in blocking buffer (0.1% Triton X-100, 1% DMSO, 5% normal goat serum in PBS 1X) on a shaker. Subsequently, embryos were incubated with primary antibodies diluted in blocking buffer O/N at 4 °C. The following day, samples were rinsed rapidly twice with washing buffer and at least 3 washes of 1–2 hours each with washing buffer were performed. Samples were incubated in blocking buffer for 30 minutes followed by secondary antibodies diluted in blocking buffer O/N at 4 °C. The final day, samples were rapidly rinsed 2 times with washing buffer and two washes of 5 minutes each with PBS 1X were performed. Samples were incubated 10 minutes with DAPI, rapidly rinsed with PBS 1X and mounted on a glass slide in 85% glycerol. The following primary antibodies were used: mouse anti-Myosin heavy chain (all-Myo) 1:20 (Developmental Studies Hybridoma Bank), <span class="Species">rabbit anti-cleaved Caspase 3 1:200 (Cell Signaling), chicken anti-GFP 1:1000 (Abcam), mouse anti-pH3 1:1000 (Abcam). Alexa fluor 488, 543 and 647 (Invitrogen) were used as secondary antibodies.

Touch-evoked response assay

AB and snap29 mutant 6 <span class="Chemical">dpf larvae were mechanically stimulated with a plastic tip and recorded for 1 minute with a NIKON DS-5MC digital camera, mounted on a NIKON SMZ-1500 stereomicroscope. 6 larvae for each condition were used and only the first 5 stimuli were considered for quantification. Statistical analysis was performed with Prism Software.

Rhodamine Dextran food preparation

Rhodamin-dextran was mixed with two different larval foods commonly used for the larval feeding. In particular, 100 mg of “Larval AP100 food” (microparticles size < 100 microns), 100 mg of JBL “Novo Tom” lyophilized artemia and 40 μl of 20 mg/ml Rhodamin-Dextran 10000 MW (Invitrogen) were added to 360 μl of Milli-Q water. The mixture was dropped on a glass slide and dried O/N at RT, protected from light exposure, then reduced to a fine powder with a pestle and administered to larvae by dissolving it on the water surface.

Morpholino injections

Zebrafish embryos were microinjected with an Olympus SZX9 and a Picospn>ritzer III microinjector (Parker Instrumentation). Injection mixes were composed of Danieau solution 1X (<span class="Chemical">NaCl 58 mM, KCl 0.7 mM, MgSO4 0.4 mM, Ca(NO3)2 0.6 mM, HEPES 5.0 mM, pH 7.6), Phenol red 0.1% and Morpholino (MO) antisense oligos (Gene Tools). Each embryo was injected respectively with 1.7 ng of splice blocking snap29 MO[14], 1.7 ng of splice-blocking snap29 together with 200 pg GFP-snap29 mRNA for the rescue, 3 ng of 5′-UTR snap25 a,b MO, or 3 ng of ATG bdnf MO[51].

Twitching assay

<span class="Chemical">Spontaneous motility assay (twitching assay) was performed using 26 hpf embryos in 3.5 mm Petri dish by recording embryos for 1 minute with a NIKON DS-5MC <span class="Chemical">digital camera mounted on a NIKON SMZ-1500 stereomicroscope.

Electron microscopy

7 dpf larvae were fixed for 2 hours at RT with a mixture of 4% <span class="Chemical">paraformaldehyde and 2.5% glutaraldehyde (EMS, USA) in 0.2 M sodium cacodylate pH 7.2, followed by 6 washes in 0.2 sodium cacodylate pH 7.2 at RT. Samples were then incubated in a 1:1 mixture of 2% osmium tetraoxide and 3% potassium ferrocyanide for 1 hour at RT followed by 6 times rinsing in 0.2 M cacodylate buffer. Samples were sequentially treated with 0.3% thiocarbohydrazide in 0.2 M cacodylate buffer for 10 minutes and 1% OsO4 in 0.2 M cacodylate buffer (pH 6.9) for 30 minutes. Then, samples were rinsed with 0.1 M sodium cacodylate (pH 6.9) buffer until all traces of the yellow osmium fixative had been removed. Then they were washed in de-ionized water, treated with 1% uranyl acetate in water for 1 h and washed in water again. Samples were subsequently subjected to dehydratation in ethanol followed by acetone, and embedded in Epoxy resin at RT, which was polymerized for at least 72 hours in a 60 °C oven. Embedded samples were sectioned with a diamond knife (Diatome, Switzerland) using ultramicrotome (Leica EM UC7; Leica Microsystems, Vienna). Sections were analyzed with a Tecnai 20 High Voltage EM (FEI, Thermo Fisher Scientific, Eindhoven, The Netherlands) operating at 200 kV[53]. Electron microscopic examination was performed as previously described[54-56].

Measurements

Quantifications were performed with Fiji. Prism GraphPad was used for statistical analyses. Choice of statistical tests and sample size are detailed in figure legends. P-values are as follows: *P ≤ 0.05, **P ≤ 0.01, ***P ≤ 0.001, ****P ≤ 0.0001. Quantification of head and trunk area were performed by manually drawing a region of interest (ROI) and by measuring the number of enclosed pixels. The number of apoptotic and prolife<span class="Species">rative cells in each sample was determined by manually counting the number of apoptotic cells on maximum projection images of 0.5 μm z-stacks. The absolute number was normalized by the area, which was manually drawn around <span class="Chemical">DAPI signals. Myofibrils profile length was determined by manually drawing the profile of superficial myofibrils stained with the anti-Myosin antibody. Twitching assay was quantified by drawing a ROI around each embryo and by counting manually the number of spontaneous movements per minute. ROI files for each experiment are available upon request. supplementary data movieS1 movieS2 movieS3 movieS4 movieS5 movieS6 movieS7 movieS8 movieS9 movieS10
  54 in total

Review 1.  Intracellular cholesterol trafficking: role of the NPC1 protein.

Authors:  E J Blanchette-Mackie
Journal:  Biochim Biophys Acta       Date:  2000-06-26

Review 2.  The epidermal lamellar body: a fascinating secretory organelle.

Authors:  Manigé Fartasch
Journal:  J Invest Dermatol       Date:  2004-05       Impact factor: 8.551

3.  Biogenesis of multilamellar bodies via autophagy.

Authors:  M Hariri; G Millane; M P Guimond; G Guay; J W Dennis; I R Nabi
Journal:  Mol Biol Cell       Date:  2000-01       Impact factor: 4.138

4.  Visualization of cranial motor neurons in live transgenic zebrafish expressing green fluorescent protein under the control of the islet-1 promoter/enhancer.

Authors:  S Higashijima; Y Hotta; H Okamoto
Journal:  J Neurosci       Date:  2000-01-01       Impact factor: 6.167

5.  The lipid composition of autophagic vacuoles regulates expression of multilamellar bodies.

Authors:  Patrick Lajoie; Ginette Guay; James W Dennis; Ivan R Nabi
Journal:  J Cell Sci       Date:  2005-04-19       Impact factor: 5.285

6.  Comparative functional genomics revealed conservation and diversification of three enhancers of the isl1 gene for motor and sensory neuron-specific expression.

Authors:  Osamu Uemura; Yohei Okada; Hideki Ando; Mickael Guedj; Shin-Ichi Higashijima; Takuya Shimazaki; Naoichi Chino; Hideyuki Okano; Hitoshi Okamoto
Journal:  Dev Biol       Date:  2005-02-15       Impact factor: 3.582

7.  SNAP-29: a general SNARE protein that inhibits SNARE disassembly and is implicated in synaptic transmission.

Authors:  Q Su; S Mochida; J H Tian; R Mehta; Z H Sheng
Journal:  Proc Natl Acad Sci U S A       Date:  2001-11-13       Impact factor: 11.205

8.  The SNARE protein SNAP-25 is linked to fast calcium triggering of exocytosis.

Authors:  Jakob B Sørensen; Ulf Matti; Shun-Hui Wei; Ralf B Nehring; Thomas Voets; Uri Ashery; Thomas Binz; Erwin Neher; Jens Rettig
Journal:  Proc Natl Acad Sci U S A       Date:  2002-02-05       Impact factor: 11.205

9.  Recapitulation of the Roberts syndrome cellular phenotype by inhibition of INCENP, ZWINT-1 and ZW10 genes.

Authors:  Antonio Musio; Tullio Mariani; Cristina Montagna; Desirèe Zambroni; Cesare Ascoli; Thomas Ried; Paolo Vezzoni
Journal:  Gene       Date:  2004-04-28       Impact factor: 3.688

10.  Dicumarol, an inhibitor of ADP-ribosylation of CtBP3/BARS, fragments golgi non-compact tubular zones and inhibits intra-golgi transport.

Authors:  Alexander A Mironov; Antonino Colanzi; Roman S Polishchuk; Galina V Beznoussenko; Alexander A Mironov; Aurora Fusella; Giuseppe Di Tullio; Maria Giuseppina Silletta; Daniela Corda; Maria Antonietta De Matteis; Alberto Luini
Journal:  Eur J Cell Biol       Date:  2004-07       Impact factor: 4.492

View more
  10 in total

1.  Autophagy Is Required for Maturation of Surfactant-Containing Lamellar Bodies in the Lung and Swim Bladder.

Authors:  Hideaki Morishita; Yuki Kanda; Takeshi Kaizuka; Haruka Chino; Kazuki Nakao; Yoshimi Miki; Yoshitaka Taketomi; Jun-Lin Guan; Makoto Murakami; Atsu Aiba; Noboru Mizushima
Journal:  Cell Rep       Date:  2020-12-08       Impact factor: 9.423

Review 2.  Nuclear and Cytoplasmatic Players in Mitochondria-Related CNS Disorders: Chromatin Modifications and Subcellular Trafficking.

