Literature DB >> 25551675

Multiple functions of the SNARE protein Snap29 in autophagy, endocytic, and exocytic trafficking during epithelial formation in Drosophila.

Elena Morelli1, Pierpaolo Ginefra, Valeria Mastrodonato, Galina V Beznoussenko, Tor Erik Rusten, David Bilder, Harald Stenmark, Alexandre A Mironov, Thomas Vaccari.   

Abstract

How autophagic degradation is linked to endosomal trafficking routes is little known. Here we screened a collection of uncharacterized Drosophila mutants affecting membrane transport to identify new genes that also have a role in autophagy. We isolated a loss of function mutant in Snap29 (Synaptosomal-associated protein 29 kDa), the gene encoding the Drosophila homolog of the human protein SNAP29 and have characterized its function in vivo. Snap29 contains 2 soluble NSF attachment protein receptor (SNARE) domains and a asparagine-proline-phenylalanine (NPF motif) at its N terminus and rescue experiments indicate that both SNARE domains are required for function, whereas the NPF motif is in part dispensable. We find that Snap29 interacts with SNARE proteins, localizes to multiple trafficking organelles, and is required for protein trafficking and for proper Golgi apparatus morphology. Developing tissue lacking Snap29 displays distinctive epithelial architecture defects and accumulates large amounts of autophagosomes, highlighting a major role of Snap29 in autophagy and secretion. Mutants for autophagy genes do not display epithelial architecture or secretion defects, suggesting that the these alterations of the Snap29 mutant are unlikely to be caused by the impairment of autophagy. In contrast, we find evidence of elevated levels of hop-Stat92E (hopscotch-signal transducer and activator of transcription protein at 92E) ligand, receptor, and associated signaling, which might underlie the epithelial defects. In summary, our findings support a role of Snap29 at key steps of membrane trafficking, and predict that signaling defects may contribute to the pathogenesis of cerebral dysgenesis, neuropathy, ichthyosis, and palmoplantar keratoderma (CEDNIK), a human congenital syndrome due to loss of Snap29.

Entities:  

Keywords:  Atg, autophagy-related; CEDNIK, cerebral dysgenesis, neuropathy, ichthyosis, and palmoplantar keratoderma; CFP, cyan fluorescent protein; E(spl)mβ-HLH, enhancer of split mβ, helix-loop-helix; EM, electron microscopy; ESCRT, endosomal sorting complex required for transport; FE, follicular epithelium; GFP, green fluorescent protein; MENE, mutant eye no eclosion; MVB, multivesicular body; N, Notch; NECD, N extracellular domain; NPF, asparagine-proline-phenylalanine; Notch; SNARE; SNARE, soluble NSF attachment protein receptor; Snap29; Snap29, synaptosomal-associated protein 29 kDa; Socs36E, suppressor of cytokine signaling at 36E; Syb, Synaptobrevin; Syx, syntaxin; V-ATPase, vacuolar H+-ATPase; Vamp, vesicle-associated membrane protein; Vps25, vacuolar protein sorting 25; WT, wild type; autophagy; dome; dome, domeless; histone H3, His3; hop-Stat92E, hopscotch-signal transducer and activator of transcription protein at 92E; os, outstretched; ref(2)P, refractory to sigma P; trafficking; usnp

Mesh:

Substances:

Year:  2014        PMID: 25551675      PMCID: PMC4502674          DOI: 10.4161/15548627.2014.981913

Source DB:  PubMed          Journal:  Autophagy        ISSN: 1554-8627            Impact factor:   16.016


Introduction

Organ development and homeostasis require concerted regulation of membrane trafficking routes, such as those governing protein secretion and endo-lysosomal degradation, and those controlling macroautophagy (autophagy hereafter), which regulates turnover of organelles and large cytoplasmic proteins. Studies in model organisms have clearly shown that the endo-lysosomal degradation pathway is required for correct organ development, due to its ability to promote degradation of signaling receptors controlling tissue growth and polarity (for review see ref. 1). Such a major role of endocytosis on tissue architecture is underscored by the fact that Drosophila larval imaginal discs, a recognized model of epithelial organ development, when mutant for a number of the Endosomal Sorting Complexes Required for Transport (ESCRT) genes, display loss of polarity and overactivation of major signaling pathways, including N (Notch) and hop-Stat92E. In contrast, mutants in genes controlling autophagy often do not display loss of tissue architecture, or altered signaling phenotypes, indicating that impairment of endo-lysosomal or autophagic degradation have dramatically distinct consequences on tissue development. However, it is poorly understood which regulators of trafficking are required for formation and convergence of autophagosomes into the endosomal degradation route, and their relevance to organ development and homeostasis. In autophagy, double-membrane organelles called autophagosomes are formed by a phagophore that sequesters portions of the cell cytoplasm. Autophagosomes then fuse with lysosomes, in which the autophagosome content is degraded. Studies have shown that 2 ubiquitin-like conjugation systems are required for autophagosome formation, and a number of organelles, such as the endoplasmic reticulum (ER), mitochondria, the Golgi apparatus, endosomes, and the plasma membrane have all been suggested to supply membranes and factors for autophagosome formation. Research in yeast indicates that, once formed, the autophagosome fuses with the vacuole, the yeast lysosome, in a manner dependent on the GTPase Ypt7/Rab7, on the homotypic fusion and protein sorting (HOPS) complex, and on SNARE-mediated membrane fusion. In metazoans, fusion events between autophagosomes and endosomal compartments are more complex, entailing the formation of amphisomes, which arise from fusion of autophagosomes with the multivesicular body (MVB), a late endosomal organelle. Consistent with this difference, in Drosophila and in mammalian cells ESCRT proteins, which regulate endosomal sorting and MVB formation, and the PtdIns3P 5-kinase fab1, which control endosome function, are required for amphisome and autolysosome formation. Also, differently from yeast, when formation of late endosomes is blocked in Drosophila and mammalian cells, autophagosomes accumulate in the cytoplasm, suggesting that amphisome formation helps clearance of autophagic cargoes. The nature of SNARE-mediated fusion events occurring during formation and clearance of autophagosomes via the endo-lysosomal system is partly obscure. SNARE-mediated fusion involves a stereotypic set of SNARE proteins forming a 4-helix bundle composed by distinct SNARE domains named Qa-, Qb-, Qc- or R-SNARE. Usually, a Qa-SNARE-containing protein (a syntaxin, or t-SNARE) and a R-SNARE -containing protein (a VAMP protein, or v-SNARE) are carried by opposing membranes, and each provide a SNARE domain to the fusion complex. These proteins are glued together by Qb- and Qc- containing proteins, providing the remaining 2 SNARE domains. The Qb- and Qc-SNAREs involved in fusion events can be contributed by members of the SNAP protein family, with SNAP25 and SNAP23 being the most extensively studied. However, metazoan genomes also contain SNAP29, which, unlike other SNAP family members, contains a N-terminal NPF (asparagine-proline-phenylalanine) motif that binds endocytic adaptors, such as EDH1, and lacks palmitoylation sites for membrane anchoring. Consistent with this, SNAP29 resides in the cytoplasm and associates with membranes transiently. In contrast to its paralogs, SNAP29 has been much less studied and its function is unclear. In tissue culture and in in vitro studies, SNAP29 has been suggested to interact with multiple Qa-SNAREs such as syntaxins, and to associate with a number of intracellular organelles to promote—as well as inhibit—membrane fusion. Using depletion approaches, it has been shown that SNAP29 and its homolog in C. elegans and zebrafish regulates trafficking between several organelles, and that it is required for integrity of various intracellular compartments. Finally, in Drosophila and human cells, the SNAREs STX17/syntaxin 17 (Syx17) and vesicle-associated membrane protein 7 (VAMP7/Vamp7) have been very recently reported to act with SNAP29/Snap29 in fusion of autophagosomes to lysosomes. Homozygous nonsense mutations leading to truncations of the human SNAP29 protein cause CEDNIK syndrome, a rare inherited congenital condition affecting skin and nervous system development and homeostasis, and resulting in short life span. Despite the evidence above, how SNAP29 functions and how its loss results in acquisition of CEDNIK traits is currently unclear. In this study, we used Drosophila imaginal discs to identify novel regulators of membrane trafficking that might have a role in autophagy, and to assess the importance of identified genes for epithelial organ development. With this strategy, we identified the first Drosophila null mutant in Snap29 (also referred to as CG11173/usnp). Snap29 mutant imaginal discs present impairment of a late step of autophagy. In addition, we found that Snap29 exerts an inhibitory role in membrane fusion at the apical membrane. In fact, Snap29 mutant tissue secretes autophagosomes in the apical lumen and presents excess of receptors on the plasma membrane. These defects correlate with disruption of the epithelial organization of imaginal discs and with a dramatic alteration in developmental signaling. Taken together, our data highlight a novel point of contact between trafficking and autophagy routes that is critical for organ development and might advance our understanding of the CEDNIK pathogenesis.

Results

MENE (2R) B6-21, a novel regulator of protein trafficking and autophagy

To identify novel trafficking genes that may control autophagy, we screened a collection of Drosophila MENE (mutant eye no eclosion) mutants. These mutants have been selected for their ability to cause larval lethality when made homozygous in eye-antennal imaginal discs, and most of the mapped ones disrupt membrane trafficking genes. To monitor formation and clearance of autophagosomes in WT discs (), and in discs containing predominantly homozygous mutant cells (referred to as “mutant discs” henceforth; see Materials and Methods) we stained with an antibody that recognizes Drosophila refractory to sigma P (ref(2)P), a SQSTM1/p62 ortholog shown to be a selective autophagy target (, marked in red). To monitor both secretion and endocytic degradation routes, we also stained with an antibody that recognizes N, a transmembrane receptor actively trafficked and enriched at the apical plasma membrane and in late endosomes (, marked in green). As previously reported in WT discs, N localizes to the apical plasma membrane and in endosomal puncta, while little signal of ref(2)p is detected, consistent with low levels of constitutive autophagy (). Discs mutant for genes regulating autophagy, but not protein secretion or endocytic trafficking, such as autophagy-related gene 13 (Atg13), which is required for initiation of autophagy, display normal morphology, and accumulate high levels of ref(2)P with no alteration of N localization, when compared to WT discs (). In contrast, discs mutant for Vacuolar protein sorting 25 (Vps25), display accumulation of both N and ref(2)P as well as major organ morphology alterations (), consistent with the reported role as tumor suppressor. Discs mutant for fab1, also accumulate N and ref(2)P but display no organ morphology alterations (), as previously shown. Among MENE mutants, MENE (2R)-E B6-21 shows accumulation of both N and ref(2)P, as well as epithelial morphology alterations (). Similar defects are observed in mutant wing discs (Fig. S1A and B). Analysis of N and ref(2)P at the subcellular level indicated key differences among MENE (2R)-E B6-21, Vps25, and fab1 mutant discs (). Compared to WT or Atg13 mutant discs (), in discs mutant for both Vps25 and fab1, N and ref(2)P form adjoining intracellular accumulations (). This phenotype is consistent with previously reported functions of these genes in endosomal sorting and formation of amphisomes (Vps25), and in lysosomal maturation and fusion of amphisomes to lysosomes (fab1). In contrast, in MENE (2R)-E B6-21 mutant discs, N appears to accumulate apically, while ref(2)P accumulates in the apical portion below the cell cortex (). These data indicate that the MENE (2R)-E B6-21 mutation affects a gene controlling protein trafficking and autophagy, at a step likely to be distinct to those regulated by Vps25 or fab1.
Figure 1.

An assay to identify novel trafficking genes involved in autophagy. (A and B) Schematic view of subapical cross-section through a third-instar larval eye-antennal imaginal discs (A) and of an epithelial cell contained in it (B). B depicts the secretion and endocytic degradation routes followed by N, and the autophagic degradation routes highlighted by ref(2)P. AM, amphisome; Ant, anterior; AP, autophagosome; EE, early endosome; GA, Golgi apparatus; LY, lysosome; NU, Nucleus; PG, phagophore; PM, plasma membrane; Post, posterior. (C to G) WT and mutant discs of the indicated genotype immunostained to detect N, ref(2)p and nuclei. A′ to E″ show the N and ref(2)P channels, respectively. Compared to WT, discs mutant for the Atg13 display strong accumulation of ref(2)P, no N accumulation and normal organ morphology. In Vps25 and fab1 mutant discs N and ref(2)P accumulate, however only in Vps25 mutant discs disc morphology is aberrant. MENE (2R)-E B6 mutant discs display epithelial architecture defects, and strong ref(2)P and N accumulation. (H to L) High magnification of a cross-section of the anterior portion of mutant discs, as in C to G. Enlargements of the boxed area and its single channels are shown below each panel. Note the distinct patterns of accumulation of N, or ref(2)P, in the different mutants.

An assay to identify novel trafficking genes involved in autophagy. (A and B) Schematic view of subapical cross-section through a third-instar larval eye-antennal imaginal discs (A) and of an epithelial cell contained in it (B). B depicts the secretion and endocytic degradation routes followed by N, and the autophagic degradation routes highlighted by ref(2)P. AM, amphisome; Ant, anterior; AP, autophagosome; EE, early endosome; GA, Golgi apparatus; LY, lysosome; NU, Nucleus; PG, phagophore; PM, plasma membrane; Post, posterior. (C to G) WT and mutant discs of the indicated genotype immunostained to detect N, ref(2)p and nuclei. A′ to E″ show the N and ref(2)P channels, respectively. Compared to WT, discs mutant for the Atg13 display strong accumulation of ref(2)P, no N accumulation and normal organ morphology. In Vps25 and fab1 mutant discs N and ref(2)P accumulate, however only in Vps25 mutant discs disc morphology is aberrant. MENE (2R)-E B6 mutant discs display epithelial architecture defects, and strong ref(2)P and N accumulation. (H to L) High magnification of a cross-section of the anterior portion of mutant discs, as in C to G. Enlargements of the boxed area and its single channels are shown below each panel. Note the distinct patterns of accumulation of N, or ref(2)P, in the different mutants.

MENE (2R)-E B6-21 is a mutant in the gene encoding Drosophila Snap29

To identify the gene mutated in MENE (2R)-E B6-21, we mapped the mutation by complementation, recombination and direct sequencing (see Materials and Methods for details) to Snap29 (). Drosophila Snap29 protein shares all the features of its human homolog, with which it shares 33% identity, including the presence of an acidic NPF motif at its N terminus, of 2 SNARE domains separated by a linker region, and the absence of cysteine residues for membrane anchoring in the linker region (Fig. S2). The identified mutation introduces a premature stop codon predicted to truncate the protein between the 2 SNARE domains (). Discs containing mutant cells express almost normal levels of mRNA (). However, with an anti-Snap29 antibody that we generated we observed that discs containing mutant cells express a Snap29 form of predicted size for the truncated protein (Snap29B6; ).
Figure 2.