Authors:  Matteo Gasparotto; Yi-Shin Lee; Alessandra Palazzi; Marcella Vacca; Francesco Filippini
Journal:  Biomolecules       Date:  2022-04-23

3.  New Cohort of Patients With CEDNIK Syndrome Expands the Phenotypic and Genotypic Spectra.

Authors:  Annelise Y Mah-Som; Cristina Skrypnyk; Andrea Guerin; Raafat Hammad Seroor Jadah; Vinayak Nivrutti Vardhan; Robert C McKinstry; Marwan S Shinawi
Journal:  Neurol Genet       Date:  2021-01-12

4.  Guidelines for the use and interpretation of assays for monitoring autophagy (4th edition)1.

Authors:  Daniel J Klionsky; Amal Kamal Abdel-Aziz; Sara Abdelfatah; Mahmoud Abdellatif; Asghar Abdoli; Steffen Abel; Hagai Abeliovich; Marie H Abildgaard; Yakubu Princely Abudu; Abraham Acevedo-Arozena; Iannis E Adamopoulos; Khosrow Adeli; Timon E Adolph; Annagrazia Adornetto; Elma Aflaki; Galila Agam; Anupam Agarwal; Bharat B Aggarwal; Maria Agnello; Patrizia Agostinis; Javed N Agrewala; Alexander Agrotis; Patricia V Aguilar; S Tariq Ahmad; Zubair M Ahmed; Ulises Ahumada-Castro; Sonja Aits; Shu Aizawa; Yunus Akkoc; Tonia Akoumianaki; Hafize Aysin Akpinar; Ahmed M Al-Abd; Lina Al-Akra; Abeer Al-Gharaibeh; Moulay A Alaoui-Jamali; Simon Alberti; Elísabet Alcocer-Gómez; Cristiano Alessandri; Muhammad Ali; M Abdul Alim Al-Bari; Saeb Aliwaini; Javad Alizadeh; Eugènia Almacellas; Alexandru Almasan; Alicia Alonso; Guillermo D Alonso; Nihal Altan-Bonnet; Dario C Altieri; Élida M C Álvarez; Sara Alves; Cristine Alves da Costa; Mazen M Alzaharna; Marialaura Amadio; Consuelo Amantini; Cristina Amaral; Susanna Ambrosio; Amal O Amer; Veena Ammanathan; Zhenyi An; Stig U Andersen; Shaida A Andrabi; Magaiver Andrade-Silva; Allen M Andres; Sabrina Angelini; David Ann; Uche C Anozie; Mohammad Y Ansari; Pedro Antas; Adam Antebi; Zuriñe Antón; Tahira Anwar; Lionel Apetoh; Nadezda Apostolova; Toshiyuki Araki; Yasuhiro Araki; Kohei Arasaki; Wagner L Araújo; Jun Araya; Catherine Arden; Maria-Angeles Arévalo; Sandro Arguelles; Esperanza Arias; Jyothi Arikkath; Hirokazu Arimoto; Aileen R Ariosa; Darius Armstrong-James; Laetitia Arnauné-Pelloquin; Angeles Aroca; Daniela S Arroyo; Ivica Arsov; Rubén Artero; Dalia Maria Lucia Asaro; Michael Aschner; Milad Ashrafizadeh; Osnat Ashur-Fabian; Atanas G Atanasov; Alicia K Au; Patrick Auberger; Holger W Auner; Laure Aurelian; Riccardo Autelli; Laura Avagliano; Yenniffer Ávalos; Sanja Aveic; Célia Alexandra Aveleira; Tamar Avin-Wittenberg; Yucel Aydin; Scott Ayton; Srinivas Ayyadevara; Maria Azzopardi; Misuzu Baba; Jonathan M Backer; Steven K Backues; Dong-Hun Bae; Ok-Nam Bae; Soo Han Bae; Eric H Baehrecke; Ahruem Baek; Seung-Hoon Baek; Sung Hee Baek; Giacinto Bagetta; Agnieszka Bagniewska-Zadworna; Hua Bai; Jie Bai; Xiyuan Bai; Yidong Bai; Nandadulal Bairagi; Shounak Baksi; Teresa Balbi; Cosima T Baldari; Walter Balduini; Andrea Ballabio; Maria Ballester; Salma Balazadeh; Rena Balzan; Rina Bandopadhyay; Sreeparna Banerjee; Sulagna Banerjee; Ágnes Bánréti; Yan Bao; Mauricio S Baptista; Alessandra Baracca; Cristiana Barbati; Ariadna Bargiela; Daniela Barilà; Peter G Barlow; Sami J Barmada; Esther Barreiro; George E Barreto; Jiri Bartek; Bonnie Bartel; Alberto Bartolome; Gaurav R Barve; Suresh H Basagoudanavar; Diane C Bassham; Robert C Bast; Alakananda Basu; Henri Batoko; Isabella Batten; Etienne E Baulieu; Bradley L Baumgarner; Jagadeesh Bayry; Rupert Beale; Isabelle Beau; Florian Beaumatin; Luiz R G Bechara; George R Beck; Michael F Beers; Jakob Begun; Christian Behrends; Georg M N Behrens; Roberto Bei; Eloy Bejarano; Shai Bel; Christian Behl; Amine Belaid; Naïma Belgareh-Touzé; Cristina Bellarosa; Francesca Belleudi; Melissa Belló Pérez; Raquel Bello-Morales; Jackeline Soares de Oliveira Beltran; Sebastián Beltran; Doris Mangiaracina Benbrook; Mykolas Bendorius; Bruno A Benitez; Irene Benito-Cuesta; Julien Bensalem; Martin W Berchtold; Sabina Berezowska; Daniele Bergamaschi; Matteo Bergami; Andreas Bergmann; Laura Berliocchi; Clarisse Berlioz-Torrent; Amélie Bernard; Lionel Berthoux; Cagri G Besirli; Sebastien Besteiro; Virginie M Betin; Rudi Beyaert; Jelena S Bezbradica; Kiran Bhaskar; Ingrid Bhatia-Kissova; Resham Bhattacharya; Sujoy Bhattacharya; Shalmoli Bhattacharyya; Md Shenuarin Bhuiyan; Sujit Kumar Bhutia; Lanrong Bi; Xiaolin Bi; Trevor J Biden; Krikor Bijian; Viktor A Billes; Nadine Binart; Claudia Bincoletto; Asa B Birgisdottir; Geir Bjorkoy; Gonzalo Blanco; Ana Blas-Garcia; Janusz Blasiak; Robert Blomgran; Klas Blomgren; Janice S Blum; Emilio Boada-Romero; Mirta Boban; Kathleen Boesze-Battaglia; Philippe Boeuf; Barry Boland; Pascale Bomont; Paolo Bonaldo; Srinivasa Reddy Bonam; Laura Bonfili; Juan S Bonifacino; Brian A Boone; Martin D Bootman; Matteo Bordi; Christoph Borner; Beat C Bornhauser; Gautam Borthakur; Jürgen Bosch; Santanu Bose; Luis M Botana; Juan Botas; Chantal M Boulanger; Michael E Boulton; Mathieu Bourdenx; Benjamin Bourgeois; Nollaig M Bourke; Guilhem Bousquet; Patricia Boya; Peter V Bozhkov; Luiz H M Bozi; Tolga O Bozkurt; Doug E Brackney; Christian H Brandts; Ralf J Braun; Gerhard H Braus; Roberto Bravo-Sagua; José M Bravo-San Pedro; Patrick Brest; Marie-Agnès Bringer; Alfredo Briones-Herrera; V Courtney Broaddus; Peter Brodersen; Jeffrey L Brodsky; Steven L Brody; Paola G Bronson; Jeff M Bronstein; Carolyn N Brown; Rhoderick E Brown; Patricia C Brum; John H Brumell; Nicola Brunetti-Pierri; Daniele Bruno; Robert J Bryson-Richardson; Cecilia Bucci; Carmen Buchrieser; Marta Bueno; Laura Elisa Buitrago-Molina; Simone Buraschi; Shilpa Buch; J Ross Buchan; Erin M Buckingham; Hikmet Budak; Mauricio Budini; Geert Bultynck; Florin Burada; Joseph R Burgoyne; M Isabel Burón; Victor Bustos; Sabrina Büttner; Elena Butturini; Aaron Byrd; Isabel Cabas; Sandra Cabrera-Benitez; Ken Cadwell; Jingjing Cai; Lu Cai; Qian Cai; Montserrat Cairó; Jose A Calbet; Guy A Caldwell; Kim A Caldwell; Jarrod A Call; Riccardo Calvani; Ana C Calvo; Miguel Calvo-Rubio Barrera; Niels Os Camara; Jacques H Camonis; Nadine Camougrand; Michelangelo Campanella; Edward M Campbell; François-Xavier Campbell-Valois; Silvia Campello; Ilaria Campesi; Juliane C Campos; Olivier Camuzard; Jorge Cancino; Danilo Candido de Almeida; Laura Canesi; Isabella Caniggia; Barbara Canonico; Carles Cantí; Bin Cao; Michele Caraglia; Beatriz Caramés; Evie H Carchman; Elena Cardenal-Muñoz; Cesar Cardenas; Luis Cardenas; Sandra M Cardoso; Jennifer S Carew; Georges F Carle; Gillian Carleton; Silvia Carloni; Didac Carmona-Gutierrez; Leticia A Carneiro; Oliana Carnevali; Julian M Carosi; Serena Carra; Alice Carrier; Lucie Carrier; Bernadette Carroll; A Brent Carter; Andreia Neves Carvalho; Magali Casanova; Caty Casas; Josefina Casas; Chiara Cassioli; Eliseo F Castillo; Karen Castillo; Sonia Castillo-Lluva; Francesca Castoldi; Marco Castori; Ariel F Castro; Margarida Castro-Caldas; Javier Castro-Hernandez; Susana Castro-Obregon; Sergio D Catz; Claudia Cavadas; Federica Cavaliere; Gabriella Cavallini; Maria Cavinato; Maria L Cayuela; Paula Cebollada Rica; Valentina Cecarini; Francesco Cecconi; Marzanna Cechowska-Pasko; Simone Cenci; Victòria Ceperuelo-Mallafré; João J Cerqueira; Janete M Cerutti; Davide Cervia; Vildan Bozok Cetintas; Silvia Cetrullo; Han-Jung Chae; Andrei S Chagin; Chee-Yin Chai; Gopal Chakrabarti; Oishee Chakrabarti; Tapas Chakraborty; Trinad Chakraborty; Mounia Chami; Georgios Chamilos; David W Chan; Edmond Y W Chan; Edward D Chan; H Y Edwin Chan; Helen H Chan; Hung Chan; Matthew T V Chan; Yau Sang Chan; Partha K Chandra; Chih-Peng Chang; Chunmei Chang; Hao-Chun Chang; Kai Chang; Jie Chao; Tracey Chapman; Nicolas Charlet-Berguerand; Samrat Chatterjee; Shail K Chaube; Anu Chaudhary; Santosh Chauhan; Edward Chaum; Frédéric Checler; Michael E Cheetham; Chang-Shi Chen; Guang-Chao Chen; Jian-Fu Chen; Liam L Chen; Leilei Chen; Lin Chen; Mingliang Chen; Mu-Kuan Chen; Ning Chen; Quan Chen; Ruey-Hwa Chen; Shi Chen; Wei Chen; Weiqiang Chen; Xin-Ming Chen; Xiong-Wen Chen; Xu Chen; Yan Chen; Ye-Guang Chen; Yingyu Chen; Yongqiang Chen; Yu-Jen Chen; Yue-Qin Chen; Zhefan Stephen Chen; Zhi Chen; Zhi-Hua Chen; Zhijian J Chen; Zhixiang Chen; Hanhua Cheng; Jun Cheng; Shi-Yuan Cheng; Wei Cheng; Xiaodong Cheng; Xiu-Tang Cheng; Yiyun Cheng; Zhiyong Cheng; Zhong Chen; Heesun Cheong; Jit Kong Cheong; Boris V Chernyak; Sara Cherry; Chi Fai Randy Cheung; Chun Hei Antonio Cheung; King-Ho Cheung; Eric Chevet; Richard J Chi; Alan Kwok Shing Chiang; Ferdinando Chiaradonna; Roberto Chiarelli; Mario Chiariello; Nathalia Chica; Susanna Chiocca; Mario Chiong; Shih-Hwa Chiou; Abhilash I Chiramel; Valerio Chiurchiù; Dong-Hyung Cho; Seong-Kyu Choe; Augustine M K Choi; Mary E Choi; Kamalika Roy Choudhury; Norman S Chow; Charleen T Chu; Jason P Chua; John Jia En Chua; Hyewon Chung; Kin Pan Chung; Seockhoon Chung; So-Hyang Chung; Yuen-Li Chung; Valentina Cianfanelli; Iwona A Ciechomska; Mariana Cifuentes; Laura Cinque; Sebahattin Cirak; Mara Cirone; Michael J Clague; Robert Clarke; Emilio Clementi; Eliana M Coccia; Patrice Codogno; Ehud Cohen; Mickael M Cohen; Tania Colasanti; Fiorella Colasuonno; Robert A Colbert; Anna Colell; Miodrag Čolić; Nuria S Coll; Mark O Collins; María I Colombo; Daniel A Colón-Ramos; Lydie Combaret; Sergio Comincini; Márcia R Cominetti; Antonella Consiglio; Andrea Conte; Fabrizio Conti; Viorica Raluca Contu; Mark R Cookson; Kevin M Coombs; Isabelle Coppens; Maria Tiziana Corasaniti; Dale P Corkery; Nils Cordes; Katia Cortese; Maria do Carmo Costa; Sarah Costantino; Paola Costelli; Ana Coto-Montes; Peter J Crack; Jose L Crespo; Alfredo Criollo; Valeria Crippa; Riccardo Cristofani; Tamas Csizmadia; Antonio Cuadrado; Bing Cui; Jun Cui; Yixian Cui; Yong Cui; Emmanuel Culetto; Andrea C Cumino; Andrey V Cybulsky; Mark J Czaja; Stanislaw J Czuczwar; Stefania D'Adamo; Marcello D'Amelio; Daniela D'Arcangelo; Andrew C D'Lugos; Gabriella D'Orazi; James A da Silva; Hormos Salimi Dafsari; Ruben K Dagda; Yasin Dagdas; Maria Daglia; Xiaoxia Dai; Yun Dai; Yuyuan Dai; Jessica Dal Col; Paul Dalhaimer; Luisa Dalla Valle; Tobias Dallenga; Guillaume Dalmasso; Markus Damme; Ilaria Dando; Nico P Dantuma; April L Darling; Hiranmoy Das; Srinivasan Dasarathy; Santosh K Dasari; Srikanta Dash; Oliver Daumke; Adrian N Dauphinee; Jeffrey S Davies; Valeria A Dávila; Roger J Davis; Tanja Davis; Sharadha Dayalan Naidu; Francesca De Amicis; Karolien De Bosscher; Francesca De Felice; Lucia De Franceschi; Chiara De Leonibus; Mayara G de Mattos Barbosa; Guido R Y De Meyer; Angelo De Milito; Cosimo De Nunzio; Clara De Palma; Mauro De Santi; Claudio De Virgilio; Daniela De Zio; Jayanta Debnath; Brian J DeBosch; Jean-Paul Decuypere; Mark A Deehan; Gianluca Deflorian; James DeGregori; Benjamin Dehay; Gabriel Del Rio; Joe R Delaney; Lea M D Delbridge; Elizabeth Delorme-Axford; M Victoria Delpino; Francesca Demarchi; Vilma Dembitz; Nicholas D Demers; Hongbin Deng; Zhiqiang Deng; Joern Dengjel; Paul Dent; Donna Denton; Melvin L DePamphilis; Channing J Der; Vojo Deretic; Albert Descoteaux; Laura Devis; Sushil Devkota; Olivier Devuyst; Grant Dewson; Mahendiran Dharmasivam; Rohan Dhiman; Diego di Bernardo; Manlio Di Cristina; Fabio Di Domenico; Pietro Di Fazio; Alessio Di Fonzo; Giovanni Di Guardo; Gianni M Di Guglielmo; Luca Di Leo; Chiara Di Malta; Alessia Di Nardo; Martina Di Rienzo; Federica Di Sano; George Diallinas; Jiajie Diao; Guillermo Diaz-Araya; Inés Díaz-Laviada; Jared M Dickinson; Marc Diederich; Mélanie Dieudé; Ivan Dikic; Shiping Ding; Wen-Xing Ding; Luciana Dini; Jelena Dinić; Miroslav Dinic; Albena T Dinkova-Kostova; Marc S Dionne; Jörg H W Distler; Abhinav Diwan; Ian M C Dixon; Mojgan Djavaheri-Mergny; Ina Dobrinski; Oxana Dobrovinskaya; Radek Dobrowolski; Renwick C J Dobson; Jelena Đokić; Serap Dokmeci Emre; Massimo Donadelli; Bo Dong; Xiaonan Dong; Zhiwu Dong; Gerald W Dorn Ii; Volker Dotsch; Huan Dou; Juan Dou; Moataz Dowaidar; Sami Dridi; Liat Drucker; Ailian Du; Caigan Du; Guangwei Du; Hai-Ning Du; Li-Lin Du; André du Toit; Shao-Bin Duan; Xiaoqiong Duan; Sónia P Duarte; Anna Dubrovska; Elaine A Dunlop; Nicolas Dupont; Raúl V Durán; Bilikere S Dwarakanath; Sergey A Dyshlovoy; Darius Ebrahimi-Fakhari; Leopold Eckhart; Charles L Edelstein; Thomas Efferth; Eftekhar Eftekharpour; Ludwig Eichinger; Nabil Eid; Tobias Eisenberg; N Tony Eissa; Sanaa Eissa; Miriam Ejarque; Abdeljabar El Andaloussi; Nazira El-Hage; Shahenda El-Naggar; Anna Maria Eleuteri; Eman S El-Shafey; Mohamed Elgendy; Aristides G Eliopoulos; María M Elizalde; Philip M Elks; Hans-Peter Elsasser; Eslam S Elsherbiny; Brooke M Emerling; N C Tolga Emre; Christina H Eng; Nikolai Engedal; Anna-Mart Engelbrecht; Agnete S T Engelsen; Jorrit M Enserink; Ricardo Escalante; Audrey Esclatine; Mafalda Escobar-Henriques; Eeva-Liisa Eskelinen; Lucile Espert; Makandjou-Ola Eusebio; Gemma Fabrias; Cinzia Fabrizi; Antonio Facchiano; Francesco Facchiano; Bengt Fadeel; Claudio Fader; Alex C Faesen; W Douglas Fairlie; Alberto Falcó; Bjorn H Falkenburger; Daping Fan; Jie Fan; Yanbo Fan; Evandro F Fang; Yanshan Fang; Yognqi Fang; Manolis Fanto; Tamar Farfel-Becker; Mathias Faure; Gholamreza Fazeli; Anthony O Fedele; Arthur M Feldman; Du Feng; Jiachun Feng; Lifeng Feng; Yibin Feng; Yuchen Feng; Wei Feng; Thais Fenz Araujo; Thomas A Ferguson; Álvaro F Fernández; Jose C Fernandez-Checa; Sonia Fernández-Veledo; Alisdair R Fernie; Anthony W Ferrante; Alessandra Ferraresi; Merari F Ferrari; Julio C B Ferreira; Susan Ferro-Novick; Antonio Figueras; Riccardo Filadi; Nicoletta Filigheddu; Eduardo Filippi-Chiela; Giuseppe Filomeni; Gian Maria Fimia; Vittorio Fineschi; Francesca Finetti; Steven Finkbeiner; Edward A Fisher; Paul B Fisher; Flavio Flamigni; Steven J Fliesler; Trude H Flo; Ida Florance; Oliver Florey; Tullio Florio; Erika Fodor; Carlo Follo; Edward A Fon; Antonella Forlino; Francesco Fornai; Paola Fortini; Anna Fracassi; Alessandro Fraldi; Brunella Franco; Rodrigo Franco; Flavia Franconi; Lisa B Frankel; Scott L Friedman; Leopold F Fröhlich; Gema Frühbeck; Jose M Fuentes; Yukio Fujiki; Naonobu Fujita; Yuuki Fujiwara; Mitsunori Fukuda; Simone Fulda; Luc Furic; Norihiko Furuya; Carmela Fusco; Michaela U Gack; Lidia Gaffke; Sehamuddin Galadari; Alessia Galasso; Maria F Galindo; Sachith Gallolu Kankanamalage; Lorenzo Galluzzi; Vincent Galy; Noor Gammoh; Boyi Gan; Ian G Ganley; Feng Gao; Hui Gao; Minghui Gao; Ping Gao; Shou-Jiang Gao; Wentao Gao; Xiaobo Gao; Ana Garcera; Maria Noé Garcia; Verónica E Garcia; Francisco García-Del Portillo; Vega Garcia-Escudero; Aracely Garcia-Garcia; Marina Garcia-Macia; Diana García-Moreno; Carmen Garcia-Ruiz; Patricia García-Sanz; Abhishek D Garg; Ricardo Gargini; Tina Garofalo; Robert F Garry; Nils C Gassen; Damian Gatica; Liang Ge; Wanzhong Ge; Ruth Geiss-Friedlander; Cecilia Gelfi; Pascal Genschik; Ian E Gentle; Valeria Gerbino; Christoph Gerhardt; Kyla Germain; Marc Germain; David A Gewirtz; Elham Ghasemipour Afshar; Saeid Ghavami; Alessandra Ghigo; Manosij Ghosh; Georgios Giamas; Claudia Giampietri; Alexandra Giatromanolaki; Gary E Gibson; Spencer B Gibson; Vanessa Ginet; Edward Giniger; Carlotta Giorgi; Henrique Girao; Stephen E Girardin; Mridhula Giridharan; Sandy Giuliano; Cecilia Giulivi; Sylvie Giuriato; Julien Giustiniani; Alexander Gluschko; Veit Goder; Alexander Goginashvili; Jakub Golab; David C Goldstone; Anna Golebiewska; Luciana R Gomes; Rodrigo Gomez; Rubén Gómez-Sánchez; Maria Catalina Gomez-Puerto; Raquel Gomez-Sintes; Qingqiu Gong; Felix M Goni; Javier González-Gallego; Tomas Gonzalez-Hernandez; Rosa A Gonzalez-Polo; Jose A Gonzalez-Reyes; Patricia González-Rodríguez; Ing Swie Goping; Marina S Gorbatyuk; Nikolai V Gorbunov; Kıvanç Görgülü; Roxana M Gorojod; Sharon M Gorski; Sandro Goruppi; Cecilia Gotor; Roberta A Gottlieb; Illana Gozes; Devrim Gozuacik; Martin Graef; Markus H Gräler; Veronica Granatiero; Daniel Grasso; Joshua P Gray; Douglas R Green; Alexander Greenhough; Stephen L Gregory; Edward F Griffin; Mark W Grinstaff; Frederic Gros; Charles Grose; Angelina S Gross; Florian Gruber; Paolo Grumati; Tilman Grune; Xueyan Gu; Jun-Lin Guan; Carlos M Guardia; Kishore Guda; Flora Guerra; Consuelo Guerri; Prasun Guha; Carlos Guillén; Shashi Gujar; Anna Gukovskaya; Ilya Gukovsky; Jan Gunst; Andreas Günther; Anyonya R Guntur; Chuanyong Guo; Chun Guo; Hongqing Guo; Lian-Wang Guo; Ming