MENE(2R)-E B6 is a null mutant of Drosophila Snap29. (A) Schematic view of the Snap29 locus. Df(2R)egl2 (black) complements the B6-21 mutation, while Df(2R)3-659 and Df(2R)106 (red) fail to complement it, indicating that B6-21 maps to the genetic interval 60A3-A5 on the right arm of the Drosophila chromosome 2. The coding sequence of Snap29 is shown in orange, while the domains of Snap29 are indicated in yellow and blue. A black triangle marks the approximate position of the B6 mutation. (B) Sequencing of the B6 allele in heterozygosity with the parental chromosome on which the mutation was induced. A C-to-T change creates a premature stop codon that truncates the protein right after the first SNARE domain. (C) Expression of Snap29 mRNA is only 25% reduced in mutant eye-antennal and wing discs, relative to WT. (D) Analysis of Snap29 expression by protein gel blot in WT disc extracts and in extracts of discs containing Snap29 mutant cells indicates that Snap29B6, a truncated form of Snap29, is present in mutant cells. (E) Ubiquitous expression of CFP-Snap29 under tubulin-Gal4 (tub>) rescues lethality of homozygous Snap29 flies. Rescued flies (right) are indistinguishable from heterozygous animals (left). (F) Adult eyes of flies with the indicated genetic background. Eye-specific ectopic expression of CFP-Snap29, or of a Snap29 form with a mutated NPF motif (Snap29AAA) rescue defects of Snap29 mutant eye discs and yield adults with normal (CFP-Snap29), or reduced eyes (Snap29AAA). Mutant cells expressing the rescue construct give rise to orange photoreceptors, while the WT cells give rise to dark red ones. (G) Western blot of extracts from WT discs, or discs containing Snap29 mutant cells or discs containing Snap29 mutant cells and expressing CFP-Snap29, reveal expression of a truncated form of Snap29 (Snap29B6) and of CFP-Snap29 in rescued discs. The asterisks indicate unspecific signals.

MENE(2R)-E B6 is a null mutant of Drosophila Snap29. (A) Schematic view of the Snap29 locus. Df(2R)egl2 (black) complements the B6-21 mutation, while Df(2R)3-659 and Df(2R)106 (red) fail to complement it, indicating that B6-21 maps to the genetic interval 60A3-A5 on the right arm of the Drosophila chromosome 2. The coding sequence of Snap29 is shown in orange, while the domains of Snap29 are indicated in yellow and blue. A black triangle marks the approximate position of the B6 mutation. (B) Sequencing of the B6 allele in heterozygosity with the parental chromosome on which the mutation was induced. A C-to-T change creates a premature stop codon that truncates the protein right after the first SNARE domain. (C) Expression of Snap29 mRNA is only 25% reduced in mutant eye-antennal and wing discs, relative to WT. (D) Analysis of Snap29 expression by protein gel blot in WT disc extracts and in extracts of discs containing Snap29 mutant cells indicates that Snap29B6, a truncated form of Snap29, is present in mutant cells. (E) Ubiquitous expression of CFP-Snap29 under tubulin-Gal4 (tub>) rescues lethality of homozygous Snap29 flies. Rescued flies (right) are indistinguishable from heterozygous animals (left). (F) Adult eyes of flies with the indicated genetic background. Eye-specific ectopic expression of CFP-Snap29, or of a Snap29 form with a mutated NPF motif (Snap29AAA) rescue defects of Snap29 mutant eye discs and yield adults with normal (CFP-Snap29), or reduced eyes (Snap29AAA). Mutant cells expressing the rescue construct give rise to orange photoreceptors, while the WT cells give rise to dark red ones. (G) Western blot of extracts from WT discs, or discs containing Snap29 mutant cells or discs containing Snap29 mutant cells and expressing CFP-Snap29, reveal expression of a truncated form of Snap29 (Snap29B6) and of CFP-Snap29 in rescued discs. The asterisks indicate unspecific signals. To confirm that the identified mutation in Snap29 is responsible for the disc phenotype, we performed rescue experiments by ectopic expression of Snap29 in Snap29 mutant discs. Both Snap29 homozygous and Snap29 hemizygous animals are lethal shortly after larval hatching. In contrast, expression of a full-length CFP-tagged form of Snap29 (CFP-Snap29) under the tubulin promoter fully rescues homozygous Snap29 flies to adulthood (). Taken together, these data indicate that impairment of Snap29 function is the cause of the phenotypes observed in Snap29 mutant tissue, and that Snap29 is likely to be a strong loss of function Snap29 allele. To determine which domain of Snap29 is important for function, we performed rescue experiments by ectopic expression of full-length and mutated Snap29 forms in Snap29 mutant eye discs. Mutant forms of Snap29 do not appear to possess dominant negative activity when overexpressed at comparable levels in otherwise WT discs (Fig. S1C to G). This is the case also of Snap29SNARE2Δ, a mutant form of Snap29 that lacks the second SNARE domain and resembles the Snap29B6 protein, suggesting that Snap29B6 is most likely nonfunctional (, S1C and D, S2). As expected, specific expression of CFP-Snap29 under the eyeless promoter rescues developmental defects and lethality of larvae bearing Snap29 homozygous mutant eye-antennal discs, and leads to eclosion of adults with eye structures indistinguishable to that of WT animals (). In contrast, Snap29 forms lacking either the first or the second SNARE domain (Fig. S1C and D) are unable to rescue Snap29 mutant discs. Surprisingly, a Snap29 form with a mutated NPF motif (Snap29AAA; Fig. S1C and D) can rescue pupal lethality, yielding escaper adults with various degrees of eye defect (). These data suggest that the presence of both SNARE domains is crucial for function, while the NPF motif is in part dispensable, at least upon overexpression.

Snap29 mutant tissue displays altered autophagy and Golgi apparatus organization

To understand the function of Drosophila Snap29 in epithelial tissue of the imaginal disc, we analyzed the ultrastructure of Snap29 mutant discs by electron microscopy (EM; ). Compared to WT, Snap29 mutant tissue displays a striking accumulation of double membrane vesicular organelles ( and B). Accumulated double-membrane organelles present diameters ranging from 0.5 μm to 5 μm with most of them averaging 0.7 μm and contain a wide array of intact cellular structures, such as mitochondria, ER, or vesicles (, arrows). By immuno-EM, we find that these organelles are positive for ref(2)p and for Atg8a, a master regulator of autophagy, indicating that most of these are autophagosomes (, arrows).
Figure 3

(See previous page). Snap29 mutant tissue possesses defective Golgi morphology and accumulates autophagosomes in the cytoplasm and apical lumen. (A and B) Electron micrograph of a section of eye disc tissue of the indicated genotype. A portion of the apical part of 3 to 5 epithelial cells above the level of the basal nuclei is shown. While double-membrane organelles are very rarely observed in WT cells, mutant cells are packed with them. In B, examples of double-membrane organelle containing other organelles are indicated with white arrows, while examples of organelles with a single membrane containing with vesicles or organelles in the apical lumen are indicated by white arrowheads. (C) Example of a thick 200-nm section of mutant tissue used for tomography reconstructions. Gold particles have been added for image registration. White boxes highlight a intracellular giant body containing autophagosomes, lysosomes and mitochondria (bottom box), and a similar apical extracellular structure (top box). Corresponding higher magnification images are shown in L and M and relative tomograms are presented as supplementary data. (D) ref(2)P and Atg8a label autophagosomes in Snap29 mutant cells by immuno-EM, as indicated by white arrows. A large double-membrane structure marked with Atg8a is also shown in the rightmost panel. (E) Example of amphisome (blue) in a WT cell close to a multilamellar organelle that could be a lysosome (purple). (F to I) Examples of autophagic organelles accumulated in mutant cells: Autophagosomes completely enclosed by a double membrane (F, light blue). Autophagosomes clustered together enclosed by folded membranes in part connected (G, light blue). The cytoplasmic space between them is shaded in red. Autophagosomes (H, light blue) close to a cluster of multilamellar organelles that could be lysosomes (H, purple). A rarely occurring amphisome (I, blue) in between 2 autophagosomes (I, light blue). (J to J″) Three representative planes of a tomographic reconstruction showing intracellular autophagosomes (one highlighted in light blue), exocytosed autophagosomes (2 highlighted in green), and one autophagosome in the process of being exocytosed (green) the lumen connecting to the apical extracellular space is highlighted in red. (K and L) Examples of large structures inside (K) and outside (L) mutant cells. Autophagosomes internal to these structures are highlighted in light blue and electrondense lysosomal material is shaded in purple. Tomograms of panels E to L are presented as supplementary data. (M and N) Examples of Golgi apparatus organization. Note the absence of stack organization in the Golgi apparatus of a mutant cell. Labels are as follows: AJ, adherens junctions; ER, endoplasmic reticulum; GA, Golgi apparatus; LU, apical lumen; MI, mitocondrium; NU, nucleus.

(See previous page). Snap29 mutant tissue possesses defective Golgi morphology and accumulates autophagosomes in the cytoplasm and apical lumen. (A and B) Electron micrograph of a section of eye disc tissue of the indicated genotype. A portion of the apical part of 3 to 5 epithelial cells above the level of the basal nuclei is shown. While double-membrane organelles are very rarely observed in WT cells, mutant cells are packed with them. In B, examples of double-membrane organelle containing other organelles are indicated with white arrows, while examples of organelles with a single membrane containing with vesicles or organelles in the apical lumen are indicated by white arrowheads. (C) Example of a thick 200-nm section of mutant tissue used for tomography reconstructions. Gold particles have been added for image registration. White boxes highlight a intracellular giant body containing autophagosomes, lysosomes and mitochondria (bottom box), and a similar apical extracellular structure (top box). Corresponding higher magnification images are shown in L and M and relative tomograms are presented as supplementary data. (D) ref(2)P and Atg8a label autophagosomes in Snap29 mutant cells by immuno-EM, as indicated by white arrows. A large double-membrane structure marked with Atg8a is also shown in the rightmost panel. (E) Example of amphisome (blue) in a WT cell close to a multilamellar organelle that could be a lysosome (purple). (F to I) Examples of autophagic organelles accumulated in mutant cells: Autophagosomes completely enclosed by a double membrane (F, light blue). Autophagosomes clustered together enclosed by folded membranes in part connected (G, light blue). The cytoplasmic space between them is shaded in red. Autophagosomes (H, light blue) close to a cluster of multilamellar organelles that could be lysosomes (H, purple). A rarely occurring amphisome (I, blue) in between 2 autophagosomes (I, light blue). (J to J″) Three representative planes of a tomographic reconstruction showing intracellular autophagosomes (one highlighted in light blue), exocytosed autophagosomes (2 highlighted in green), and one autophagosome in the process of being exocytosed (green) the lumen connecting to the apical extracellular space is highlighted in red. (K and L) Examples of large structures inside (K) and outside (L) mutant cells. Autophagosomes internal to these structures are highlighted in light blue and electrondense lysosomal material is shaded in purple. Tomograms of panels E to L are presented as supplementary data. (M and N) Examples of Golgi apparatus organization. Note the absence of stack organization in the Golgi apparatus of a mutant cell. Labels are as follows: AJ, adherens junctions; ER, endoplasmic reticulum; GA, Golgi apparatus; LU, apical lumen; MI, mitocondrium; NU, nucleus. In WT eye disc cells autophagic structures are very rare and tomographic analysis reveals that the few found are late-stage amphisomes or autolysosomes, as judged by their single and double-limiting membrane and by their partly degraded luminal content (; Movie S1). In contrast, the vast majority of the autophagosomes accumulated in Snap29 mutant cells are completely delimited by double membrane filled with a continuous protein-poor space. In addition, the accumulated autophagosomes in Snap29 mutant cells contain cytosolic structures in their lumen that are perfectly preserved, indicating that no degradation occurs in these organelles (; Movie S2). The outer and inner limiting membranes of the accumulated autophagosomes is often convoluted and folded on a limited part of the organelle surface, and accumulated autophagosomes were often found close to each other (; Movie S3), or close to multilamellar organelles that could be lysosomes (; Movie S4). Rarely, amphisomes were found in Snap29 mutant cells, suggesting that fusion of autophagosomes with MVBs can still occur to a certain degree. In this case, signs of content degradation, such as broken membranes, are apparent (; Movie S5). In addition to intracellular accumulation of autophagosomes, Snap29 mutant cells present a prominent apical extracellular accumulation of large vesicles, possessing a single-delimiting membrane and displaying approximately the size of the autophagosomes accumulated intracellularly (, arrowhead). Importantly, tomographic analysis reveals that these also can contain intact undigested cellular structures, and are often found juxtaposed to the apical membrane, or can be found at various stages of fusion with the apical plasma membrane (, Movie S6), indicating that they might represent exocytosed autophagic structures. Occasionally, we observed the presence of very large (>2 μm in diameter) cytoplasmic bodies surrounded by a double membrane containing smaller autophagosomes and other organelles (; Movie S7). Similar giant structures could be also found outside of the cells apically (; Movie S8). While these aberrant organelles could occur by multiple rounds of autophagic sequestration, the presence of apoptotic cells in Snap29 mutant discs (Fig. S3A and B) suggests that they could be apoptotic bodies, possibly engulfed by epithelial cells. Finally, compared to WT cells, Snap29 mutant cells show a prominent disorganization of the cisternae of the Golgi apparatus (). Tomographic reconstructions show that while in WT cells the Golgi cisternae are typically stacked (Movie S9), in Snap29 mutant cells the cisternae are highly perforated and their number is decreased (Movie S10). Also, while in WT cells the length of individual cisternae is uniform, in Snap29 mutant cells their size is highly variable (Movie S10). Taken together, these data indicate that Drosophila Snap29 is required to prevent accumulation of autophagosomes and to maintain a correct Golgi apparatus morphology.

Snap29 controls fusion of autophagosomes to degradative organelles

In agreement with our data on mutant discs, in imaginal discs containing clones of Snap29 mutant cells (referred to as “mosaic discs” henceforth; Materials and Methods), mutant cells also display accumulation of ref(2)P, when compared to surrounding GFP-positive WT cells (). Similar ref(2)P accumulation is seen in cells mutant for Vps25 (). As expected from failure of autophagy to clear ubiquitinated protein aggregates marked by ref(2)P, Snap29 mutant discs display moderate accumulation of ubiquitin, when compared to WT or Vps25 mutant discs (). Accumulation of autophagosomes and ref(2)P in mutant cells could be due to a block in the autophagy flux or to induction of autophagy, or both. To distinguish between these possibilities, we tested S6k phosphorylation and expression of Atg genes, as it has been shown that, in conditions of starvation-induced autophagy, levels of phospho-S6k are low and expression of certain Atg genes is high. Compared to WT discs, mutant discs possess high levels of phospho-S6k and low Atg8a and Atg18b expression, suggesting that accumulation of autophagosomes in mutant cells is not due to induction of autophagy (). To test whether a block in autophagosome fusion to degradative organelles is the cause of autophagosome accumulation, we analyzed the fat body, a tissue used as model to study autophagy. Fat body cells in which autophagy has been induced by starvation, when depleted of Snap29 show accumulation of ref(2)P and decreased levels of punctate structures positive for mCherry-Atg8a, a marker of autophagosomes and autolysosomes, when compared to WT cells (Fig. S3C and D). Consistent with our EM findings, these data suggest that Snap29 is required for fusion of autophagosomes with degradative endocytic organelles.
Figure 4.