Guo; Pawan Gupta; Shashi Kumar Gupta; Swapnil Gupta; Veer Bala Gupta; Vivek Gupta; Asa B Gustafsson; David D Gutterman; Ranjitha H B; Annakaisa Haapasalo; James E Haber; Aleksandra Hać; Shinji Hadano; Anders J Hafrén; Mansour Haidar; Belinda S Hall; Gunnel Halldén; Anne Hamacher-Brady; Andrea Hamann; Maho Hamasaki; Weidong Han; Malene Hansen; Phyllis I Hanson; Zijian Hao; Masaru Harada; Ljubica Harhaji-Trajkovic; Nirmala Hariharan; Nigil Haroon; James Harris; Takafumi Hasegawa; Noor Hasima Nagoor; Jeffrey A Haspel; Volker Haucke; Wayne D Hawkins; Bruce A Hay; Cole M Haynes; Soren B Hayrabedyan; Thomas S Hays; Congcong He; Qin He; Rong-Rong He; You-Wen He; Yu-Ying He; Yasser Heakal; Alexander M Heberle; J Fielding Hejtmancik; Gudmundur Vignir Helgason; Vanessa Henkel; Marc Herb; Alexander Hergovich; Anna Herman-Antosiewicz; Agustín Hernández; Carlos Hernandez; Sergio Hernandez-Diaz; Virginia Hernandez-Gea; Amaury Herpin; Judit Herreros; Javier H Hervás; Daniel Hesselson; Claudio Hetz; Volker T Heussler; Yujiro Higuchi; Sabine Hilfiker; Joseph A Hill; William S Hlavacek; Emmanuel A Ho; Idy H T Ho; Philip Wing-Lok Ho; Shu-Leong Ho; Wan Yun Ho; G Aaron Hobbs; Mark Hochstrasser; Peter H M Hoet; Daniel Hofius; Paul Hofman; Annika Höhn; Carina I Holmberg; Jose R Hombrebueno; Chang-Won Hong Yi-Ren Hong; Lora V Hooper; Thorsten Hoppe; Rastislav Horos; Yujin Hoshida; I-Lun Hsin; Hsin-Yun Hsu; Bing Hu; Dong Hu; Li-Fang Hu; Ming Chang Hu; Ronggui Hu; Wei Hu; Yu-Chen Hu; Zhuo-Wei Hu; Fang Hua; Jinlian Hua; Yingqi Hua; Chongmin Huan; Canhua Huang; Chuanshu Huang; Chuanxin Huang; Chunling Huang; Haishan Huang; Kun Huang; Michael L H Huang; Rui Huang; Shan Huang; Tianzhi Huang; Xing Huang; Yuxiang Jack Huang; Tobias B Huber; Virginie Hubert; Christian A Hubner; Stephanie M Hughes; William E Hughes; Magali Humbert; Gerhard Hummer; James H Hurley; Sabah Hussain; Salik Hussain; Patrick J Hussey; Martina Hutabarat; Hui-Yun Hwang; Seungmin Hwang; Antonio Ieni; Fumiyo Ikeda; Yusuke Imagawa; Yuzuru Imai; Carol Imbriano; Masaya Imoto; Denise M Inman; Ken Inoki; Juan Iovanna; Renato V Iozzo; Giuseppe Ippolito; Javier E Irazoqui; Pablo Iribarren; Mohd Ishaq; Makoto Ishikawa; Nestor Ishimwe; Ciro Isidoro; Nahed Ismail; Shohreh Issazadeh-Navikas; Eisuke Itakura; Daisuke Ito; Davor Ivankovic; Saška Ivanova; Anand Krishnan V Iyer; José M Izquierdo; Masanori Izumi; Marja Jäättelä; Majid Sakhi Jabir; William T Jackson; Nadia Jacobo-Herrera; Anne-Claire Jacomin; Elise Jacquin; Pooja Jadiya; Hartmut Jaeschke; Chinnaswamy Jagannath; Arjen J Jakobi; Johan Jakobsson; Bassam Janji; Pidder Jansen-Dürr; Patric J Jansson; Jonathan Jantsch; Sławomir Januszewski; Alagie Jassey; Steve Jean; Hélène Jeltsch-David; Pavla Jendelova; Andreas Jenny; Thomas E Jensen; Niels Jessen; Jenna L Jewell; Jing Ji; Lijun Jia; Rui Jia; Liwen Jiang; Qing Jiang; Richeng Jiang; Teng Jiang; Xuejun Jiang; Yu Jiang; Maria Jimenez-Sanchez; Eun-Jung Jin; Fengyan Jin; Hongchuan Jin; Li Jin; Luqi Jin; Meiyan Jin; Si Jin; Eun-Kyeong Jo; Carine Joffre; Terje Johansen; Gail V W Johnson; Simon A Johnston; Eija Jokitalo; Mohit Kumar Jolly; Leo A B Joosten; Joaquin Jordan; Bertrand Joseph; Dianwen Ju; Jeong-Sun Ju; Jingfang Ju; Esmeralda Juárez; Delphine Judith; Gábor Juhász; Youngsoo Jun; Chang Hwa Jung; Sung-Chul Jung; Yong Keun Jung; Heinz Jungbluth; Johannes Jungverdorben; Steffen Just; Kai Kaarniranta; Allen Kaasik; Tomohiro Kabuta; Daniel Kaganovich; Alon Kahana; Renate Kain; Shinjo Kajimura; Maria Kalamvoki; Manjula Kalia; Danuta S Kalinowski; Nina Kaludercic; Ioanna Kalvari; Joanna Kaminska; Vitaliy O Kaminskyy; Hiromitsu Kanamori; Keizo Kanasaki; Chanhee Kang; Rui Kang; Sang Sun Kang; Senthilvelrajan Kaniyappan; Tomotake Kanki; Thirumala-Devi Kanneganti; Anumantha G Kanthasamy; Arthi Kanthasamy; Marc Kantorow; Orsolya Kapuy; Michalis V Karamouzis; Md Razaul Karim; Parimal Karmakar; Rajesh G Katare; Masaru Kato; Stefan H E Kaufmann; Anu Kauppinen; Gur P Kaushal; Susmita Kaushik; Kiyoshi Kawasaki; Kemal Kazan; Po-Yuan Ke; Damien J Keating; Ursula Keber; John H Kehrl; Kate E Keller; Christian W Keller; Jongsook Kim Kemper; Candia M Kenific; Oliver Kepp; Stephanie Kermorgant; Andreas Kern; Robin Ketteler; Tom G Keulers; Boris Khalfin; Hany Khalil; Bilon Khambu; Shahid Y Khan; Vinoth Kumar Megraj Khandelwal; Rekha Khandia; Widuri Kho; Noopur V Khobrekar; Sataree Khuansuwan; Mukhran Khundadze; Samuel A Killackey; Dasol Kim; Deok Ryong Kim; Do-Hyung Kim; Dong-Eun Kim; Eun Young Kim; Eun-Kyoung Kim; Hak-Rim Kim; Hee-Sik Kim; Jeong Hun Kim; Jin Kyung Kim; Jin-Hoi Kim; Joungmok Kim; Ju Hwan Kim; Keun Il Kim; Peter K Kim; Seong-Jun Kim; Scot R Kimball; Adi Kimchi; Alec C Kimmelman; Tomonori Kimura; Matthew A King; Kerri J Kinghorn; Conan G Kinsey; Vladimir Kirkin; Lorrie A Kirshenbaum; Sergey L Kiselev; Shuji Kishi; Katsuhiko Kitamoto; Yasushi Kitaoka; Kaio Kitazato; Richard N Kitsis; Josef T Kittler; Ole Kjaerulff; Peter S Klein; Thomas Klopstock; Jochen Klucken; Helene Knævelsrud; Roland L Knorr; Ben C B Ko; Fred Ko; Jiunn-Liang Ko; Hotaka Kobayashi; Satoru Kobayashi; Ina Koch; Jan C Koch; Ulrich Koenig; Donat Kögel; Young Ho Koh; Masato Koike; Sepp D Kohlwein; Nur M Kocaturk; Masaaki Komatsu; Jeannette König; Toru Kono; Benjamin T Kopp; Tamas Korcsmaros; Gözde Korkmaz; Viktor I Korolchuk; Mónica Suárez Korsnes; Ali Koskela; Janaiah Kota; Yaichiro Kotake; Monica L Kotler; Yanjun Kou; Michael I Koukourakis; Evangelos Koustas; Attila L Kovacs; Tibor Kovács; Daisuke Koya; Tomohiro Kozako; Claudine Kraft; Dimitri Krainc; Helmut Krämer; Anna D Krasnodembskaya; Carole Kretz-Remy; Guido Kroemer; Nicholas T Ktistakis; Kazuyuki Kuchitsu; Sabine Kuenen; Lars Kuerschner; Thomas Kukar; Ajay Kumar; Ashok Kumar; Deepak Kumar; Dhiraj Kumar; Sharad Kumar; Shinji Kume; Caroline Kumsta; Chanakya N Kundu; Mondira Kundu; Ajaikumar B Kunnumakkara; Lukasz Kurgan; Tatiana G Kutateladze; Ozlem Kutlu; SeongAe Kwak; Ho Jeong Kwon; Taeg Kyu Kwon; Yong Tae Kwon; Irene Kyrmizi; Albert La Spada; Patrick Labonté; Sylvain Ladoire; Ilaria Laface; Frank Lafont; Diane C Lagace; Vikramjit Lahiri; Zhibing Lai; Angela S Laird; Aparna Lakkaraju; Trond Lamark; Sheng-Hui Lan; Ane Landajuela; Darius J R Lane; Jon D Lane; Charles H Lang; Carsten Lange; Ülo Langel; Rupert Langer; Pierre Lapaquette; Jocelyn Laporte; Nicholas F LaRusso; Isabel Lastres-Becker; Wilson Chun Yu Lau; Gordon W Laurie; Sergio Lavandero; Betty Yuen Kwan Law; Helen Ka-Wai Law; Rob Layfield; Weidong Le; Herve Le Stunff; Alexandre Y Leary; Jean-Jacques Lebrun; Lionel Y W Leck; Jean-Philippe Leduc-Gaudet; Changwook Lee; Chung-Pei Lee; Da-Hye Lee; Edward B Lee; Erinna F Lee; Gyun Min Lee; He-Jin Lee; Heung Kyu Lee; Jae Man Lee; Jason S Lee; Jin-A Lee; Joo-Yong Lee; Jun Hee Lee; Michael Lee; Min Goo Lee; Min Jae Lee; Myung-Shik Lee; Sang Yoon Lee; Seung-Jae Lee; Stella Y Lee; Sung Bae Lee; Won Hee Lee; Ying-Ray Lee; Yong-Ho Lee; Youngil Lee; Christophe Lefebvre; Renaud Legouis; Yu L Lei; Yuchen Lei; Sergey Leikin; Gerd Leitinger; Leticia Lemus; Shuilong Leng; Olivia Lenoir; Guido Lenz; Heinz Josef Lenz; Paola Lenzi; Yolanda León; Andréia M Leopoldino; Christoph Leschczyk; Stina Leskelä; Elisabeth Letellier; Chi-Ting Leung; Po Sing Leung; Jeremy S Leventhal; Beth Levine; Patrick A Lewis; Klaus Ley; Bin Li; Da-Qiang Li; Jianming Li; Jing Li; Jiong Li; Ke Li; Liwu Li; Mei Li; Min Li; Min Li; Ming Li; Mingchuan Li; Pin-Lan Li; Ming-Qing Li; Qing Li; Sheng Li; Tiangang Li; Wei Li; Wenming Li; Xue Li; Yi-Ping Li; Yuan Li; Zhiqiang Li; Zhiyong Li; Zhiyuan Li; Jiqin Lian; Chengyu Liang; Qiangrong Liang; Weicheng Liang; Yongheng Liang; YongTian Liang; Guanghong Liao; Lujian Liao; Mingzhi Liao; Yung-Feng Liao; Mariangela Librizzi; Pearl P Y Lie; Mary A Lilly; Hyunjung J Lim; Thania R R Lima; Federica Limana; Chao Lin; Chih-Wen Lin; Dar-Shong Lin; Fu-Cheng Lin; Jiandie D Lin; Kurt M Lin; Kwang-Huei Lin; Liang-Tzung Lin; Pei-Hui Lin; Qiong Lin; Shaofeng Lin; Su-Ju Lin; Wenyu Lin; Xueying Lin; Yao-Xin Lin; Yee-Shin Lin; Rafael Linden; Paula Lindner; Shuo-Chien Ling; Paul Lingor; Amelia K Linnemann; Yih-Cherng Liou; Marta M Lipinski; Saška Lipovšek; Vitor A Lira; Natalia Lisiak; Paloma B Liton; Chao Liu; Ching-Hsuan Liu; Chun-Feng Liu; Cui Hua Liu; Fang Liu; Hao Liu; Hsiao-Sheng Liu; Hua-Feng Liu; Huifang Liu; Jia Liu; Jing Liu; Julia Liu; Leyuan Liu; Longhua Liu; Meilian Liu; Qin Liu; Wei Liu; Wende Liu; Xiao-Hong Liu; Xiaodong Liu; Xingguo Liu; Xu Liu; Xuedong Liu; Yanfen Liu; Yang Liu; Yang Liu; Yueyang Liu; Yule Liu; J Andrew Livingston; Gerard Lizard; Jose M Lizcano; Senka Ljubojevic-Holzer; Matilde E LLeonart; David Llobet-Navàs; Alicia Llorente; Chih Hung Lo; Damián Lobato-Márquez; Qi Long; Yun Chau Long; Ben Loos; Julia A Loos; Manuela G López; Guillermo López-Doménech; José Antonio López-Guerrero; Ana T López-Jiménez; Óscar López-Pérez; Israel López-Valero; Magdalena J Lorenowicz; Mar Lorente; Peter Lorincz; Laura Lossi; Sophie Lotersztajn; Penny E Lovat; Jonathan F Lovell; Alenka Lovy; Péter Lőw; Guang Lu; Haocheng Lu; Jia-Hong Lu; Jin-Jian Lu; Mengji Lu; Shuyan Lu; Alessandro Luciani; John M Lucocq; Paula Ludovico; Micah A Luftig; Morten Luhr; Diego Luis-Ravelo; Julian J Lum; Liany Luna-Dulcey; Anders H Lund; Viktor K Lund; Jan D Lünemann; Patrick Lüningschrör; Honglin Luo; Rongcan Luo; Shouqing Luo; Zhi Luo; Claudio Luparello; Bernhard Lüscher; Luan Luu; Alex Lyakhovich; Konstantin G Lyamzaev; Alf Håkon Lystad; Lyubomyr Lytvynchuk; Alvin C Ma; Changle Ma; Mengxiao Ma; Ning-Fang Ma; Quan-Hong Ma; Xinliang Ma; Yueyun Ma; Zhenyi Ma; Ormond A MacDougald; Fernando Macian; Gustavo C MacIntosh; Jeffrey P MacKeigan; Kay F Macleod; Sandra Maday; Frank Madeo; Muniswamy Madesh; Tobias Madl; Julio Madrigal-Matute; Akiko Maeda; Yasuhiro Maejima; Marta Magarinos; Poornima Mahavadi; Emiliano Maiani; Kenneth Maiese; Panchanan Maiti; Maria Chiara Maiuri; Barbara Majello; Michael B Major; Elena Makareeva; Fayaz Malik; Karthik Mallilankaraman; Walter Malorni; Alina Maloyan; Najiba Mammadova; Gene Chi Wai Man; Federico Manai; Joseph D Mancias; Eva-Maria Mandelkow; Michael A Mandell; Angelo A Manfredi; Masoud H Manjili; Ravi Manjithaya; Patricio Manque; Bella B Manshian; Raquel Manzano; Claudia Manzoni; Kai Mao; Cinzia Marchese; Sandrine Marchetti; Anna Maria Marconi; Fabrizio Marcucci; Stefania Mardente; Olga A Mareninova; Marta Margeta; Muriel Mari; Sara Marinelli; Oliviero Marinelli; Guillermo Mariño; Sofia Mariotto; Richard S Marshall; Mark R Marten; Sascha Martens; Alexandre P J Martin; Katie R Martin; Sara Martin; Shaun Martin; Adrián Martín-Segura; Miguel A Martín-Acebes; Inmaculada Martin-Burriel; Marcos Martin-Rincon; Paloma Martin-Sanz; José A Martina; Wim Martinet; Aitor Martinez; Ana Martinez; Jennifer Martinez; Moises Martinez Velazquez; Nuria Martinez-Lopez; Marta Martinez-Vicente; Daniel O Martins; Joilson O Martins; Waleska K Martins; Tania Martins-Marques; Emanuele Marzetti; Shashank Masaldan; Celine Masclaux-Daubresse; Douglas G Mashek; Valentina Massa; Lourdes Massieu; Glenn R Masson; Laura Masuelli; Anatoliy I Masyuk; Tetyana V Masyuk; Paola Matarrese; Ander Matheu; Satoaki Matoba; Sachiko Matsuzaki; Pamela Mattar; Alessandro Matte; Domenico Mattoscio; José L Mauriz; Mario Mauthe; Caroline Mauvezin; Emanual Maverakis; Paola Maycotte; Johanna Mayer; Gianluigi Mazzoccoli; Cristina Mazzoni; Joseph R Mazzulli; Nami McCarty; Christine McDonald; Mitchell R McGill; Sharon L McKenna; BethAnn McLaughlin; Fionn McLoughlin; Mark A McNiven; Thomas G McWilliams; Fatima Mechta-Grigoriou; Tania Catarina Medeiros; Diego L Medina; Lynn A Megeney; Klara Megyeri; Maryam Mehrpour; Jawahar L Mehta; Alfred J Meijer; Annemarie H Meijer; Jakob Mejlvang; Alicia Meléndez; Annette Melk; Gonen Memisoglu; Alexandrina F Mendes; Delong Meng; Fei Meng; Tian Meng; Rubem Menna-Barreto; Manoj B Menon; Carol Mercer; Anne E Mercier; Jean-Louis Mergny; Adalberto Merighi; Seth D Merkley; Giuseppe Merla; Volker Meske; Ana Cecilia Mestre; Shree Padma Metur; Christian Meyer; Hemmo Meyer; Wenyi Mi; Jeanne Mialet-Perez; Junying Miao; Lucia Micale; Yasuo Miki; Enrico Milan; Małgorzata Milczarek; Dana L Miller; Samuel I Miller; Silke Miller; Steven W Millward; Ira Milosevic; Elena A Minina; Hamed Mirzaei; Hamid Reza Mirzaei; Mehdi Mirzaei; Amit Mishra; Nandita Mishra; Paras Kumar Mishra; Maja Misirkic Marjanovic; Roberta Misasi; Amit Misra; Gabriella Misso; Claire Mitchell; Geraldine Mitou; Tetsuji Miura; Shigeki Miyamoto; Makoto Miyazaki; Mitsunori Miyazaki; Taiga Miyazaki; Keisuke Miyazawa; Noboru Mizushima; Trine H Mogensen; Baharia Mograbi; Reza Mohammadinejad; Yasir Mohamud; Abhishek Mohanty; Sipra Mohapatra; Torsten Möhlmann; Asif Mohmmed; Anna Moles; Kelle H Moley; Maurizio Molinari; Vincenzo Mollace; Andreas Buch Møller; Bertrand Mollereau; Faustino Mollinedo; Costanza Montagna; Mervyn J Monteiro; Andrea Montella; L Ruth Montes; Barbara Montico; Vinod K Mony; Giacomo Monzio Compagnoni; Michael N Moore; Mohammad A Moosavi; Ana L Mora; Marina Mora; David Morales-Alamo; Rosario Moratalla; Paula I Moreira; Elena Morelli; Sandra Moreno; Daniel Moreno-Blas; Viviana Moresi; Benjamin Morga; Alwena H Morgan; Fabrice Morin; Hideaki Morishita; Orson L Moritz; Mariko Moriyama; Yuji Moriyasu; Manuela Morleo; Eugenia Morselli; Jose F Moruno-Manchon; Jorge Moscat; Serge Mostowy; Elisa Motori; Andrea Felinto Moura; Naima Moustaid-Moussa; Maria Mrakovcic; Gabriel Muciño-Hernández; Anupam Mukherjee; Subhadip Mukhopadhyay; Jean M Mulcahy Levy; Victoriano Mulero; Sylviane Muller; Christian Münch; Ashok Munjal; Pura Munoz-Canoves; Teresa Muñoz-Galdeano; Christian Münz; Tomokazu Murakawa; Claudia Muratori; Brona M Murphy; J Patrick Murphy; Aditya Murthy; Timo T Myöhänen; Indira U Mysorekar; Jennifer Mytych; Seyed Mohammad Nabavi; Massimo Nabissi; Péter Nagy; Jihoon Nah; Aimable Nahimana; Ichiro Nakagawa; Ken Nakamura; Hitoshi Nakatogawa; Shyam S Nandi; Meera Nanjundan; Monica Nanni; Gennaro Napolitano; Roberta Nardacci; Masashi Narita; Melissa Nassif; Ilana Nathan; Manabu Natsumeda; Ryno J Naude; Christin Naumann; Olaia Naveiras; Fatemeh Navid; Steffan T Nawrocki; Taras Y Nazarko; Francesca Nazio; Florentina Negoita; Thomas Neill; Amanda L Neisch; Luca M Neri; Mihai G Netea; Patrick Neubert; Thomas P Neufeld; Dietbert Neumann; Albert Neutzner; Phillip T Newton; Paul A Ney; Ioannis P Nezis; Charlene C W Ng; Tzi Bun Ng; Hang T T Nguyen; Long T Nguyen; Hong-Min Ni; Clíona Ní Cheallaigh; Zhenhong Ni; M Celeste Nicolao; Francesco Nicoli; Manuel Nieto-Diaz; Per Nilsson; Shunbin Ning; Rituraj Niranjan; Hiroshi Nishimune; Mireia Niso-Santano; Ralph A Nixon; Annalisa Nobili; Clevio Nobrega; Takeshi Noda; Uxía Nogueira-Recalde; Trevor M Nolan; Ivan Nombela; Ivana Novak; Beatriz Novoa; Takashi Nozawa; Nobuyuki Nukina; Carmen Nussbaum-Krammer; Jesper Nylandsted; Tracey R O'Donovan; Seónadh M O'Leary; Eyleen J O'Rourke; Mary P O'Sullivan; Timothy E O'Sullivan; Salvatore Oddo; Ina Oehme; Michinaga Ogawa; Eric Ogier-Denis; Margret H Ogmundsdottir; Besim Ogretmen; Goo Taeg Oh; Seon-Hee Oh; Young J Oh; Takashi Ohama; Yohei Ohashi; Masaki Ohmuraya; Vasileios Oikonomou; Rani Ojha; Koji Okamoto; Hitoshi Okazawa; Masahide Oku; Sara Oliván; Jorge M A Oliveira; Michael Ollmann; James A Olzmann; Shakib Omari; M Bishr Omary; Gizem Önal; Martin Ondrej; Sang-Bing Ong; Sang-Ging Ong; Anna Onnis; Juan A Orellana; Sara Orellana-Muñoz; Maria Del Mar Ortega-Villaizan; Xilma R Ortiz-Gonzalez; Elena Ortona; Heinz D Osiewacz; Abdel-Hamid K Osman; Rosario Osta; Marisa S Otegui; Kinya Otsu; Christiane Ott; Luisa Ottobrini; Jing-Hsiung James Ou; Tiago F Outeiro; Inger Oynebraten; Melek Ozturk; Gilles Pagès; Susanta Pahari; Marta Pajares; Utpal B Pajvani; Rituraj Pal; Simona Paladino; Nicolas Pallet; Michela Palmieri; Giuseppe Palmisano; Camilla Palumbo; Francesco Pampaloni; Lifeng Pan; Qingjun Pan; Wenliang Pan; Xin Pan; Ganna Panasyuk; Rahul Pandey; Udai B Pandey; Vrajesh Pandya; Francesco Paneni; Shirley Y Pang; Elisa Panzarini; Daniela L Papademetrio; Elena Papaleo; Daniel Papinski; Diana Papp; Eun Chan Park; Hwan Tae Park; Ji-Man Park; Jong-In Park; Joon Tae Park; Junsoo Park; Sang Chul Park; Sang-Youel Park; Abraham H Parola; Jan B Parys; Adrien Pasquier; Benoit Pasquier; João F Passos; Nunzia Pastore; Hemal