Snap29 mutant cells fail to complete autophagy. (A to C) Clones of Snap29 (A and B) or Vps25 (C) mutant cells in mosaic eye-antennal discs accumulate high levels of ref(2)p and ubiquitin, compared to surrounding WT cells. (B and C) show a high magnification image of an anterior portion of an eye discs. Single ref(2)P and Ubiquitin channels are shown. (D to F) Immunoblots of protein extracts from eye-antennal discs of the indicated genotypes to detect ref(2)P (D), ubiquitin (E) and pS6k (F). Compared to protein extracts of WT discs, discs mutant for Snap29 and for the autophagy and trafficking regulator Vps25 accumulate ref(2)P, ubiquitin and pS6k. Loading controls are shown below each blot. (G) Relative expression of Atg8a or Atg18b by Q-PCR analysis of mRNA extracts from WT and mutant discs. Mutant discs do not show induction of expression of Atg genes. (H and I) A single medial confocal cross-section of the Drosophila FE of a stage 9 egg chamber. FE cells overexpressing GFP-LAMP1 are stained for Snap29 and Atg8a. H′ to H"’ show respectively the LAMP1 and Snap29, the LAMP1 and Atg8a, and the Snap29 and Atg8a merged channels. A high magnification of a typical cluster formed by GFP-LAMP1, Snap29 and Atg8a-positive vesicles is shown in (I). The 3 proteins are in close proximity.

Snap29 mutant cells fail to complete autophagy. (A to C) Clones of Snap29 (A and B) or Vps25 (C) mutant cells in mosaic eye-antennal discs accumulate high levels of ref(2)p and ubiquitin, compared to surrounding WT cells. (B and C) show a high magnification image of an anterior portion of an eye discs. Single ref(2)P and Ubiquitin channels are shown. (D to F) Immunoblots of protein extracts from eye-antennal discs of the indicated genotypes to detect ref(2)P (D), ubiquitin (E) and pS6k (F). Compared to protein extracts of WT discs, discs mutant for Snap29 and for the autophagy and trafficking regulator Vps25 accumulate ref(2)P, ubiquitin and pS6k. Loading controls are shown below each blot. (G) Relative expression of Atg8a or Atg18b by Q-PCR analysis of mRNA extracts from WT and mutant discs. Mutant discs do not show induction of expression of Atg genes. (H and I) A single medial confocal cross-section of the Drosophila FE of a stage 9 egg chamber. FE cells overexpressing GFP-LAMP1 are stained for Snap29 and Atg8a. H′ to H"’ show respectively the LAMP1 and Snap29, the LAMP1 and Atg8a, and the Snap29 and Atg8a merged channels. A high magnification of a typical cluster formed by GFP-LAMP1, Snap29 and Atg8a-positive vesicles is shown in (I). The 3 proteins are in close proximity. If Snap29 regulates fusion of autophagosomes with lysosomes, it should be found associated to these organelles. To investigate localization of Snap29 in epithelial cells, we first assessed specificity of the anti-Snap29 for immunolocalization. In discs (Fig. S4A), in Schneider-2 (S2) cells (Fig. S4B and C) and in the follicular epithelium (FE) enwrapping the germline in the adult ovary (Fig. S4E), anti-Snap29 marks cytoplasmic puncta, and such signal is reduced in clones of Snap29 mutant cells (Fig. S4A) or upon Snap29 depletion (Fig. S4C and D), indicating that the antibody is specifically recognizing endogenous Snap29. In FE of animals expressing GFP-LAMP1, a marker of late endosomes, Snap29 puncta only rarely overlap with GFP-LAMP1 puncta (). However, they are sometimes found in close proximity of clusters of Atg8a puncta surrounding GFP-LAMP1 positive structures (), indicating that Snap29 could transiently associate to autophagosomes to mediate lysosomal fusion.

Snap29 is a negative regulator of autophagosome secretion

Since we found presence of organelles with the morphology of autophagosomes in the apical lumen of Snap29 mutant discs (), we hypothesized that Snap29 could negatively regulate secretion at the plasma membrane. Consistent with this, we observed that secreted organelles in mutant cells are ref(2)P-and Atg8a-positive (). Secretion of autophagosomes could be an indirect consequence of intracellular accumulation of autophagosomes. To assess whether this is the case, we tested whether secretion of autophagosomes is also present in discs mutant for Syx17 and Vamp7, which have been proposed to regulate autophagosome fusion to lysosomes together with Snap29. Surprisingly, both by immunofluorescence and EM, we find that, while Syx17 and Vamp7 mutant tissues display accumulation of autophagosomes intracellularly, they are devoid of secreted autophagosomes (). In addition, in contrast to Snap29 mutant discs (), Syx17 and Vamp7 mutant discs possess normal morphology and N localization (). Taken together, these data indicate that autophagosome secretion is unlikely a consequence of impaired fusion of autophagosomes with lysosomes and suggest that Snap29 might negatively regulate fusion at the plasma membrane independent of Syx17 and Vamp7.
Figure 5.

Autophagosomes are secreted in Snap29 mutant discs. (A to D) Cross sections of WT and Snap29B6 mutant wing discs (A and B), or eye discs (C and D) stained as indicated. ref(2)P and Atg8a accumulate inside mutant cells and above the apical lumen of Snap29 mutant discs. White arrowheads highlight the apical plasma membrane of the tissue above which is the lumen between 2 epithelial folds. (E) ImmunoEM of a Snap29 mutant disc reveals Atg8a labeling of a large vesicle in the extracellular lumen. The white arrowheads indicate the apical plasma membrane. (F to I) Sections of eye discs mutant for Syx17 or Vamp7. ref(2)P and autophagosomes accumulate within mutant cells, but they are not present in the extracellular lumen. (J and K) Cross-sections of Syx17 and Vamp7 mutant eye discs stained as indicated. High magnifications (right panels and insets) show that unperturbed N localization and no colocalization of N with accumulated ref(2)P. Labels are as in .

Autophagosomes are secreted in Snap29 mutant discs. (A to D) Cross sections of WT and Snap29B6 mutant wing discs (A and B), or eye discs (C and D) stained as indicated. ref(2)P and Atg8a accumulate inside mutant cells and above the apical lumen of Snap29 mutant discs. White arrowheads highlight the apical plasma membrane of the tissue above which is the lumen between 2 epithelial folds. (E) ImmunoEM of a Snap29 mutant disc reveals Atg8a labeling of a large vesicle in the extracellular lumen. The white arrowheads indicate the apical plasma membrane. (F to I) Sections of eye discs mutant for Syx17 or Vamp7. ref(2)P and autophagosomes accumulate within mutant cells, but they are not present in the extracellular lumen. (J and K) Cross-sections of Syx17 and Vamp7 mutant eye discs stained as indicated. High magnifications (right panels and insets) show that unperturbed N localization and no colocalization of N with accumulated ref(2)P. Labels are as in .

Snap29 interacts with trafficking regulators and localizes to trafficking compartments

Spurred by the requirement for Snap29 in possibly at least 2 distinct fusion processes, we assessed which SNAREs can be found in complex with Snap29. Thus, we immuno-precipitated endogenous Snap29 from S2 cell extracts and subjected the recovered complexes to mass spectrometry (). In 4 experiments using 2 independently-raised polyclonal anti-Snap29 (this study and), we repeatedly identified a set of SNARE proteins that consists of the plasma membrane Qa-SNAREs Syx1A and Syx4, of the endosomal Qa-SNARE Syx7, and of the R-SNAREs Sec22, Synaptobrevin (Syb) and Vamp7. We have also found the SNARE-specific factors Nsf2, αSnap and γSnap1 and a limited set of other proteins (; Table S1). These data are consistent with large-scale protein complex identification approaches, and suggest that Snap29 associates with multiple SNARE complexes. Consistent with this, Snap29 depletion in the posterior half of developing wing imaginal discs leads to a reduction of adult wing tissue that is enhanced by depletion of Syx17 (Fig. S3E to G) or Vamp7 (Fig. S3H and I), or Sec22 (Fig. S3J and K). In addition, we find that, when overexpressed in the FE, the functional CFP-Snap29 localizes to the plasma membrane, partially to the Golgi apparatus and to the early endosome (). Finally, endogenous Snap29 partially localizes with the marker of the endosomal recycling compartment Rab11 (). Together, this evidence suggests that Drosophila Snap29 can associate to proteins and compartments important for secretion and recycling and degradation in endosomes.
Figure 6.

Snap29 interacts with SNARE proteins and localizes to multiple trafficking organelles. (A) Anti-Snap29 immunoblotting of Schneider-2 (S2) cell extracts immunoprecipitated with protein G only (IP G) and corresponding supernatant fraction (SN G), or with anti-yeast Mad2 as unrelated control (IP C) and corresponding supernatant fraction (SN C), or with rabbit anti-Snap29 (IP Snap29) and corresponding supernatant fraction (SN Snap29). Snap29 is efficiently immunoprecipitated only using anti-Snap29. (B) Membrane fusion proteins coimmunoprecipitated with Snap29 in at least 2 out of 4 experiments using 2 independently-raised anti-Snap29. The proportion of immunoprecipitations containing each protein is indicated. (C to E) Colocalization of CFP-Snap29 or Snap29 with markers of the indicated trafficking compartments in FE cells. Single medial confocal cross-sections are shown, with single channel below each panel. The insets show higher magnification of colocalized proteins. CFP-Snap29 localizes to the plasma membrane upon overexpression and partially colocalizes with markers of the Golgi apparatus (GM130; C), early endosomes (Syx7; D), while endogenous Snap29 partially colocalizes with recycling endosomes (GFP-Rab11; E).

Snap29 interacts with SNARE proteins and localizes to multiple trafficking organelles. (A) Anti-Snap29 immunoblotting of Schneider-2 (S2) cell extracts immunoprecipitated with protein G only (IP G) and corresponding supernatant fraction (SN G), or with anti-yeast Mad2 as unrelated control (IP C) and corresponding supernatant fraction (SN C), or with rabbit anti-Snap29 (IP Snap29) and corresponding supernatant fraction (SN Snap29). Snap29 is efficiently immunoprecipitated only using anti-Snap29. (B) Membrane fusion proteins coimmunoprecipitated with Snap29 in at least 2 out of 4 experiments using 2 independently-raised anti-Snap29. The proportion of immunoprecipitations containing each protein is indicated. (C to E) Colocalization of CFP-Snap29 or Snap29 with markers of the indicated trafficking compartments in FE cells. Single medial confocal cross-sections are shown, with single channel below each panel. The insets show higher magnification of colocalized proteins. CFP-Snap29 localizes to the plasma membrane upon overexpression and partially colocalizes with markers of the Golgi apparatus (GM130; C), early endosomes (Syx7; D), while endogenous Snap29 partially colocalizes with recycling endosomes (GFP-Rab11; E).

Snap29 regulates N secretion and endocytic degradation

To further identify at which steps of membrane trafficking Snap29 might function, we investigated localization and trafficking of N in mosaic eye-antennal imaginal discs containing Snap29 mutant cells. As already observed in Snap29 mutant discs () in Snap29 mutant cells we found that N accumulates, compared to WT cells (GFP-positive; ). The site of N accumulation is most likely the plasma membrane. In fact, excess N in mutant cells does not colocalize with markers of the Golgi apparatus or with the early endosomal marker Syx7 (). To assess whether excess N is exposed on the surface of Snap29 mutant cells, we labeled nonpermeabilized mosaic discs with an anti-N antibody that recognizes the N extracellular domain (anti-NECD). Compared to WT cells, localization of N at the plasma membrane in Snap29 mutant cells is increased and visible in punctate subdomain of the cell surface (), indicating that either delivery of N to the apical plasma membrane is increased in mutant cells, or that N internalization from the surface is decreased. To distinguish between these 2 possibilities, we cultured mosaic discs for 15 or 210 min after surface labeling with anti-NECD. This makes it possible to follow internalization in early endosomes (15′) and lysosomal degradation (210′) of N.2 In both WT and mutant cells, N is able to access Syx7-positive early endosomes 15 min after labeling (). In mutant cells a pool of N is still present in Syx7-negative puncta, representing either late endosomes or lysosomes, 210 min after pulse (). As expected for both upregulation of N secretion and decrease of N degradation, protein extracts from Snap29 mutant discs contain more N than WT discs and about the same amount of N compared to discs mutant for Vps25, which is required for endosomal degradation of N (). Overall, these data suggest that Snap29 is required to prevent excess N secretion to the plasma membrane, as well as to promote N degradation in a postendosomal compartment.
Figure 7.

Snap29 mutant cells display altered N trafficking. (A and B) Clones of Snap29 mutant cells in mosaic eye-antennal discs accumulate high levels of N, compared to surrounding WT cells. A′ and B″ are single channels. (C and D) Clones of Snap29 mutant cells in the anterior portion of a mosaic eye discs stained as indicated. N and GM130 do not colocalize in both WT and mutant cells, while a fraction of N colocalizes with Syx7 in both WT and mutant cells, excluding accumulation in these compartments. (C′ and D″) are single channels. (E) Labeling of nonpermeabilized Snap29 mosaic eye-antennal discs with an anti-N NECD. Compared to WT cells marked by expression of GFP, clones of mutant cells in the eye disc display higher N surface levels (Surf. N). E′ shows the single confocal channel for anti-N. (F and G) Z-sections of eye disc epithelia subjected to 15′ (F) and 210′ (G) internalization of anti-NECD and staining as indicated. Similar to WT cells, N is present on the apical plasma membrane of mutant cells (F, arrow) and is able to access early endosomes (F, arrowhead). N is efficiently internalized over time in both WT and mutant cells (G, arrow); however, in mutant cells it fails to be degraded and accumulates in a Syx7-negative compartment (G, arrowhead). (F′-G′) show the single confocal channel for anti-N. (H) 210′ min internalization of anti-NECD. Compared to WT cells, mutant cells display intracellular N accumulations. The actin-rich cell cortex is marked with phalloidin. (G′) shows the single confocal channel for anti-N. (I) Immunoblotting of protein extracts with an antibody recognizing the intracellular domain of N. Full-length N is approximately 300 kDa while the intracellular domain (iN) is 120 kDa. Both forms accumulated in Snap29 and Vps25 mutant discs, compared to WT. The same membrane blotted with anti-β-tubulin provides a loading control.

Snap29 mutant cells display altered N trafficking. (A and B) Clones of Snap29 mutant cells in mosaic eye-antennal discs accumulate high levels of N, compared to surrounding WT cells. A′ and B″ are single channels. (C and D) Clones of Snap29 mutant cells in the anterior portion of a mosaic eye discs stained as indicated. N and GM130 do not colocalize in both WT and mutant cells, while a fraction of N colocalizes with Syx7 in both WT and mutant cells, excluding accumulation in these compartments. (C′ and D″) are single channels. (E) Labeling of nonpermeabilized Snap29 mosaic eye-antennal discs with an anti-N NECD. Compared to WT cells marked by expression of GFP, clones of mutant cells in the eye disc display higher N surface levels (Surf. N). E′ shows the single confocal channel for anti-N. (F and G) Z-sections of eye disc epithelia subjected to 15′ (F) and 210′ (G) internalization of anti-NECD and staining as indicated. Similar to WT cells, N is present on the apical plasma membrane of mutant cells (F, arrow) and is able to access early endosomes (F, arrowhead). N is efficiently internalized over time in both WT and mutant cells (G, arrow); however, in mutant cells it fails to be degraded and accumulates in a Syx7-negative compartment (G, arrowhead). (F′-G′) show the single confocal channel for anti-N. (H) 210′ min internalization of anti-NECD. Compared to WT cells, mutant cells display intracellular N accumulations. The actin-rich cell cortex is marked with phalloidin. (G′) shows the single confocal channel for anti-N. (I) Immunoblotting of protein extracts with an antibody recognizing the intracellular domain of N. Full-length N is approximately 300 kDa while the intracellular domain (iN) is 120 kDa. Both forms accumulated in Snap29 and Vps25 mutant discs, compared to WT. The same membrane blotted with anti-β-tubulin provides a loading control.

Snap29 controls disc development in part by downregulating hop-Stat92E signaling

Our data indicate that Snap29 controls key steps of protein trafficking and autophagy in epithelial tissue, and that loss of Snap29 compromises epithelial organ development. To determine how Snap29 regulates disc development, we first tested whether N signaling is altered in Snap29 mutant tissue. In fact, activation of N signaling is known to promote proliferation and differentiation of disc tissue. By monitoring expression of the N reporter Enhancer of split mβ, helix-loop-helix (E(spl)mβ-HLH)-lacZ, which is transcribed in response to N activation, we found that Snap29 eye discs present decreased N signaling activity, compared to WT discs (). We then extended our analysis to a panel of signaling pathways important for development. We found that mutant discs express high levels of outstretched (os), a ligand known to activate hop-Stat92E signaling (). Consistent with this, we observed high expression of the hop-Stat92E signaling reporter 10XSTAT-GFP in Snap29 mutant discs, revealing that Snap29 is required to downregulate hop-Stat92E signaling ().
Figure 8.

Elevated hop-Stat92E signaling contributes to altered development of Snap29 mutant eye discs. (A and B) WT and Snap29 mutant eye discs expressing E(Spl)mβ-HLH-lacZ, a N signaling reporter, stained as indicated. Snap29 mutant discs display a reduction of N signaling compared to WT. A′ and B′ show single anti-β-Gal channels. (C) Expression of the indicated signaling target genes in eye disc extracts. The mRNA of a N target is decreased in Snap29 mutant eye-antennal disc extract, while the mRNA of the hop-Stat92E ligand os is greatly elevated, compared to WT. (D and E) The expression of the hop-Stat92E reporter gene 10XSTAT-GFP is increased in mutant discs compared to WT discs. D′-E′ are the single GFP channels. (F and G) WT and Snap29 mutant eye-antennal discs stained with anti-phospho-HistoneH3 (pHis3) to detect dividing cells. Compared to WT tissue in which proliferation is mostly limited to the differentiating photoreceptors along the morphogenetic furrow (arrowheads), mutant eye discs display areas containing several pH3-positive cells, suggesting that mutant cells overproliferate. The average number of pH3-positive cells in samples of the indicated genotype is indicated. P value (Wilcoxon-Mann Whitney Test) is 0.0625. F′-G′ are the single pHis3 channels. (H and I) Clones of Snap29 mutant cells in a mosaic eye discs stained as indicated. Compared to WT (GFP-positive) cells, mutant cells accumulate dome, mostly at the cell cortex. H′ and I′ shows single dome channels. (J and K) Adult eyes of flies of the indicated genotypes. Eye specific ectopic expression of Socs36E, a hop-Stat92E signaling inhibitor does not impair eye development (J). Socs36E expression in Snap29 mutant eye discs rescues in part eye development and yields adults with reduced eyes (K). In (K), mutant cells expressing the Socs36E give rise to orange photoreceptors, while the few WT cell to the dark red ones.

Elevated hop-Stat92E signaling contributes to altered development of Snap29 mutant eye discs. (A and B) WT and Snap29 mutant eye discs expressing E(Spl)mβ-HLH-lacZ, a N signaling reporter, stained as indicated. Snap29 mutant discs display a reduction of N signaling compared to WT. A′ and B′ show single anti-β-Gal channels. (C) Expression of the indicated signaling target genes in eye disc extracts. The mRNA of a N target is decreased in Snap29 mutant eye-antennal disc extract, while the mRNA of the hop-Stat92E ligand os is greatly elevated, compared to WT. (D and E) The expression of the hop-Stat92E reporter gene 10XSTAT-GFP is increased in mutant discs compared to WT discs. D′-E′ are the single GFP channels. (F and G) WT and Snap29 mutant eye-antennal discs stained with anti-phospho-HistoneH3 (pHis3) to detect dividing cells. Compared to WT tissue in which proliferation is mostly limited to the differentiating photoreceptors along the morphogenetic furrow (arrowheads), mutant eye discs display areas containing several pH3-positive cells, suggesting that mutant cells overproliferate. The average number of pH3-positive cells in samples of the indicated genotype is indicated. P value (Wilcoxon-Mann Whitney Test) is 0.0625. F′-G′ are the single pHis3 channels. (H and I) Clones of Snap29 mutant cells in a mosaic eye discs stained as indicated. Compared to WT (GFP-positive) cells, mutant cells accumulate dome, mostly at the cell cortex. H′ and I′ shows single dome channels. (J and K) Adult eyes of flies of the indicated genotypes. Eye specific ectopic expression of Socs36E, a hop-Stat92E signaling inhibitor does not impair eye development (J). Socs36E expression in Snap29 mutant eye discs rescues in part eye development and yields adults with reduced eyes (K). In (K), mutant cells expressing the Socs36E give rise to orange photoreceptors, while the few WT cell to the dark red ones. hop-Stat92E signaling is known to control proliferation during disc development, and ectopic signaling has been shown to contribute to aberrant architecture of mutant organs. Thus, we next assessed whether mutant discs contain more proliferating cells than controls. Proliferation in third instar eye discs from WT animals mostly occurs at the morphogenetic furrow (), consisting in a few rows of cells forming photoreceptors, as shown by immunolocalization of phospho-Histone H3 (pHis3)-positive cells (, arrowheads). In Snap29 mutant eye discs, pH3-positive cells are not statistically more abundant. However, parts of the mutant tissue with altered epithelial architecture display a noticeably high number of pHis3-positive cells, suggesting that some Snap29 mutant cells might overproliferate (). hop-Stat92E signaling in Drosophila is transduced by dome (domeless), the only hop-Stat92E receptor encoded by the fly genome. Because the level of hop-Stat92E signaling is controlled by endocytic trafficking of dome, a transmembrane protein, we next determined whether levels of dome are altered in Snap29 mutant cells. In mosaic eye discs, we could detect significant accumulations of dome on the surface of Snap29 mutant cells, compared to surrounding WT cells (GFP-Positive; ). These data indicate that mutant discs possess higher levels of a hop-Stat92E ligand, of the hop-Stat92E receptor, and of hop-Stat92E signaling activity that could affect tissue proliferation. Finally, to test whether elevated hop-Stat92E signaling is responsible for the phenotype of Snap29 mutant discs, we expressed in mutant-disc tissue Socs36E (suppressor of cytokine signaling at 36E), a negative regulator of the hop-Stat92E pathway thought to control endocytic degradation of dome. Surprisingly, eye disc-specific overexpression of Socs36E is sufficient to rescue the lethality of animals bearing Snap29 mutant eye discs. Animals rescued by increased Socs36E expression present very reduced eyes, bearing a few photoreceptors originating from mutant cells (), indicating that reduction of hop-Stat92E signaling rescues in part the phenotype of Snap29 mutant discs. These data indicate that elevated hop-Stat92E signaling contributes to the developmental defects observed in Snap29 mutant tissue.

Discussion

Our analysis of the first Drosophila loss of function mutant in Snap29 indicates that it acts at key steps of autophagy, secretion, and endolysosomal trafficking, as summarized in the model presented in . The implications of our findings on our understanding of Snap29 function and its impact on the biology of developing epithelial organs is discussed in detail below.
Figure 9.

A model for Snap29 function at distinct steps of trafficking in epithelial cells. Schematic model illustrating Snap29 activity on membrane trafficking routes and organelle morphology in epithelial cells. Labels as in Figure 1. Qa- and R-SNARE likely to interact with Snap29 at distinct steps of trafficking based on our study and the literature are listed on the right. AM, amphisome; AP, autophagosome. EE, early endosome; GA, Golgi apparatus; LY, lysosome; MVB, multivesicular body; NU, nucleus; PG, phagophore; PM, plasma membrane.

A model for Snap29 function at distinct steps of trafficking in epithelial cells. Schematic model illustrating Snap29 activity on membrane trafficking routes and organelle morphology in epithelial cells. Labels as in Figure 1. Qa- and R-SNARE likely to interact with Snap29 at distinct steps of trafficking based on our study and the literature are listed on the right. AM, amphisome; AP, autophagosome. EE, early endosome; GA, Golgi apparatus; LY, lysosome; MVB, multivesicular body; NU, nucleus; PG, phagophore; PM, plasma membrane.

The role of Snap29 in membrane fusion during autophagy in Drosophila

The identity of SNARE proteins regulating the subsequent steps of fusion required for autophagosome formation and maturation into autolysosomes is a long-standing question, on which significant progress has been reported recently. The SNAREs STX12/STX13, Ykt6, Vamp7, and Sec22 have been recently proposed to be required for autophagosome formation in yeast, Drosophila and mammals. In yeast, the SNAREs Vam3, Vam7, and Vti1 have all been suggested to control fusion of autophagosomes with vacuoles. While Vam3 and Vam7 have no clear homologs in metazoan animals, the mammalian SNAREs VAMP7, VAMP8, and VTI1B are all suggested to be involved in autophagosomal fusion events (for review see ref. 57). The Qa-SNARE protein STX17 is required for membrane fusion at 2 distinct steps of autophagy: Early autophagosome formation and fusion of autophagosomes with lysosomes to form autolysosomes. An association of Syx17 with Snap29 and the R-SNARE protein Vamp7 to form a fusion complex specific for late step of autophagy has been also very recently reported in the Drosophila fat tissue. Additionally, a certain degree of accumulation of autophagosomes has been observed in C. elegans depleted of Snap-29. Our ultrastructural analysis showing clearly accumulation of almost exclusively fully formed autophagosomes with preserved luminal content strongly favors the model that Snap29 is required with Syx17 and Vamp7 for fusion of autophagosomes with lysosomes. Consistent with this evidence, we found accumulation of autophagosomes in Syx17 and Vamp7 mutant discs and we detected a genetic interaction between Snap29 and Syx17, and Snap29 and Vamp7. An aspect that demands further investigation is whether Snap29 acts elsewhere in the endolysosomal system. We find contrasting evidence for this. On one end, we find partial colocalization of Snap29 with the endosomal Qa-SNARE Syx7, and repeatedly find Syx7 in our immunoprecipitations. In addition, in our uptake assays, in mutant cells the endocytic cargo N accumulates in an endosomal compartment. On the other end, such compartment is Syx7 negative. Since accumulation of N in a Syx7-positive endosomes has been reported to promote ectopic N activation, and we have found reduced N signaling in Snap29 mutant discs, the point of N accumulation could be a postsorting compartment, such as the late endosome/MVB, or the lysosome. Despite this, we do not observe MVB accumulation in Snap29 mutant discs. These data are in sharp contrast with the accumulation of MVBs, but not of autophagosomes, that is observed in epithelial tissue mutant for vacuolar H+-ATPase (V-ATPase) subunit genes. Interestingly, in addition to enabling lysosomal functioning, V-ATPase have been proposed to play a role in membrane fusion and in autophagy. However, in addition to lack of accumulation of MVBs, we also find very little sign of acid-induced degradation in the autophagosomes accumulated in Snap29 mutant cells. Thus, the comparison between the EM findings in Snap29 and V-ATPase mutants suggests that Snap29 functions upstream of V-ATPase in autophagy and argues against a role of V-ATPase in autophagosome formation or fusion to lysosomes.

Is Snap29 a positive regulator of membrane fusion?

We observed traits in Snap29 mutant cells that could be the result of excess or inappropriate membrane fusion events, rather than of reduced fusion. These are: the large amount of membranes forming the accumulated autophagosomes; the presence in these of folded, multilamellar membranes; the secretion of autophagosomes extracellularly. It is unlikely that these events are an indirect result from the need of mutant cells to get rid of autophagic cargoes. In fact, we find no autophagosome secretion or excess membrane around autophagosomes in Syx17 and Vamp7 mutant discs. Alternatively, excess autophagosome membrane and secretion could both arise from failure to inhibit excess vesicle fusion. Inhibitory SNAREs have been postulated to occur naturally to control Golgi stack fusion patterns, while bacteria encode inhibitory SNAREs containing 2 SNARE domains, that can act with STX7 and VAMP8 (the homologs of Drosophila Syx7 and Vamp7) to inhibit secretion of lysosomes in mammalian cells. Interestingly, negative regulation of fusion by SNAP29 at the plasma membrane has been observed in rat neurons. A direct role of Snap29 in inhibition of membrane fusion at the plasma membrane during secretion could account also for the elevated N and dome levels on the surface of mutant cells. Consistent with this possibility, we find that Snap29 interacts with Syx1A and Syx4, 2 plasma membrane syntaxins and can localize to the plasma membrane upon overexpression. Of note, unconventional secretion routes involving autophagy regulators have been recently described, suggesting a scenario in which the autophagy and secretion functions of Snap29 could be connected to a putative negative role in fusion. The nature of Snap29 function in fusion events, and its involvement in unconventional secretion routes are currently under investigation.