H Patel; Daniel Patschan; Sophie Pattingre; Gustavo Pedraza-Alva; Jose Pedraza-Chaverri; Zully Pedrozo; Gang Pei; Jianming Pei; Hadas Peled-Zehavi; Joaquín M Pellegrini; Joffrey Pelletier; Miguel A Peñalva; Di Peng; Ying Peng; Fabio Penna; Maria Pennuto; Francesca Pentimalli; Cláudia Mf Pereira; Gustavo J S Pereira; Lilian C Pereira; Luis Pereira de Almeida; Nirma D Perera; Ángel Pérez-Lara; Ana B Perez-Oliva; María Esther Pérez-Pérez; Palsamy Periyasamy; Andras Perl; Cristiana Perrotta; Ida Perrotta; Richard G Pestell; Morten Petersen; Irina Petrache; Goran Petrovski; Thorsten Pfirrmann; Astrid S Pfister; Jennifer A Philips; Huifeng Pi; Anna Picca; Alicia M Pickrell; Sandy Picot; Giovanna M Pierantoni; Marina Pierdominici; Philippe Pierre; Valérie Pierrefite-Carle; Karolina Pierzynowska; Federico Pietrocola; Miroslawa Pietruczuk; Claudio Pignata; Felipe X Pimentel-Muiños; Mario Pinar; Roberta O Pinheiro; Ronit Pinkas-Kramarski; Paolo Pinton; Karolina Pircs; Sujan Piya; Paola Pizzo; Theo S Plantinga; Harald W Platta; Ainhoa Plaza-Zabala; Markus Plomann; Egor Y Plotnikov; Helene Plun-Favreau; Ryszard Pluta; Roger Pocock; Stefanie Pöggeler; Christian Pohl; Marc Poirot; Angelo Poletti; Marisa Ponpuak; Hana Popelka; Blagovesta Popova; Helena Porta; Soledad Porte Alcon; Eliana Portilla-Fernandez; Martin Post; Malia B Potts; Joanna Poulton; Ted Powers; Veena Prahlad; Tomasz K Prajsnar; Domenico Praticò; Rosaria Prencipe; Muriel Priault; Tassula Proikas-Cezanne; Vasilis J Promponas; Christopher G Proud; Rosa Puertollano; Luigi Puglielli; Thomas Pulinilkunnil; Deepika Puri; Rajat Puri; Julien Puyal; Xiaopeng Qi; Yongmei Qi; Wenbin Qian; Lei Qiang; Yu Qiu; Joe Quadrilatero; Jorge Quarleri; Nina Raben; Hannah Rabinowich; Debora Ragona; Michael J Ragusa; Nader Rahimi; Marveh Rahmati; Valeria Raia; Nuno Raimundo; Namakkal-Soorappan Rajasekaran; Sriganesh Ramachandra Rao; Abdelhaq Rami; Ignacio Ramírez-Pardo; David B Ramsden; Felix Randow; Pundi N Rangarajan; Danilo Ranieri; Hai Rao; Lang Rao; Rekha Rao; Sumit Rathore; J Arjuna Ratnayaka; Edward A Ratovitski; Palaniyandi Ravanan; Gloria Ravegnini; Swapan K Ray; Babak Razani; Vito Rebecca; Fulvio Reggiori; Anne Régnier-Vigouroux; Andreas S Reichert; David Reigada; Jan H Reiling; Theo Rein; Siegfried Reipert; Rokeya Sultana Rekha; Hongmei Ren; Jun Ren; Weichao Ren; Tristan Renault; Giorgia Renga; Karen Reue; Kim Rewitz; Bruna Ribeiro de Andrade Ramos; S Amer Riazuddin; Teresa M Ribeiro-Rodrigues; Jean-Ehrland Ricci; Romeo Ricci; Victoria Riccio; Des R Richardson; Yasuko Rikihisa; Makarand V Risbud; Ruth M Risueño; Konstantinos Ritis; Salvatore Rizza; Rosario Rizzuto; Helen C Roberts; Luke D Roberts; Katherine J Robinson; Maria Carmela Roccheri; Stephane Rocchi; George G Rodney; Tiago Rodrigues; Vagner Ramon Rodrigues Silva; Amaia Rodriguez; Ruth Rodriguez-Barrueco; Nieves Rodriguez-Henche; Humberto Rodriguez-Rocha; Jeroen Roelofs; Robert S Rogers; Vladimir V Rogov; Ana I Rojo; Krzysztof Rolka; Vanina Romanello; Luigina Romani; Alessandra Romano; Patricia S Romano; David Romeo-Guitart; Luis C Romero; Montserrat Romero; Joseph C Roney; Christopher Rongo; Sante Roperto; Mathias T Rosenfeldt; Philip Rosenstiel; Anne G Rosenwald; Kevin A Roth; Lynn Roth; Steven Roth; Kasper M A Rouschop; Benoit D Roussel; Sophie Roux; Patrizia Rovere-Querini; Ajit Roy; Aurore Rozieres; Diego Ruano; David C Rubinsztein; Maria P Rubtsova; Klaus Ruckdeschel; Christoph Ruckenstuhl; Emil Rudolf; Rüdiger Rudolf; Alessandra Ruggieri; Avnika Ashok Ruparelia; Paola Rusmini; Ryan R Russell; Gian Luigi Russo; Maria Russo; Rossella Russo; Oxana O Ryabaya; Kevin M Ryan; Kwon-Yul Ryu; Maria Sabater-Arcis; Ulka Sachdev; Michael Sacher; Carsten Sachse; Abhishek Sadhu; Junichi Sadoshima; Nathaniel Safren; Paul Saftig; Antonia P Sagona; Gaurav Sahay; Amirhossein Sahebkar; Mustafa Sahin; Ozgur Sahin; Sumit Sahni; Nayuta Saito; Shigeru Saito; Tsunenori Saito; Ryohei Sakai; Yasuyoshi Sakai; Jun-Ichi Sakamaki; Kalle Saksela; Gloria Salazar; Anna Salazar-Degracia; Ghasem H Salekdeh; Ashok K Saluja; Belém Sampaio-Marques; Maria Cecilia Sanchez; Jose A Sanchez-Alcazar; Victoria Sanchez-Vera; Vanessa Sancho-Shimizu; J Thomas Sanderson; Marco Sandri; Stefano Santaguida; Laura Santambrogio; Magda M Santana; Giorgio Santoni; Alberto Sanz; Pascual Sanz; Shweta Saran; Marco Sardiello; Timothy J Sargeant; Apurva Sarin; Chinmoy Sarkar; Sovan Sarkar; Maria-Rosa Sarrias; Surajit Sarkar; Dipanka Tanu Sarmah; Jaakko Sarparanta; Aishwarya Sathyanarayan; Ranganayaki Sathyanarayanan; K Matthew Scaglione; Francesca Scatozza; Liliana Schaefer; Zachary T Schafer; Ulrich E Schaible; Anthony H V Schapira; Michael Scharl; Hermann M Schatzl; Catherine H Schein; Wiep Scheper; David Scheuring; Maria Vittoria Schiaffino; Monica Schiappacassi; Rainer Schindl; Uwe Schlattner; Oliver Schmidt; Roland Schmitt; Stephen D Schmidt; Ingo Schmitz; Eran Schmukler; Anja Schneider; Bianca E Schneider; Romana Schober; Alejandra C Schoijet; Micah B Schott; Michael Schramm; Bernd Schröder; Kai Schuh; Christoph Schüller; Ryan J Schulze; Lea Schürmanns; Jens C Schwamborn; Melanie Schwarten; Filippo Scialo; Sebastiano Sciarretta; Melanie J Scott; Kathleen W Scotto; A Ivana Scovassi; Andrea Scrima; Aurora Scrivo; David Sebastian; Salwa Sebti; Simon Sedej; Laura Segatori; Nava Segev; Per O Seglen; Iban Seiliez; Ekihiro Seki; Scott B Selleck; Frank W Sellke; Joshua T Selsby; Michael Sendtner; Serif Senturk; Elena Seranova; Consolato Sergi; Ruth Serra-Moreno; Hiromi Sesaki; Carmine Settembre; Subba Rao Gangi Setty; Gianluca Sgarbi; Ou Sha; John J Shacka; Javeed A Shah; Dantong Shang; Changshun Shao; Feng Shao; Soroush Sharbati; Lisa M Sharkey; Dipali Sharma; Gaurav Sharma; Kulbhushan Sharma; Pawan Sharma; Surendra Sharma; Han-Ming Shen; Hongtao Shen; Jiangang Shen; Ming Shen; Weili Shen; Zheni Shen; Rui Sheng; Zhi Sheng; Zu-Hang Sheng; Jianjian Shi; Xiaobing Shi; Ying-Hong Shi; Kahori Shiba-Fukushima; Jeng-Jer Shieh; Yohta Shimada; Shigeomi Shimizu; Makoto Shimozawa; Takahiro Shintani; Christopher J Shoemaker; Shahla Shojaei; Ikuo Shoji; Bhupendra V Shravage; Viji Shridhar; Chih-Wen Shu; Hong-Bing Shu; Ke Shui; Arvind K Shukla; Timothy E Shutt; Valentina Sica; Aleem Siddiqui; Amanda Sierra; Virginia Sierra-Torre; Santiago Signorelli; Payel Sil; Bruno J de Andrade Silva; Johnatas D Silva; Eduardo Silva-Pavez; Sandrine Silvente-Poirot; Rachel E Simmonds; Anna Katharina Simon; Hans-Uwe Simon; Matias Simons; Anurag Singh; Lalit P Singh; Rajat Singh; Shivendra V Singh; Shrawan K Singh; Sudha B Singh; Sunaina Singh; Surinder Pal Singh; Debasish Sinha; Rohit Anthony Sinha; Sangita Sinha; Agnieszka Sirko; Kapil Sirohi; Efthimios L Sivridis; Panagiotis Skendros; Aleksandra Skirycz; Iva Slaninová; Soraya S Smaili; Andrei Smertenko; Matthew D Smith; Stefaan J Soenen; Eun Jung Sohn; Sophia P M Sok; Giancarlo Solaini; Thierry Soldati; Scott A Soleimanpour; Rosa M Soler; Alexei Solovchenko; Jason A Somarelli; Avinash Sonawane; Fuyong Song; Hyun Kyu Song; Ju-Xian Song; Kunhua Song; Zhiyin Song; Leandro R Soria; Maurizio Sorice; Alexander A Soukas; Sandra-Fausia Soukup; Diana Sousa; Nadia Sousa; Paul A Spagnuolo; Stephen A Spector; M M Srinivas Bharath; Daret St Clair; Venturina Stagni; Leopoldo Staiano; Clint A Stalnecker; Metodi V Stankov; Peter B Stathopulos; Katja Stefan; Sven Marcel Stefan; Leonidas Stefanis; Joan S Steffan; Alexander Steinkasserer; Harald Stenmark; Jared Sterneckert; Craig Stevens; Veronika Stoka; Stephan Storch; Björn Stork; Flavie Strappazzon; Anne Marie Strohecker; Dwayne G Stupack; Huanxing Su; Ling-Yan Su; Longxiang Su; Ana M Suarez-Fontes; Carlos S Subauste; Selvakumar Subbian; Paula V Subirada; Ganapasam Sudhandiran; Carolyn M Sue; Xinbing Sui; Corey Summers; Guangchao Sun; Jun Sun; Kang Sun; Meng-Xiang Sun; Qiming Sun; Yi Sun; Zhongjie Sun; Karen K S Sunahara; Eva Sundberg; Katalin Susztak; Peter Sutovsky; Hidekazu Suzuki; Gary Sweeney; J David Symons; Stephen Cho Wing Sze; Nathaniel J Szewczyk; Anna Tabęcka-Łonczynska; Claudio Tabolacci; Frank Tacke; Heinrich Taegtmeyer; Marco Tafani; Mitsuo Tagaya; Haoran Tai; Stephen