The function of Snap29 in Drosophila tissue architecture and CEDNIK pathogenesis

Despite the large body of evidence on SNAP29, the pathogenesis of CEDNIK is obscure. Our genetic analysis reveals that the Drosophila Snap29 mutant behaves as a strong loss of function and expresses a nonfunctional Snap29 protein, a similar situation to that reported for CEDNIK. Considering the absence of mouse mutants for Snap29, our findings in Drosophila could provide an initial framework to understand the pathogenesis of CEDNIK, which starts during fetal development and affects epithelial organs. In this regard, we observed that the in vivo effect of lack of Snap29 during development in Drosophila is also epithelial tissue disorganization. This phenotype is unlikely to be due to impaired autophagy. In fact, we find that genes specifically acting during autophagy, such as Atg13, Syx17, and Vamp7 are dispensable for eye disc development. In addition, Atg7 appears dispensable for skin barrier formation in mice and flies. This evidence predicts that impairment of autophagy does not cause the developmental alterations associated to CEDNIK at least in the skin, which have been fairly well characterized. It is well possible that impaired autophagy plays a role in the unexplored neuronal traits of CEDNIK, considering that autophagy is a major process preventing neurodegeneration (for review see ref. 68.) Which of the nonautophagy defects associated to lack of Snap29 could then be relevant to skin pathogenesis in CEDNIK? Could it be the defect highlighted by N accumulation in late endosomal and lysosomal compartments in our uptake experiment? We do not favor this hypothesis. In fact, we do not detect ectopic N activation, which is a feature of mutants of ESCRT genes controlling endosomal sorting. Such difference suggests that in Snap29 mutant cells, the pool of N accumulating intracellularly has been subjected to MVB sorting and resides in the late endosomal and lysosomal lumen. Considering also that loss of genes that control post MVB sorting events generally does not perturb disc epithelium development, the defect highlighted by intracellular N accumulation in Snap29 mutant cells is per se unlikely to contribute to the developmental phenotypes of Snap29 mutant organs. Excluding routes that converge on the lysosomes, a further possibility is that the epithelial defects are due to alteration of secretory trafficking. Increased N presence at the plasma membrane, coupled with decreased N activation, could be relevant, since loss of N signaling is known to lead to epithelial alterations in skin. Alternatively, excess hop-Stat92E signaling could be important. In this case, excess signaling could directly originate from increased levels of active dome on the surface of Snap29 mutant cells. This scenario is consistent with the fact that Drosophila mutants preventing cargo internalization, such as those disrupting clathrin, display increased level of cargoes at the plasma membrane and possess elevated hop-Stat92E signaling and reduced N signaling. Underscoring a possible problem at the plasma membrane, expression of Socs36E, a negative regulator of hop-Stat92E signaling reported to act also by enhancing endosomal degradation of dome, rescues part of the epithelial defects of Snap29 mutant discs. Alternatively, elevated hop-Stat92E signaling could be a secondary effect of epithelial architecture or trafficking alterations. Detailed analysis of secretion and of signaling activity in CEDNIK samples will reveal whether alteration of these processes play a role in the pathogenesis of the syndrome. In summary, our study clarifies the function of Snap29 in membrane trafficking and its consequences for epithelial tissue development, which might prove relevant for human health.

Materials and Methods

Fly strains, mapping, and genetics

Flies were maintained on standard yeast/cornmeal/agar media. All experiments were performed at 25°C. Mosaic eye imaginal discs were generated using yw eyFLP; ubiGFP[w+] FRT42, while mutant eye discs were generated using yw, eyFLP; cl[w+], FRT42/CyO, TwiGal4, UAS-GFP. Similar lines with different FRTs, or with UbxFLP, were used to generate mutant tissue for genes located on different chromosome arms or to generate mutant wing disc tissue, as previously described. Other alleles used were w; FRT42D, Vps25, yv; UAS Snap29 RNAi (Bloomington Drosophila Stock Center [BDSC] # 25862), Atg13 FRT42D, fab1 Syx17 and Df(3L)Exel8098 (all from), UAS-Syx17 RNAi (Vienna Drosophila Research Center - [VDRC] #GD36596), UAS Vamp7 RNAi (VDRC #GD13317), UAS Sec22 RNAi (VDRC #GD9888), UAS Socs36E (a gift from M. Zeidler). To identify the locus affected by B6 mutation, MENE-(2R)-E/B6 was crossed to the 2R Deficiency (Df) kit (BDSC). Such complementation mapping revealed the presence of 2 lethal mutations around 51A-B and 60A. Blind recombination of MENE-(2R)-E/B6 to w-; FRT42D revealed that the lethality leading to the MENE phenotype was the one at 60A. Recombinant #21 (B6-21) was used for further characterization. Briefly, submapping by Df complementation around 60A narrowed the candidate region to 60A3-5. Independent recombination mapping also showed absence of recombination with 2 viable P-elements (KG01846 [BDSC #14169] and KG04017 [BDSC #13357]) mapping to 60A3 and 60A5, confirming the presence of the mutation at 60A3-5. Direct sequencing of candidate gene exons revealed a mutation in CG11173/Snap29. For transgenic rescue experiments we used w; FRT42, GMR-Hid/CyO, eyGal4, UASFLP. Transgenic fly lines carrying mutant tagged and mutant Snap29 forms were generated by standard techniques using the attP/attB recombination system. Over expression in follicle cells was obtained using the Cy2-Gal4 (BDSC). For colocalization experiments, we used UAS GFP-Rab11 and UAS-GFP-LAMP1 (a gift of H. Kramer). The 10XSTAT-GFP and E(spl)mβ-HLH-lacZ transgenic flies were kindly provided by E. Bach and E. Lai, respectively. Detailed genotypes for all samples in figures are shown in Table S2.

Molecular biology and bioinformatics

Sequencing of Snap29 exons was performed as previously described, using the following primers : Snap29 1F 5′-GATAACTCCAGACAACAACAAAG-3′ Snap29 1R 5′-CTGGGGGTTGTAGGAGAGAG-3′; Snap29 2F 5′-CTGGACTCTACCAACAAAAGC-3′ Snap29 2R 5′-ACCGGATGATTGTCGTAGC-3′; Snap29 3F 5′-GCCAATAGCAACATTAACC-3′ Snap29 3R 5′-CTTAATGGCCTTGTGAAGTGC-3′. CFP-Snap29, SNARE1Δ, SNARE2Δ and NPF>AAA inserts were cloned EcoRI XbaI into a pUASattB plasmid. To generate the CFP-tagged Snap29, the CFP and the Snap29 coding sequences were amplified from a Snap29 cDNA vector (Drosophila Genomic Research Center) with the following primers: CFP F EcoRI: 5′-GATCGAATTCATGGTGAGCAAGGGCGAGGA-3′ CFP R : 5′-TAGTTATGGGCCTTGTGCAGCTCGT -3′ Snap29 F: 5′-ACGAGCTGTACAAGGCCCATAACTA -3′ Snap29 R XbaI: 5′-GATCTCTAGAGCTATTCTAAGCAATG -3′ The 2 PCR products were then used as template for a second PCR using CFP F EcoRI and Snap29 R XbaI as primers. To generate the SNARE1Δ insert 2 regions (290 bp and 532 bp) of Snap29 cDNA were amplified with the following primers: SNARE1Δ 1F EcoRI 5′-GATCGAATTCGAAGTTTCCCTCGCC-3′ SNARE1Δ 1R 5′-CAGACCAGTCAGATGAGTTCGCTGCTCAATG-3′; SNARE1Δ 2F 5′-ATTGAGCAGCGAACTCATCTGACTGGTCTG-3′ SNARE1Δ 2R XbaI 5′-GATCTCTAGAGCTATTCTAAGCAATG-3′. The 2 PCR products were used as templates for a second PCR using SNARE1Δ 1F EcoRI and SNARE1Δ 2R XbaI as primers. To generate the SNARE2Δ insert was amplified with the following primers: SNARE2Δ F 5′-GATCGAATTCGAAGTTTCCCTCGCC-3′ SNARE2Δ R 5′-GATCTCTAGAGAATGCTCGCTTGTTCACTGGTAGGTGCTGCTG-3′. To generate the NPF>AAA insert 2 PCR were performed using the following primers: NPF>AAA 1F EcoRI 5′- GATCGAATTCGAAGTTTCCCTCGCC-3′ NPF>AAA 1R 5′-CATCCATCTCTGCGGCTGCGGTGCTCCTC-3′, NPF>AAA 2F 5′-GAGGAGCACCGCAGCCGCAGAGATGGATG-3′ NPF>AAA 2R XbaI 5′-GATCTCTAGAGCTATTCTAAGCAATG-3′. The 2 PCR products were used as a template for a second PCR with NPF>AAA 1F EcoRI and NPF>AAA 2R XbaI as primers. To produce a GST-Snap29 for antibody generation, we generated an insert by PCR using the following primers: GST BamHI 5′-GATCGGATCCGCCCATAACTACCTGC-3′ GST XhoI 5′-GATCCTCGAGGCTATTCTAAGCAATG-3′. The PCR product was inserted using BamHI and XhoI into pGEX -GST (Addgene Vector Database, 27-4597-01). Double-stranded (ds) RNAs for intererence in S2 cells have been generated using the following primers: T3-Snap29 5′-TAATACGACTCACTATAGGGAGA AACCCAGGAGGTGGGTAAG-3′ T7- Snap29 5′-AATTAACCCTCACTAAAGGGAGA ATGTTATCCAGCAATTCATTTTG-3′ DsRNA were in vitro transcribed with the T3 (Promega, P208C) and T7 (Promega, P207B) polymerase according to manufacturer's instructions, annealed, and incubated with the cells at a final concentration of 15ug/106 cells for 72 h. Multiple sequence analysis was performed using ClustalX using standard parameters. Antibody production GST-Snap29 expression was carried out in the E. coli BL21 strain (NEB, C2530H) upon IPTG induction and gluthatione-Sepharose beads (Invitrogen, 10-1243) purification was performed under standard conditions. The purified protein was used for rabbit immunizations (Eurogentech, Liège, Belgium). Sera were affinity purified using AminoLink® Kit (Pierce Biotechnology, 44890).

Immunostainings and N trafficking analysis

Imaginal disc, ovaries, and fat bodies were fixed and stained under standard conditions. N surface staining and N trafficking assays were performed as described. Primary antibodies against the following antigens were used: Rabbit anti-Snap29 1:1000, rabbit anti-Syx7 1:100, rabbit anti-GM130 1:1000 (Abcam, ab30637), rabbit anti-ref(2)P 1:1000,, rat anti-Atg8a 1:300, mouse anti-βGal 1:25 (Developmental Studies Hybridoma Bank - DSHB, 40-1a-s), mouse anti-mono- and polyubiquitinylated conjugates (FK2) 1:100 (ENZO, BML-PW8810), rabbit anti-pHis3 1:200 (Cell Signaling Technology, 3377), rabbit anti-activated decay/caspase 3 1:100 (Cell Signaling Technology, 9661), mouse anti-NECD 1:100 (DSHB, C458.2H-a), 1:100 anti-α-tubulin (AbD SeroTech, MCA78G), rabbit anti-dome 1:100 (a gift from S. Noselli), chicken anti-GFP 1:1000 (Abcam, ab13970). Appropriate Alexa Fluor 647-, Alexa Fluor 488- and Cy3-conjugated secondary antibodies were used (Jackson Immunoresearch Laboratories: Cy3 conjugate, mouse [715-165-150], rabbit [711-165-152], rat [712-165-150]; Life Technologies/Invitrogen: mouse [A-21202], rabbit [A-21206], rat [A-21203], mouse [A-31571], rabbit [A-31573], rat [A-21247]) and rhodamine-phalloidin (Sigma, P1951) were used. All images are single confocal sections taken with a confocal microscope (Leica, Heidelberg, Germany) using ×16/NA 0.5, ×40/NA 1.25, or ×63/NA 1.4 oil lenses. Images were edited with Adobe Photoshop and ImageJ and assembled with Adobe Illustrator.

Western blot, immunoprecipitation, and LC-MS/MS analysis

Third instar larva eye imaginal discs were collected, homogenized and incubated for 20 min on ice in 1 mM Tris-HCl, 150 mM NaCl, 5 mM EDTA, 1% Triton X-100 (Sigma, T8787), 1% deoxycholate (Sigma, D6750) and 0.1% SDS (Sigma, L4522). Lysates were cleared by centrifugation. Supernatant fractions were recovered and quantified, separated by SDS-PAGE and transferred to nitrocellulose by standard methods. Primary antibodies used were rabbit anti-Snap29 (this study) 1:1000, anti-ref(2)P 1:1000, anti-ubiquitin (PD41) 1:1000 (Santa Cruz Biotechnology, sc8017), anti NICD 1:1000 (DSHB, c17.9c6-s), mouse anti-β-tubulin 1:8000 (GE Healthcare, 13-8000), anti-p6Sk (1:2000) (a gift from A. Teleman, DKFZ, Heidelberg, Germany). Secondary antibodies used were anti-rabbit and anti-mouse 1:8000 (GE Healthcare, NA934 and NXA931). Immunoblots were visualized with SuperSignal West pico/femto Chemioluminescent Substrate (Thermo Scientific, 34080-34095) using Chemidoc (Bio-Rad, Hercules, CA, USA). For immunoprecipitations, S2 cells were cultured under standard conditions and incubated for 20 min on ice in lysis buffer (50 mM HEPES, pH 7.4, 150 mM NaCl, 10% glycerol, 5 mM EDTA, 1% Triton X-100, 15 mM MgCl2, 0.1 M Na4O7P2 pH 7.5, 1 mM PMSF (Sigma, P7626), 0.5 M Na3VO4, 0.5 M NaF and protease inhibitors (Sigma, P2714). Lysates were clarified by centrifugation and immunoprecipitated with 8μl of purified rabbit anti-Snap29, 3 μl of crude rat anti-Snap29 or with 4 μl of purified anti-yeast Mad2 antibody (a gift from A. Ciliberto, IFOM, Milan, Italy) as negative control, in combination with protein G-Sepharose. Precipitated immunocomplexes were washed and subjected to western blot analysis as previously described using the anti-Snap29 antibody. For LC-MS/MS analysis, proteins were separated and processed as described. Peptides were analyzed by liquid chromatography on an Agilent 1100 LC system (Agilent Technologies, Santa Clara CA, USA) coupled to LTQ-FT ultra (Thermo Fisher Scientific, Waltham, MA, USA). Mass spectrometric data were analyzed for protein identification and presence of diglycine signature using Mascot Deamon and Proteome Discoverer 1.1 (1.1.0.263 Thermo Fisher Scientific, Waltham, MA, USA).

Reverse Transcription (RT)-PCR

RT-PCR was performed as described. The following primers were used: Snap29 F 5′ – AGCAGCGAACTCTGGACTCT – 3′, Snap29 R 5′ – TGTGATGTCTTCTCCAGTTGCT – 3′; E(Spl)mβ-HLH F 5′ –GAGTGCCTGACCCAGGAG – 3′ E(Spl)mβ-HLH R 5′ – CGGTCAGCTCCAGGATGT – 3′; os F 5′ –ATGGCCGAGTCCTGGCTACTGTT – 3′, os R 5′ – AACTGGATCGACTATCGCAACTTC – 3′; Atg8a F 5′ - GGGATGCATCGGAATGAA – 3′, Atg8a R 5′ – CGGTTTTCCTCAATTCGTTT – 3′; Atg18b F 5′ - AAAATACAATCACCAAAGCACAAA – 3′, Atg18b R 5′ – GTCCTGGTTGAAGTTCATTTGAT – 3′; Rpl32 F 5′ – CGGATCGATATGCTAAGCTGT – 3′, Rpl32 R 5′ – CGACGCACTCTGTTGTCG – 3′. Amplicon expression in each sample was normalized to its RpL32-RA mRNA content.