W G Tait; Yoshinori Takahashi; Szabolcs Takats; Priti Talwar; Chit Tam; Shing Yau Tam; Davide Tampellini; Atsushi Tamura; Chong Teik Tan; Eng-King Tan; Ya-Qin Tan; Masaki Tanaka; Motomasa Tanaka; Daolin Tang; Jingfeng Tang; Tie-Shan Tang; Isei Tanida; Zhipeng Tao; Mohammed Taouis; Lars Tatenhorst; Nektarios Tavernarakis; Allen Taylor; Gregory A Taylor; Joan M Taylor; Elena Tchetina; Andrew R Tee; Irmgard Tegeder; David Teis; Natercia Teixeira; Fatima Teixeira-Clerc; Kumsal A Tekirdag; Tewin Tencomnao; Sandra Tenreiro; Alexei V Tepikin; Pilar S Testillano; Gianluca Tettamanti; Pierre-Louis Tharaux; Kathrin Thedieck; Arvind A Thekkinghat; Stefano Thellung; Josephine W Thinwa; V P Thirumalaikumar; Sufi Mary Thomas; Paul G Thomes; Andrew Thorburn; Lipi Thukral; Thomas Thum; Michael Thumm; Ling Tian; Ales Tichy; Andreas Till; Vincent Timmerman; Vladimir I Titorenko; Sokol V Todi; Krassimira Todorova; Janne M Toivonen; Luana Tomaipitinca; Dhanendra Tomar; Cristina Tomas-Zapico; Sergej Tomić; Benjamin Chun-Kit Tong; Chao Tong; Xin Tong; Sharon A Tooze; Maria L Torgersen; Satoru Torii; Liliana Torres-López; Alicia Torriglia; Christina G Towers; Roberto Towns; Shinya Toyokuni; Vladimir Trajkovic; Donatella Tramontano; Quynh-Giao Tran; Leonardo H Travassos; Charles B Trelford; Shirley Tremel; Ioannis P Trougakos; Betty P Tsao; Mario P Tschan; Hung-Fat Tse; Tak Fu Tse; Hitoshi Tsugawa; Andrey S Tsvetkov; David A Tumbarello; Yasin Tumtas; María J Tuñón; Sandra Turcotte; Boris Turk; Vito Turk; Bradley J Turner; Richard I Tuxworth; Jessica K Tyler; Elena V Tyutereva; Yasuo Uchiyama; Aslihan Ugun-Klusek; Holm H Uhlig; Marzena Ułamek-Kozioł; Ilya V Ulasov; Midori Umekawa; Christian Ungermann; Rei Unno; Sylvie Urbe; Elisabet Uribe-Carretero; Suayib Üstün; Vladimir N Uversky; Thomas Vaccari; Maria I Vaccaro; Björn F Vahsen; Helin Vakifahmetoglu-Norberg; Rut Valdor; Maria J Valente; Ayelén Valko; Richard B Vallee; Angela M Valverde; Greet Van den Berghe; Stijn van der Veen; Luc Van Kaer; Jorg van Loosdregt; Sjoerd J L van Wijk; Wim Vandenberghe; Ilse Vanhorebeek; Marcos A Vannier-Santos; Nicola Vannini; M Cristina Vanrell; Chiara Vantaggiato; Gabriele Varano; Isabel Varela-Nieto; Máté Varga; M Helena Vasconcelos; Somya Vats; Demetrios G Vavvas; Ignacio Vega-Naredo; Silvia Vega-Rubin-de-Celis; Guillermo Velasco; Ariadna P Velázquez; Tibor Vellai; Edo Vellenga; Francesca Velotti; Mireille Verdier; Panayotis Verginis; Isabelle Vergne; Paul Verkade; Manish Verma; Patrik Verstreken; Tim Vervliet; Jörg Vervoorts; Alexandre T Vessoni; Victor M Victor; Michel Vidal; Chiara Vidoni; Otilia V Vieira; Richard D Vierstra; Sonia Viganó; Helena Vihinen; Vinoy Vijayan; Miquel Vila; Marçal Vilar; José M Villalba; Antonio Villalobo; Beatriz Villarejo-Zori; Francesc Villarroya; Joan Villarroya; Olivier Vincent; Cecile Vindis; Christophe Viret; Maria Teresa Viscomi; Dora Visnjic; Ilio Vitale; David J Vocadlo; Olga V Voitsekhovskaja; Cinzia Volonté; Mattia Volta; Marta Vomero; Clarissa Von Haefen; Marc A Vooijs; Wolfgang Voos; Ljubica Vucicevic; Richard Wade-Martins; Satoshi Waguri; Kenrick A Waite; Shuji Wakatsuki; David W Walker; Mark J Walker; Simon A Walker; Jochen Walter; Francisco G Wandosell; Bo Wang; Chao-Yung Wang; Chen Wang; Chenran Wang; Chenwei Wang; Cun-Yu Wang; Dong Wang; Fangyang Wang; Feng Wang; Fengming Wang; Guansong Wang; Han Wang; Hao Wang; Hexiang Wang; Hong-Gang Wang; Jianrong Wang; Jigang Wang; Jiou Wang; Jundong Wang; Kui Wang; Lianrong Wang; Liming Wang; Maggie Haitian Wang; Meiqing Wang; Nanbu Wang; Pengwei Wang; Peipei Wang; Ping Wang; Ping Wang; Qing Jun Wang; Qing Wang; Qing Kenneth Wang; Qiong A Wang; Wen-Tao Wang; Wuyang Wang; Xinnan Wang; Xuejun Wang; Yan Wang; Yanchang Wang; Yanzhuang Wang; Yen-Yun Wang; Yihua Wang; Yipeng Wang; Yu Wang; Yuqi Wang; Zhe Wang; Zhenyu Wang; Zhouguang Wang; Gary Warnes; Verena Warnsmann; Hirotaka Watada; Eizo Watanabe; Maxinne Watchon; Anna Wawrzyńska; Timothy E Weaver; Grzegorz Wegrzyn; Ann M Wehman; Huafeng Wei; Lei Wei; Taotao Wei; Yongjie Wei; Oliver H Weiergräber; Conrad C Weihl; Günther Weindl; Ralf Weiskirchen; Alan Wells; Runxia H Wen; Xin Wen; Antonia Werner; Beatrice Weykopf; Sally P Wheatley; J Lindsay Whitton; Alexander J Whitworth; Katarzyna Wiktorska; Manon E Wildenberg; Tom Wileman; Simon Wilkinson; Dieter Willbold; Brett Williams; Robin S B Williams; Roger L Williams; Peter R Williamson; Richard A Wilson; Beate Winner; Nathaniel J Winsor; Steven S Witkin; Harald Wodrich; Ute Woehlbier; Thomas Wollert; Esther Wong; Jack Ho Wong; Richard W Wong; Vincent Kam Wai Wong; W Wei-Lynn Wong; An-Guo Wu; Chengbiao Wu; Jian Wu; Junfang Wu; Kenneth K Wu; Min Wu; Shan-Ying Wu; Shengzhou Wu; Shu-Yan Wu; Shufang Wu; William K K Wu; Xiaohong Wu; Xiaoqing Wu; Yao-Wen Wu; Yihua Wu; Ramnik J Xavier; Hongguang Xia; Lixin Xia; Zhengyuan Xia; Ge Xiang; Jin Xiang; Mingliang Xiang; Wei Xiang; Bin Xiao; Guozhi Xiao; Hengyi Xiao; Hong-Tao Xiao; Jian Xiao; Lan Xiao; Shi Xiao; Yin Xiao; Baoming Xie; Chuan-Ming Xie; Min Xie; Yuxiang Xie; Zhiping Xie; Zhonglin Xie; Maria Xilouri; Congfeng Xu; En Xu; Haoxing Xu; Jing Xu; JinRong Xu; Liang Xu; Wen Wen Xu; Xiulong Xu; Yu Xue; Sokhna M S Yakhine-Diop; Masamitsu Yamaguchi; Osamu Yamaguchi; Ai Yamamoto; Shunhei Yamashina; Shengmin Yan; Shian-Jang Yan; Zhen Yan; Yasuo Yanagi; Chuanbin Yang; Dun-Sheng Yang; Huan Yang; Huang-Tian Yang; Hui Yang; Jin-Ming Yang; Jing Yang; Jingyu Yang; Ling Yang; Liu Yang; Ming Yang; Pei-Ming Yang; Qian Yang; Seungwon Yang; Shu Yang; Shun-Fa Yang; Wannian Yang; Wei Yuan Yang; Xiaoyong Yang; Xuesong Yang; Yi Yang; Ying Yang; Honghong Yao; Shenggen Yao; Xiaoqiang Yao; Yong-Gang Yao; Yong-Ming Yao; Takahiro Yasui; Meysam Yazdankhah; Paul M Yen; Cong Yi; Xiao-Ming Yin; Yanhai Yin; Zhangyuan Yin; Ziyi Yin; Meidan Ying; Zheng Ying; Calvin K Yip; Stephanie Pei Tung Yiu; Young H Yoo; Kiyotsugu Yoshida; Saori R Yoshii; Tamotsu Yoshimori; Bahman Yousefi; Boxuan Yu; Haiyang Yu; Jun Yu; Jun Yu; Li Yu; Ming-Lung Yu; Seong-Woon Yu; Victor C Yu; W Haung Yu; Zhengping Yu; Zhou Yu; Junying Yuan; Ling-Qing Yuan; Shilin Yuan; Shyng-Shiou F Yuan; Yanggang Yuan; Zengqiang Yuan; Jianbo Yue; Zhenyu Yue; Jeanho Yun; Raymond L Yung; David N Zacks; Gabriele Zaffagnini; Vanessa O Zambelli; Isabella Zanella; Qun S Zang; Sara Zanivan; Silvia Zappavigna; Pilar Zaragoza; Konstantinos S Zarbalis; Amir Zarebkohan; Amira Zarrouk; Scott O Zeitlin; Jialiu Zeng; Ju-Deng Zeng; Eva Žerovnik; Lixuan Zhan; Bin Zhang; Donna D Zhang; Hanlin Zhang; Hong Zhang; Hong Zhang; Honghe Zhang; Huafeng Zhang; Huaye Zhang; Hui Zhang; Hui-Ling Zhang; Jianbin Zhang; Jianhua Zhang; Jing-Pu Zhang; Kalin Y B Zhang; Leshuai W Zhang; Lin Zhang; Lisheng Zhang; Lu Zhang; Luoying Zhang; Menghuan Zhang; Peng Zhang; Sheng Zhang; Wei Zhang; Xiangnan Zhang; Xiao-Wei Zhang; Xiaolei Zhang; Xiaoyan Zhang; Xin Zhang; Xinxin Zhang; Xu Dong Zhang; Yang Zhang; Yanjin Zhang; Yi Zhang; Ying-Dong Zhang; Yingmei Zhang; Yuan-Yuan Zhang; Yuchen Zhang; Zhe Zhang; Zhengguang Zhang; Zhibing Zhang; Zhihai Zhang; Zhiyong Zhang; Zili Zhang; Haobin Zhao; Lei Zhao; Shuang Zhao; Tongbiao Zhao; Xiao-Fan Zhao; Ying Zhao; Yongchao Zhao; Yongliang Zhao; Yuting Zhao; Guoping Zheng; Kai Zheng; Ling Zheng; Shizhong Zheng; Xi-Long Zheng; Yi Zheng; Zu-Guo Zheng; Boris Zhivotovsky; Qing Zhong; Ao Zhou; Ben Zhou; Cefan Zhou; Gang Zhou; Hao Zhou; Hong Zhou; Hongbo Zhou; Jie Zhou; Jing Zhou; Jing Zhou; Jiyong Zhou; Kailiang Zhou; Rongjia Zhou; Xu-Jie Zhou; Yanshuang Zhou; Yinghong Zhou; Yubin Zhou; Zheng-Yu Zhou; Zhou Zhou; Binglin Zhu; Changlian Zhu; Guo-Qing Zhu; Haining Zhu; Hongxin Zhu; Hua Zhu; Wei-Guo Zhu; Yanping Zhu; Yushan Zhu; Haixia Zhuang; Xiaohong Zhuang; Katarzyna Zientara-Rytter; Christine M Zimmermann; Elena Ziviani; Teresa Zoladek; Wei-Xing Zong; Dmitry B Zorov; Antonio Zorzano; Weiping Zou; Zhen Zou; Zhengzhi Zou; Steven Zuryn; Werner Zwerschke; Beate Brand-Saberi; X Charlie Dong; Chandra Shekar Kenchappa; Zuguo Li; Yong Lin; Shigeru Oshima; Yueguang Rong; Judith C Sluimer; Christina L Stallings; Chun-Kit Tong
Journal:  Autophagy       Date:  2021-02-08       Impact factor: 13.391