Electron microscopy and tomography

For morphological EM of Drosophila tissue, samples were prepared as previously described. Briefly, samples were fixed with 1% glutaraldehyde for 1 h and then with 1% reduced OsO4 for 1 h and embedded into Epoxy embedding medium (Sigma, 45359) or gelatin type A (Sigma, G8150). Then, constantly checking the position of the section plane with the help of stained semi-thin sections Epon or cryo-sections were prepared. Cryo-sections were then labeled with rabbit anti-ref(2)P antibody 1:100 or with rat anti-Atg8a antibody 1:40. The primary antibody was marked with 10 nm gold (a gift from G. Posthuma, University Medical Center, Utrecht, The Netherlands). The analysis of chemically fixed samples by electron tomography was performed on 200-nm-thick sections, as described previously. Briefly, samples were tilted from +65° to –65° at 1° intervals, with a magnification of 26,500x or 40,000x. At least 5 tomograms were analyzed per each experimental condition.
  78 in total

1.  Discrete enhancer elements mediate selective responsiveness of enhancer of split complex genes to common transcriptional activators.

Authors:  D T Nellesen; E C Lai; J W Posakony
Journal:  Dev Biol       Date:  1999-09-01       Impact factor: 3.582

Review 2.  Notch signaling: cell fate control and signal integration in development.

Authors:  S Artavanis-Tsakonas; M D Rand; R J Lake
Journal:  Science       Date:  1999-04-30       Impact factor: 47.728

3.  Role and regulation of starvation-induced autophagy in the Drosophila fat body.

Authors:  Ryan C Scott; Oren Schuldiner; Thomas P Neufeld
Journal:  Dev Cell       Date:  2004-08       Impact factor: 12.270

4.  Role for Rab7 in maturation of late autophagic vacuoles.

Authors:  Stefanie Jäger; Cecilia Bucci; Isei Tanida; Takashi Ueno; Eiki Kominami; Paul Saftig; Eeva-Liisa Eskelinen
Journal:  J Cell Sci       Date:  2004-08-31       Impact factor: 5.285

5.  Isolation and characterization of rat liver amphisomes. Evidence for fusion of autophagosomes with both early and late endosomes.

Authors:  T O Berg; M Fengsrud; P E Strømhaug; T Berg; P O Seglen
Journal:  J Biol Chem       Date:  1998-08-21       Impact factor: 5.157

6.  GS32, a novel Golgi SNARE of 32 kDa, interacts preferentially with syntaxin 6.

Authors:  S H Wong; Y Xu; T Zhang; G Griffiths; S L Lowe; V N Subramaniam; K T Seow; W Hong
Journal:  Mol Biol Cell       Date:  1999-01       Impact factor: 4.138

7.  Rab7 is required for the normal progression of the autophagic pathway in mammalian cells.

Authors:  Maximiliano G Gutierrez; Daniela B Munafó; Walter Berón; María I Colombo
Journal:  J Cell Sci       Date:  2004-05-11       Impact factor: 5.285

8.  Three novel proteins of the syntaxin/SNAP-25 family.

Authors:  M Steegmaier; B Yang; J S Yoo; B Huang; M Shen; S Yu; Y Luo; R H Scheller
Journal:  J Biol Chem       Date:  1998-12-18       Impact factor: 5.157

9.  Prelysosomal convergence of autophagic and endocytic pathways.

Authors:  P B Gordon; P O Seglen
Journal:  Biochem Biophys Res Commun       Date:  1988-02-29       Impact factor: 3.575

10.  i-SNAREs: inhibitory SNAREs that fine-tune the specificity of membrane fusion.

Authors:  Oleg Varlamov; Allen Volchuk; Vahid Rahimian; Claudia A Doege; Fabienne Paumet; William S Eng; Nancy Arango; Francesco Parlati; Mariella Ravazzola; Lelio Orci; Thomas H Söllner; James E Rothman
Journal:  J Cell Biol       Date:  2003-12-29       Impact factor: 10.539

View more
  36 in total

1.  Dedicated SNAREs and specialized TRIM cargo receptors mediate secretory autophagy.

Authors:  Tomonori Kimura; Jingyue Jia; Suresh Kumar; Seong Won Choi; Yuexi Gu; Michal Mudd; Nicolas Dupont; Shanya Jiang; Ryan Peters; Farzin Farzam; Ashish Jain; Keith A Lidke; Christopher M Adams; Terje Johansen; Vojo Deretic
Journal:  EMBO J       Date:  2016-12-08       Impact factor: 11.598

Review 2.  Roles for RAB24 in autophagy and disease.

Authors:  Päivi Ylä-Anttila; Eeva-Liisa Eskelinen
Journal:  Small GTPases       Date:  2017-05-19

3.  The Q-soluble N-Ethylmaleimide-sensitive Factor Attachment Protein Receptor (Q-SNARE) SNAP-47 Regulates Trafficking of Selected Vesicle-associated Membrane Proteins (VAMPs).

Authors:  Aurelia Kuster; Sebastien Nola; Florent Dingli; Barbara Vacca; Christian Gauchy; Jean-Claude Beaujouan; Marcela Nunez; Thomas Moncion; Damarys Loew; Etienne Formstecher; Thierry Galli; Veronique Proux-Gillardeaux
Journal:  J Biol Chem       Date:  2015-09-10       Impact factor: 5.157

4.  Autophagy Is Required for Maturation of Surfactant-Containing Lamellar Bodies in the Lung and Swim Bladder.

Authors:  Hideaki Morishita; Yuki Kanda; Takeshi Kaizuka; Haruka Chino; Kazuki Nakao; Yoshimi Miki; Yoshitaka Taketomi; Jun-Lin Guan; Makoto Murakami; Atsu Aiba; Noboru Mizushima
Journal:  Cell Rep       Date:  2020-12-08       Impact factor: 9.423

5.  Enteroviruses Remodel Autophagic Trafficking through Regulation of Host SNARE Proteins to Promote Virus Replication and Cell Exit.

Authors:  Abigail K Corona; Holly M Saulsbery; Angel F Corona Velazquez; William T Jackson
Journal:  Cell Rep       Date:  2018-03-20       Impact factor: 9.423

Review 6.  Finding the Middle Ground for Autophagic Fusion Requirements.

Authors:  Abigail K Corona; William T Jackson
Journal:  Trends Cell Biol       Date:  2018-08-13       Impact factor: 20.808

Review 7.  Postsynaptic SNARE Proteins: Role in Synaptic Transmission and Plasticity.

Authors:  María Pilar Madrigal; Adrián Portalés; María Pérez SanJuan; Sandra Jurado
Journal:  Neuroscience       Date:  2018-11-17       Impact factor: 3.590

Review 8.  Molecular Functions of Glycoconjugates in Autophagy.

Authors:  Kamau Fahie; Natasha E Zachara
Journal:  J Mol Biol       Date:  2016-06-23       Impact factor: 5.469

9.  DnaJ/Hsc70 chaperone complexes control the extracellular release of neurodegenerative-associated proteins.

Authors:  Sarah N Fontaine; Dali Zheng; Jonathan J Sabbagh; Mackenzie D Martin; Dale Chaput; April Darling; Justin H Trotter; Andrew R Stothert; Bryce A Nordhues; April Lussier; Jeremy Baker; Lindsey Shelton; Mahnoor Kahn; Laura J Blair; Stanley M Stevens; Chad A Dickey
Journal:  EMBO J       Date:  2016-06-03       Impact factor: 11.598