5.  Snap29 mutant mice recapitulate neurological and ophthalmological abnormalities associated with 22q11 and CEDNIK syndrome.

Authors:  Vafa Keser; Jean-François Boisclair Lachance; Sabrina Shameen Alam; Youngshin Lim; Eleonora Scarlata; Apinder Kaur; Tian Fang Zhang; Shasha Lv; Pierre Lachapelle; Cristian O'Flaherty; Jeffrey A Golden; Loydie A Jerome-Majewska
Journal:  Commun Biol       Date:  2019-10-11

6.  Quantitative Phosphoproteomic Analysis Reveals the Regulatory Networks of Elovl6 on Lipid and Glucose Metabolism in Zebrafish.

Authors:  Xueting Wang; Shouxiang Sun; Xiaojuan Cao; Jian Gao
Journal:  Int J Mol Sci       Date:  2020-04-19       Impact factor: 5.923

7.  Decreased neuronal synaptosome associated protein 29 contributes to poststroke cognitive impairment by disrupting presynaptic maintenance.

Authors:  Weijie Yan; Jiahui Fan; Xia Zhang; Huimeng Song; Rongqi Wan; Wei Wang; Yanling Yin
Journal:  Theranostics       Date:  2021-03-04       Impact factor: 11.556

8.  Activity of the SNARE Protein SNAP29 at the Endoplasmic Reticulum and Golgi Apparatus.

Authors:  Elena Morelli; Elisa A Speranza; Enrica Pellegrino; Galina V Beznoussenko; Francesca Carminati; Massimiliano Garré; Alexander A Mironov; Marco Onorati; Thomas Vaccari
Journal:  Front Cell Dev Biol       Date:  2021-02-18

Review 9.  Teleost Fish and Organoids: Alternative Windows Into the Development of Healthy and Diseased Brains.

Authors:  Giulia Fasano; Claudia Compagnucci; Bruno Dallapiccola; Marco Tartaglia; Antonella Lauri
Journal:  Front Mol Neurosci       Date:  2022-08-11       Impact factor: 6.261

Review 10.  Getting Sugar Coating Right! The Role of the Golgi Trafficking Machinery in Glycosylation.

Authors:  Zinia D'Souza; Farhana Taher Sumya; Amrita Khakurel; Vladimir Lupashin
Journal:  Cells       Date:  2021-11-23       Impact factor: 6.600

  10 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.