10.  Guidelines for the use and interpretation of assays for monitoring autophagy (3rd edition).

Authors:  Daniel J Klionsky; Kotb Abdelmohsen; Akihisa Abe; Md Joynal Abedin; Hagai Abeliovich; Abraham Acevedo Arozena; Hiroaki Adachi; Christopher M Adams; Peter D Adams; Khosrow Adeli; Peter J Adhihetty; Sharon G Adler; Galila Agam; Rajesh Agarwal; Manish K Aghi; Maria Agnello; Patrizia Agostinis; Patricia V Aguilar; Julio Aguirre-Ghiso; Edoardo M Airoldi; Slimane Ait-Si-Ali; Takahiko Akematsu; Emmanuel T Akporiaye; Mohamed Al-Rubeai; Guillermo M Albaiceta; Chris Albanese; Diego Albani; Matthew L Albert; Jesus Aldudo; Hana Algül; Mehrdad Alirezaei; Iraide Alloza; Alexandru Almasan; Maylin Almonte-Beceril; Emad S Alnemri; Covadonga Alonso; Nihal Altan-Bonnet; Dario C Altieri; Silvia Alvarez; Lydia Alvarez-Erviti; Sandro Alves; Giuseppina Amadoro; Atsuo Amano; Consuelo Amantini; Santiago Ambrosio; Ivano Amelio; Amal O Amer; Mohamed Amessou; Angelika Amon; Zhenyi An; Frank A Anania; Stig U Andersen; Usha P Andley; Catherine K Andreadi; Nathalie Andrieu-Abadie; Alberto Anel; David K Ann; Shailendra Anoopkumar-Dukie; Manuela Antonioli; Hiroshi Aoki; Nadezda Apostolova; Saveria Aquila; Katia Aquilano; Koichi Araki; Eli Arama; Agustin Aranda; Jun Araya; Alexandre Arcaro; Esperanza Arias; Hirokazu Arimoto; Aileen R Ariosa; Jane L Armstrong; Thierry Arnould; Ivica Arsov; Katsuhiko Asanuma; Valerie Askanas; Eric Asselin; Ryuichiro Atarashi; Sally S Atherton; Julie D Atkin; Laura D Attardi; Patrick Auberger; Georg Auburger; Laure Aurelian; Riccardo Autelli; Laura Avagliano; Maria Laura Avantaggiati; Limor Avrahami; Suresh Awale; Neelam Azad; Tiziana Bachetti; Jonathan M Backer; Dong-Hun Bae; Jae-Sung Bae; Ok-Nam Bae; Soo Han Bae; Eric H Baehrecke; Seung-Hoon Baek; Stephen Baghdiguian; Agnieszka Bagniewska-Zadworna; Hua Bai; Jie Bai; Xue-Yuan Bai; Yannick Bailly; Kithiganahalli Narayanaswamy Balaji; Walter Balduini; Andrea Ballabio; Rena Balzan; Rajkumar Banerjee; Gábor Bánhegyi; Haijun Bao; Benoit Barbeau; Maria D Barrachina; Esther Barreiro; Bonnie Bartel; Alberto Bartolomé; Diane C Bassham; Maria Teresa Bassi; Robert C Bast; Alakananda Basu; Maria Teresa Batista; Henri Batoko; Maurizio Battino; Kyle Bauckman; Bradley L Baumgarner; K Ulrich Bayer; Rupert Beale; Jean-François Beaulieu; George R Beck; Christoph Becker; J David Beckham; Pierre-André Bédard; Patrick J Bednarski; Thomas J Begley; Christian Behl; Christian Behrends; Georg Mn Behrens; Kevin E Behrns; Eloy Bejarano; Amine Belaid; Francesca Belleudi; Giovanni Bénard; Guy Berchem; Daniele Bergamaschi; Matteo Bergami; Ben Berkhout; Laura Berliocchi; Amélie Bernard; Monique Bernard; Francesca Bernassola; Anne Bertolotti; Amanda S Bess; Sébastien Besteiro; Saverio Bettuzzi; Savita Bhalla; Shalmoli Bhattacharyya; Sujit K Bhutia; Caroline Biagosch; Michele Wolfe Bianchi; Martine Biard-Piechaczyk; Viktor Billes; Claudia Bincoletto; Baris Bingol; Sara W Bird; Marc Bitoun; Ivana Bjedov; Craig Blackstone; Lionel Blanc; Guillermo A Blanco; Heidi Kiil Blomhoff; Emilio Boada-Romero; Stefan Böckler; Marianne Boes; Kathleen Boesze-Battaglia; Lawrence H Boise; Alessandra Bolino; Andrea Boman; Paolo Bonaldo; Matteo Bordi; Jürgen Bosch; Luis M Botana; Joelle Botti; German Bou; Marina Bouché; Marion Bouchecareilh; Marie-Josée Boucher; Michael E Boulton; Sebastien G Bouret; Patricia Boya; Michaël Boyer-Guittaut; Peter V Bozhkov; Nathan Brady; Vania Mm Braga; Claudio Brancolini; Gerhard H Braus; José M Bravo-San Pedro; Lisa A Brennan; Emery H Bresnick; Patrick Brest; Dave Bridges; Marie-Agnès Bringer; Marisa Brini; Glauber C Brito; Bertha Brodin; Paul S Brookes; Eric J Brown; Karen Brown; Hal E Broxmeyer; Alain Bruhat; Patricia Chakur Brum; John H Brumell; Nicola Brunetti-Pierri; Robert J Bryson-Richardson; Shilpa Buch; Alastair M Buchan; Hikmet Budak; Dmitry V Bulavin; Scott J Bultman; Geert Bultynck; Vladimir Bumbasirevic; Yan Burelle; Robert E Burke; Margit Burmeister; Peter Bütikofer; Laura Caberlotto; Ken Cadwell; Monika Cahova; Dongsheng Cai; Jingjing Cai; Qian Cai; Sara Calatayud; Nadine Camougrand; Michelangelo Campanella; Grant R Campbell; Matthew Campbell; Silvia Campello; Robin Candau; Isabella Caniggia; Lavinia Cantoni; Lizhi Cao; Allan B Caplan; Michele Caraglia; Claudio Cardinali; Sandra Morais Cardoso; Jennifer S Carew; Laura A Carleton; Cathleen R Carlin; Silvia Carloni; Sven R Carlsson; Didac Carmona-Gutierrez; Leticia Am Carneiro; Oliana Carnevali; Serena Carra; Alice Carrier; Bernadette Carroll; Caty Casas; Josefina Casas; Giuliana Cassinelli; Perrine Castets; Susana Castro-Obregon; Gabriella Cavallini; Isabella Ceccherini; Francesco Cecconi; Arthur I Cederbaum; Valentín Ceña; Simone Cenci; Claudia Cerella; Davide Cervia; Silvia Cetrullo; Hassan Chaachouay; Han-Jung Chae; Andrei S Chagin; Chee-Yin Chai; Gopal Chakrabarti; Georgios Chamilos; Edmond Yw Chan; Matthew Tv Chan; Dhyan Chandra; Pallavi Chandra; Chih-Peng Chang; Raymond Chuen-Chung Chang; Ta Yuan Chang; John C Chatham; Saurabh Chatterjee; Santosh Chauhan; Yongsheng Che; Michael E Cheetham; Rajkumar Cheluvappa; Chun-Jung Chen; Gang Chen; Guang-Chao Chen; Guoqiang Chen; Hongzhuan Chen; Jeff W Chen; Jian-Kang Chen; Min Chen; Mingzhou Chen; Peiwen Chen; Qi Chen; Quan Chen; Shang-Der Chen; Si Chen; Steve S-L Chen; Wei Chen; Wei-Jung Chen; Wen Qiang Chen; Wenli Chen; Xiangmei Chen; Yau-Hung Chen; Ye-Guang Chen; Yin Chen; Yingyu Chen; Yongshun Chen; Yu-Jen Chen; Yue-Qin Chen; Yujie Chen; Zhen Chen; Zhong Chen; Alan Cheng; Christopher Hk Cheng; Hua Cheng; Heesun Cheong; Sara Cherry; Jason Chesney; Chun Hei Antonio Cheung; Eric Chevet; Hsiang Cheng Chi; Sung-Gil Chi; Fulvio Chiacchiera; Hui-Ling Chiang; Roberto Chiarelli; Mario Chiariello; Marcello Chieppa; Lih-Shen Chin; Mario Chiong; Gigi Nc Chiu; Dong-Hyung Cho; Ssang-Goo Cho; William C Cho; Yong-Yeon Cho; Young-Seok Cho; Augustine Mk Choi; Eui-Ju Choi; Eun-Kyoung Choi; Jayoung Choi; Mary E Choi; Seung-Il Choi; Tsui-Fen Chou; Salem Chouaib; Divaker Choubey; Vinay Choubey; Kuan-Chih Chow; Kamal Chowdhury; Charleen T Chu; Tsung-Hsien Chuang; Taehoon Chun; Hyewon Chung; Taijoon Chung; Yuen-Li Chung; Yong-Joon Chwae; Valentina Cianfanelli; Roberto Ciarcia; Iwona A Ciechomska; Maria Rosa Ciriolo; Mara Cirone; Sofie Claerhout; Michael J Clague; Joan Clària; Peter Gh Clarke; Robert Clarke; Emilio Clementi; Cédric Cleyrat; Miriam Cnop; Eliana M Coccia; Tiziana Cocco; Patrice Codogno; Jörn Coers; Ezra Ew Cohen; David Colecchia; Luisa Coletto; Núria S Coll; Emma Colucci-Guyon; Sergio Comincini; Maria Condello; Katherine L Cook; Graham H Coombs; Cynthia D Cooper; J Mark Cooper; Isabelle Coppens; Maria Tiziana Corasaniti; Marco Corazzari; Ramon Corbalan; Elisabeth Corcelle-Termeau; Mario D Cordero; Cristina Corral-Ramos; Olga Corti; Andrea Cossarizza; Paola Costelli; Safia Costes; Susan L Cotman; Ana Coto-Montes; Sandra Cottet; Eduardo Couve; Lori R Covey; L Ashley Cowart; Jeffery S Cox; Fraser P Coxon; Carolyn B Coyne; Mark S Cragg; Rolf J Craven; Tiziana Crepaldi; Jose L Crespo; Alfredo Criollo; Valeria Crippa; Maria Teresa Cruz; Ana Maria Cuervo; Jose M Cuezva; Taixing Cui; Pedro R Cutillas; Mark J Czaja; Maria F Czyzyk-Krzeska; Ruben K Dagda; Uta Dahmen; Chunsun Dai; Wenjie Dai; Yun Dai; Kevin N Dalby; Luisa Dalla Valle; Guillaume Dalmasso; Marcello D'Amelio; Markus Damme; Arlette Darfeuille-Michaud; Catherine Dargemont; Victor M Darley-Usmar; Srinivasan Dasarathy; Biplab Dasgupta; Srikanta Dash; Crispin R Dass; Hazel Marie Davey; Lester M Davids; David Dávila; Roger J Davis; Ted M Dawson; Valina L Dawson; Paula Daza; Jackie de Belleroche; Paul de Figueiredo; Regina Celia Bressan Queiroz de Figueiredo; José de la Fuente; Luisa De Martino; Antonella De Matteis; Guido Ry De Meyer; Angelo De Milito; Mauro De Santi; Wanderley de Souza; Vincenzo De Tata; Daniela De Zio; Jayanta Debnath; Reinhard Dechant; Jean-Paul Decuypere; Shane Deegan; Benjamin Dehay; Barbara Del Bello; Dominic P Del Re; Régis Delage-Mourroux; Lea Md Delbridge; Louise Deldicque; Elizabeth Delorme-Axford; Yizhen Deng; Joern Dengjel; Melanie Denizot; Paul Dent; Channing J Der; Vojo Deretic; Benoît Derrien; Eric Deutsch; Timothy P Devarenne; Rodney J Devenish; Sabrina Di Bartolomeo; Nicola Di Daniele; Fabio Di Domenico; Alessia Di Nardo; Simone Di Paola; Antonio Di Pietro; Livia Di Renzo; Aaron DiAntonio; Guillermo Díaz-Araya; Ines Díaz-Laviada; Maria T Diaz-Meco; Javier Diaz-Nido; Chad A Dickey; Robert C Dickson; Marc Diederich; Paul Digard; Ivan Dikic; Savithrama P Dinesh-Kumar; Chan Ding; Wen-Xing Ding; Zufeng Ding; Luciana Dini; Jörg Hw Distler; Abhinav Diwan; Mojgan Djavaheri-Mergny; Kostyantyn Dmytruk; Renwick Cj Dobson; Volker Doetsch; Karol Dokladny; Svetlana Dokudovskaya; Massimo Donadelli; X Charlie Dong; Xiaonan Dong; Zheng Dong; Terrence M Donohue; Kelly S Doran; Gabriella D'Orazi; Gerald W Dorn; Victor Dosenko; Sami Dridi; Liat Drucker; Jie Du; Li-Lin Du; Lihuan Du; André du Toit; Priyamvada Dua; Lei Duan; Pu Duann; Vikash Kumar Dubey; Michael R Duchen; Michel A Duchosal; Helene Duez; Isabelle Dugail; Verónica I Dumit; Mara C Duncan; Elaine A Dunlop; William A Dunn; Nicolas Dupont; Luc Dupuis; Raúl V Durán; Thomas M Durcan; Stéphane Duvezin-Caubet; Umamaheswar Duvvuri; Vinay Eapen; Darius Ebrahimi-Fakhari; Arnaud Echard; Leopold Eckhart; Charles L Edelstein; Aimee L Edinger; Ludwig Eichinger; Tobias Eisenberg; Avital Eisenberg-Lerner; N Tony Eissa; Wafik S El-Deiry; Victoria El-Khoury; Zvulun Elazar; Hagit Eldar-Finkelman; Chris Jh Elliott; Enzo Emanuele; Urban Emmenegger; Nikolai Engedal; Anna-Mart Engelbrecht; Simone Engelender; Jorrit M Enserink; Ralf Erdmann; Jekaterina Erenpreisa; Rajaraman Eri; Jason L Eriksen; Andreja Erman; Ricardo Escalante; Eeva-Liisa Eskelinen; Lucile Espert; Lorena Esteban-Martínez; Thomas J Evans; Mario Fabri; Gemma Fabrias; Cinzia Fabrizi; Antonio Facchiano; Nils J Færgeman; Alberto Faggioni; W Douglas Fairlie; Chunhai Fan; Daping Fan; Jie Fan; Shengyun Fang; Manolis Fanto; Alessandro Fanzani; Thomas Farkas; Mathias Faure; Francois B Favier; Howard Fearnhead; Massimo Federici; Erkang Fei; Tania C Felizardo; Hua Feng; Yibin Feng; Yuchen Feng; Thomas A Ferguson; Álvaro F Fernández; Maite G Fernandez-Barrena; Jose C Fernandez-Checa; Arsenio Fernández-López; Martin E Fernandez-Zapico; Olivier Feron; Elisabetta Ferraro; Carmen Veríssima Ferreira-Halder; Laszlo Fesus; Ralph Feuer; Fabienne C Fiesel; Eduardo C Filippi-Chiela; Giuseppe Filomeni; Gian Maria Fimia; John H Fingert; Steven Finkbeiner; Toren Finkel; Filomena Fiorito; Paul B Fisher; Marc Flajolet; Flavio Flamigni; Oliver Florey; Salvatore Florio; R Andres Floto; Marco Folini; Carlo Follo; Edward A Fon; Francesco Fornai; Franco Fortunato; Alessandro Fraldi; Rodrigo Franco; Arnaud Francois; Aurélie François; Lisa B Frankel; Iain Dc Fraser; Norbert Frey; Damien G Freyssenet; Christian Frezza; Scott L Friedman; Daniel E Frigo; Dongxu Fu; José M Fuentes; Juan Fueyo; Yoshio Fujitani; Yuuki Fujiwara; Mikihiro Fujiya; Mitsunori Fukuda; Simone Fulda; Carmela Fusco; Bozena Gabryel; Matthias Gaestel; Philippe Gailly; Malgorzata Gajewska; Sehamuddin Galadari; Gad Galili; Inmaculada Galindo; Maria F Galindo; Giovanna Galliciotti; Lorenzo Galluzzi; Luca Galluzzi; Vincent Galy; Noor Gammoh; Sam Gandy; Anand K Ganesan; Swamynathan Ganesan; Ian G Ganley; Monique Gannagé; Fen-Biao Gao; Feng Gao; Jian-Xin Gao; Lorena García Nannig; Eleonora García Véscovi; Marina Garcia-Macía; Carmen Garcia-Ruiz; Abhishek D Garg; Pramod Kumar Garg; Ricardo Gargini; Nils Christian Gassen; Damián Gatica; Evelina Gatti; Julie Gavard; Evripidis Gavathiotis; Liang Ge; Pengfei Ge; Shengfang Ge; Po-Wu Gean; Vania Gelmetti; Armando A Genazzani; Jiefei Geng; Pascal Genschik; Lisa Gerner; Jason E Gestwicki; David A Gewirtz; Saeid Ghavami; Eric Ghigo; Debabrata Ghosh; Anna Maria Giammarioli; Francesca Giampieri; Claudia Giampietri; Alexandra Giatromanolaki; Derrick J Gibbings; Lara Gibellini; Spencer B Gibson; Vanessa Ginet; Antonio Giordano; Flaviano Giorgini; Elisa Giovannetti; Stephen E Girardin; Suzana Gispert; Sandy Giuliano; Candece L Gladson; Alvaro Glavic; Martin Gleave; Nelly Godefroy; Robert M Gogal; Kuppan Gokulan; Gustavo H Goldman; Delia Goletti; Michael S Goligorsky; Aldrin V Gomes; Ligia C Gomes; Hernando Gomez; Candelaria Gomez-Manzano; Rubén Gómez-Sánchez; Dawit Ap Gonçalves; Ebru Goncu; Qingqiu Gong; Céline Gongora; Carlos B Gonzalez; Pedro Gonzalez-Alegre; Pilar Gonzalez-Cabo; Rosa Ana González-Polo; Ing Swie Goping; Carlos Gorbea; Nikolai V Gorbunov; Daphne R Goring; Adrienne M Gorman; Sharon M Gorski; Sandro Goruppi; Shino Goto-Yamada; Cecilia Gotor; Roberta A Gottlieb; Illana Gozes; Devrim Gozuacik; Yacine Graba; Martin Graef; Giovanna E Granato; Gary Dean Grant; Steven Grant; Giovanni Luca Gravina; Douglas R Green; Alexander Greenhough; Michael T Greenwood; Benedetto Grimaldi; Frédéric Gros; Charles Grose; Jean-Francois Groulx; Florian Gruber; Paolo Grumati; Tilman Grune; Jun-Lin Guan; Kun-Liang Guan; Barbara Guerra; Carlos Guillen; Kailash Gulshan; Jan Gunst; Chuanyong Guo; Lei Guo; Ming Guo; Wenjie Guo; Xu-Guang Guo; Andrea A Gust; Åsa B Gustafsson; Elaine Gutierrez; Maximiliano G Gutierrez; Ho-Shin Gwak; Albert Haas; James E Haber; Shinji Hadano; Monica Hagedorn; David R Hahn; Andrew J Halayko; Anne Hamacher-Brady; Kozo Hamada; Ahmed Hamai; Andrea Hamann; Maho Hamasaki; Isabelle Hamer; Qutayba Hamid; Ester M Hammond; Feng Han; Weidong Han; James T Handa; John A Hanover; Malene Hansen; Masaru Harada; Ljubica Harhaji-Trajkovic; J Wade Harper; Abdel Halim Harrath; Adrian L Harris; James Harris; Udo Hasler; Peter Hasselblatt; Kazuhisa Hasui; Robert G Hawley; Teresa S Hawley; Congcong He; Cynthia Y He; Fengtian He; Gu He; Rong-Rong He; Xian-Hui He; You-Wen He; Yu-Ying He; Joan K Heath; Marie-Josée Hébert; Robert A Heinzen; Gudmundur Vignir Helgason; Michael Hensel; Elizabeth P Henske; Chengtao Her; Paul K Herman; Agustín Hernández; Carlos Hernandez; Sonia Hernández-Tiedra; Claudio Hetz; P Robin Hiesinger; Katsumi Higaki; Sabine Hilfiker; Bradford G Hill; Joseph A Hill; William D Hill; Keisuke Hino; Daniel Hofius; Paul Hofman; Günter U Höglinger; Jörg Höhfeld; Marina K Holz; Yonggeun Hong; David A Hood; Jeroen Jm Hoozemans; Thorsten Hoppe; Chin Hsu; Chin-Yuan Hsu; Li-Chung Hsu; Dong Hu; Guochang Hu; Hong-Ming Hu; Hongbo Hu; Ming Chang Hu; Yu-Chen Hu; Zhuo-Wei Hu; Fang Hua; Ya Hua; Canhua Huang; Huey-Lan Huang; Kuo-How Huang; Kuo-Yang Huang; Shile Huang; Shiqian Huang; Wei-Pang Huang; Yi-Ran Huang; Yong Huang; Yunfei Huang; Tobias B Huber; Patricia Huebbe; Won-Ki Huh; Juha J Hulmi; Gang Min Hur; James H Hurley; Zvenyslava Husak; Sabah Na Hussain; Salik Hussain; Jung Jin Hwang; Seungmin Hwang; Thomas Is Hwang; Atsuhiro Ichihara; Yuzuru Imai; Carol Imbriano; Megumi Inomata; Takeshi Into; Valentina Iovane; Juan L Iovanna; Renato V Iozzo; Nancy Y Ip; Javier E Irazoqui; Pablo Iribarren; Yoshitaka Isaka; Aleksandra J Isakovic; Harry Ischiropoulos; Jeffrey S Isenberg; Mohammad Ishaq; Hiroyuki Ishida; Isao Ishii; Jane E Ishmael; Ciro Isidoro; Ken-Ichi Isobe; Erika Isono; Shohreh Issazadeh-Navikas; Koji Itahana; Eisuke Itakura; Andrei I Ivanov; Anand Krishnan V Iyer; José M Izquierdo; Yotaro Izumi; Valentina Izzo; Marja Jäättelä; Nadia Jaber; Daniel John Jackson; William T Jackson; Tony George Jacob; Thomas S Jacques; Chinnaswamy Jagannath; Ashish Jain; Nihar Ranjan Jana; Byoung Kuk Jang; Alkesh Jani; Bassam Janji; Paulo Roberto Jannig; Patric J Jansson; Steve Jean; Marina Jendrach; Ju-Hong Jeon; Niels Jessen; Eui-Bae Jeung; Kailiang Jia; Lijun Jia; Hong Jiang; Hongchi Jiang; Liwen Jiang; Teng Jiang; Xiaoyan Jiang; Xuejun Jiang; Xuejun Jiang; Ying Jiang; Yongjun Jiang; Alberto Jiménez; Cheng Jin; Hongchuan Jin; Lei Jin; Meiyan Jin; Shengkan Jin; Umesh Kumar Jinwal; Eun-Kyeong Jo; Terje Johansen; Daniel E Johnson; Gail Vw Johnson; James D Johnson; Eric Jonasch; Chris Jones; Leo Ab Joosten; Joaquin Jordan; Anna-Maria Joseph; Bertrand Joseph; Annie M Joubert; Dianwen Ju; Jingfang Ju; Hsueh-Fen Juan; Katrin Juenemann; Gábor Juhász; Hye Seung Jung; Jae U Jung; Yong-Keun Jung; Heinz Jungbluth; Matthew J Justice; Barry Jutten; Nadeem O Kaakoush; Kai Kaarniranta; Allen Kaasik; Tomohiro Kabuta; Bertrand Kaeffer; Katarina Kågedal; Alon Kahana; Shingo Kajimura; Or Kakhlon; Manjula Kalia; Dhan V Kalvakolanu; Yoshiaki Kamada; Konstantinos Kambas; Vitaliy O Kaminskyy; Harm H Kampinga; Mustapha Kandouz; Chanhee Kang; Rui Kang; Tae-Cheon Kang; Tomotake Kanki; Thirumala-Devi Kanneganti; Haruo Kanno; Anumantha G Kanthasamy; Marc Kantorow; Maria Kaparakis-Liaskos; Orsolya Kapuy; Vassiliki Karantza; Md Razaul Karim; Parimal Karmakar; Arthur Kaser; Susmita Kaushik; Thomas Kawula; A Murat Kaynar; Po-Yuan Ke; Zun-Ji Ke; John H Kehrl; Kate E Keller; Jongsook Kim Kemper; Anne K Kenworthy; Oliver Kepp; Andreas Kern; Santosh Kesari; David Kessel; Robin Ketteler; Isis do Carmo Kettelhut; Bilon Khambu; Muzamil Majid Khan; Vinoth Km Khandelwal; Sangeeta Khare; Juliann G Kiang; Amy A Kiger; Akio Kihara; Arianna L Kim; Cheol Hyeon Kim; Deok Ryong Kim; Do-Hyung Kim; Eung Kweon Kim; Hye Young Kim; Hyung-Ryong Kim; Jae-Sung Kim; Jeong Hun Kim; Jin Cheon Kim; Jin Hyoung Kim; Kwang Woon Kim; Michael D Kim; Moon-Moo Kim; Peter K Kim; Seong Who Kim; Soo-Youl Kim; Yong-Sun Kim; Yonghyun Kim; Adi Kimchi; Alec C Kimmelman; Tomonori Kimura; Jason S King; Karla Kirkegaard; Vladimir Kirkin; Lorrie A Kirshenbaum; Shuji Kishi; Yasuo Kitajima; Katsuhiko Kitamoto; Yasushi Kitaoka; Kaio Kitazato; Rudolf A Kley; Walter T Klimecki; Michael Klinkenberg; Jochen Klucken; Helene Knævelsrud; Erwin Knecht; Laura Knuppertz; Jiunn-Liang Ko; Satoru Kobayashi; Jan C Koch; Christelle Koechlin-Ramonatxo; Ulrich Koenig; Young Ho Koh; Katja Köhler; Sepp D Kohlwein; Masato Koike; Masaaki Komatsu; Eiki Kominami; Dexin Kong; Hee Jeong Kong; Eumorphia G Konstantakou; Benjamin T Kopp; Tamas Korcsmaros; Laura Korhonen; Viktor I Korolchuk; Nadya V Koshkina; Yanjun Kou; Michael I Koukourakis; Constantinos Koumenis; Attila L Kovács; Tibor Kovács; Werner J Kovacs; Daisuke Koya; Claudine Kraft; Dimitri Krainc; Helmut Kramer; Tamara Kravic-Stevovic; Wilhelm Krek; Carole Kretz-Remy; Roswitha Krick; Malathi Krishnamurthy; Janos Kriston-Vizi; Guido Kroemer; Michael C Kruer; Rejko Kruger; Nicholas T Ktistakis; Kazuyuki Kuchitsu; Christian Kuhn; Addanki Pratap Kumar; Anuj Kumar; Ashok Kumar; Deepak Kumar; Dhiraj Kumar; Rakesh Kumar; Sharad Kumar; Mondira Kundu; Hsing-Jien Kung; Atsushi Kuno; Sheng-Han Kuo; Jeff Kuret; Tino Kurz; Terry Kwok; Taeg Kyu Kwon; Yong Tae Kwon; Irene Kyrmizi; Albert R La Spada; Frank Lafont; Tim Lahm; Aparna Lakkaraju; Truong Lam; Trond Lamark; Steve Lancel; Terry H Landowski; Darius J R Lane; Jon D Lane; Cinzia Lanzi; Pierre Lapaquette; Louis R Lapierre; Jocelyn Laporte; Johanna Laukkarinen; Gordon W Laurie; Sergio Lavandero; Lena Lavie; Matthew J LaVoie; Betty Yuen Kwan Law; Helen Ka-Wai Law; Kelsey B Law; Robert Layfield; Pedro A Lazo; Laurent Le Cam; Karine G Le Roch; Hervé Le Stunff; Vijittra Leardkamolkarn; Marc Lecuit; Byung-Hoon Lee; Che-Hsin Lee; Erinna F Lee; Gyun Min Lee; He-Jin Lee; Hsinyu Lee; Jae Keun Lee; Jongdae Lee; Ju-Hyun Lee; Jun Hee Lee; Michael Lee; Myung-Shik Lee; Patty J Lee; Sam W Lee; Seung-Jae Lee; Shiow-Ju Lee; Stella Y Lee; Sug Hyung Lee; Sung Sik Lee; Sung-Joon Lee; Sunhee Lee; Ying-Ray Lee; Yong J Lee; Young H Lee; Christiaan Leeuwenburgh; Sylvain Lefort; Renaud Legouis; Jinzhi Lei; Qun-Ying Lei; David A Leib; Gil Leibowitz; Istvan Lekli; Stéphane D Lemaire; John J Lemasters; Marius K Lemberg; Antoinette Lemoine; Shuilong Leng; Guido Lenz; Paola Lenzi; Lilach O Lerman; Daniele Lettieri Barbato; Julia I-Ju Leu; Hing Y Leung; Beth Levine; Patrick A Lewis; Frank Lezoualc'h; Chi Li; Faqiang Li; Feng-Jun Li; Jun Li; Ke Li; Lian Li; Min Li; Min Li; Qiang Li; Rui Li; Sheng Li; Wei Li; Wei Li; Xiaotao Li; Yumin Li; Jiqin Lian; Chengyu Liang; Qiangrong Liang; Yulin Liao; Joana Liberal; Pawel P Liberski; Pearl Lie; Andrew P Lieberman; Hyunjung Jade Lim; Kah-Leong Lim; Kyu Lim; Raquel T Lima; Chang-Shen Lin; Chiou-Feng Lin; Fang Lin; Fangming Lin; Fu-Cheng Lin; Kui Lin; Kwang-Huei Lin; Pei-Hui Lin; Tianwei Lin; Wan-Wan Lin; Yee-Shin Lin; Yong Lin; Rafael Linden; Dan Lindholm; Lisa M Lindqvist; Paul Lingor; Andreas Linkermann; Lance A Liotta; Marta M Lipinski; Vitor A Lira; Michael P Lisanti; Paloma B Liton; Bo Liu; Chong Liu; Chun-Feng Liu; Fei Liu; Hung-Jen Liu; Jianxun Liu; Jing-Jing Liu; Jing-Lan Liu; Ke Liu; Leyuan Liu; Liang Liu; Quentin Liu; Rong-Yu Liu; Shiming Liu; Shuwen Liu; Wei Liu; Xian-De Liu; Xiangguo Liu; Xiao-Hong Liu; Xinfeng Liu; Xu Liu; Xueqin Liu; Yang Liu; Yule Liu; Zexian Liu; Zhe Liu; Juan P Liuzzi; Gérard Lizard; Mila Ljujic; Irfan J Lodhi; Susan E Logue; Bal L Lokeshwar; Yun Chau Long; Sagar Lonial; Benjamin Loos; Carlos López-Otín; Cristina López-Vicario; Mar Lorente; Philip L Lorenzi; Péter Lõrincz; Marek Los; Michael T Lotze; Penny E Lovat; Binfeng Lu; Bo Lu; Jiahong Lu; Qing Lu; She-Min Lu; Shuyan Lu; Yingying Lu; Frédéric Luciano; Shirley Luckhart; John Milton Lucocq; Paula Ludovico; Aurelia Lugea; Nicholas W Lukacs; Julian J Lum; Anders H Lund; Honglin Luo; Jia Luo; Shouqing Luo; Claudio Luparello; Timothy Lyons; Jianjie Ma; Yi Ma; Yong Ma; Zhenyi Ma; Juliano Machado; Glaucia M Machado-Santelli; Fernando Macian; Gustavo C MacIntosh; Jeffrey P MacKeigan; Kay F Macleod; John D MacMicking; Lee Ann MacMillan-Crow; Frank Madeo; Muniswamy Madesh; Julio Madrigal-Matute; Akiko Maeda; Tatsuya Maeda; Gustavo Maegawa; Emilia Maellaro; Hannelore Maes; Marta Magariños; Kenneth Maiese; Tapas K Maiti; Luigi Maiuri; Maria Chiara Maiuri; Carl G Maki; Roland Malli; Walter Malorni; Alina Maloyan; Fathia Mami-Chouaib; Na Man; Joseph D Mancias; Eva-Maria Mandelkow; Michael A Mandell; Angelo A Manfredi; Serge N Manié; Claudia Manzoni; Kai Mao; Zixu Mao; Zong-Wan Mao; Philippe Marambaud; Anna Maria Marconi; Zvonimir Marelja; Gabriella Marfe; Marta Margeta; Eva Margittai; Muriel Mari; Francesca V Mariani; Concepcio Marin; Sara Marinelli; Guillermo Mariño; Ivanka Markovic; Rebecca Marquez; Alberto M Martelli; Sascha Martens; Katie R Martin; Seamus J Martin; Shaun Martin; Miguel A Martin-Acebes; Paloma Martín-Sanz; Camille Martinand-Mari; Wim Martinet; Jennifer Martinez; Nuria Martinez-Lopez; Ubaldo Martinez-Outschoorn; Moisés Martínez-Velázquez; Marta Martinez-Vicente; Waleska Kerllen Martins; Hirosato Mashima; James A Mastrianni; Giuseppe Matarese; Paola Matarrese; Roberto Mateo; Satoaki Matoba; Naomichi Matsumoto; Takehiko Matsushita; Akira Matsuura; Takeshi Matsuzawa; Mark P Mattson; Soledad Matus; Norma Maugeri; Caroline Mauvezin; Andreas Mayer; Dusica Maysinger; Guillermo D Mazzolini; Mary Kate McBrayer; Kimberly McCall; Craig McCormick; Gerald M McInerney; Skye C McIver; Sharon McKenna; John J McMahon; Iain A McNeish; Fatima Mechta-Grigoriou; Jan Paul Medema; Diego L Medina; Klara Megyeri; Maryam Mehrpour; Jawahar L Mehta; Yide Mei; Ute-Christiane Meier; Alfred J Meijer; Alicia Meléndez; Gerry Melino; Sonia Melino; Edesio Jose Tenorio de Melo; Maria A Mena; Marc D Meneghini; Javier A Menendez; Regina Menezes; Liesu Meng; Ling-Hua Meng; Songshu Meng; Rossella Menghini; A Sue Menko; Rubem Fs Menna-Barreto; Manoj B Menon; Marco A Meraz-Ríos; Giuseppe Merla; Luciano Merlini; Angelica M Merlot; Andreas Meryk; Stefania Meschini; Joel N Meyer; Man-Tian Mi; Chao-Yu Miao; Lucia Micale; Simon Michaeli; Carine Michiels; Anna Rita Migliaccio; Anastasia Susie Mihailidou; Dalibor Mijaljica; Katsuhiko Mikoshiba; Enrico Milan; Leonor Miller-Fleming; Gordon B Mills; Ian G Mills; Georgia Minakaki; Berge A Minassian; Xiu-Fen Ming; Farida Minibayeva; Elena A Minina; Justine D Mintern; Saverio Minucci; Antonio Miranda-Vizuete; Claire H Mitchell; Shigeki Miyamoto; Keisuke Miyazawa; Noboru Mizushima; Katarzyna Mnich; Baharia Mograbi; Simin Mohseni; Luis Ferreira Moita; Marco Molinari; Maurizio Molinari; Andreas Buch Møller; Bertrand Mollereau; Faustino Mollinedo; Marco Mongillo; Martha M Monick; Serena Montagnaro; Craig Montell; Darren J Moore; Michael N Moore; Rodrigo Mora-Rodriguez; Paula I Moreira; Etienne Morel; Maria Beatrice Morelli; Sandra Moreno; Michael J Morgan; Arnaud Moris; Yuji Moriyasu; Janna L Morrison; Lynda A Morrison; Eugenia Morselli; Jorge Moscat; Pope L Moseley; Serge Mostowy; Elisa Motori; Denis Mottet; Jeremy C Mottram; Charbel E-H Moussa; Vassiliki E Mpakou; Hasan Mukhtar; Jean M Mulcahy Levy; Sylviane Muller; Raquel Muñoz-Moreno; Cristina Muñoz-Pinedo; Christian Münz; Maureen E Murphy; James T Murray; Aditya Murthy; Indira U Mysorekar; Ivan R Nabi; Massimo Nabissi; Gustavo A Nader; Yukitoshi Nagahara; Yoshitaka Nagai; Kazuhiro Nagata; Anika Nagelkerke; Péter Nagy; Samisubbu R Naidu; Sreejayan Nair; Hiroyasu Nakano; Hitoshi Nakatogawa; Meera Nanjundan; Gennaro Napolitano; Naweed I Naqvi; Roberta Nardacci; Derek P Narendra; Masashi Narita; Anna Chiara Nascimbeni; Ramesh Natarajan; Luiz C Navegantes; Steffan T Nawrocki; Taras Y Nazarko; Volodymyr Y Nazarko; Thomas Neill; Luca M Neri; Mihai G Netea; Romana T Netea-Maier; Bruno M Neves; Paul A Ney; Ioannis P Nezis; Hang Tt Nguyen; Huu Phuc Nguyen; Anne-Sophie Nicot; Hilde Nilsen; Per Nilsson; Mikio Nishimura; Ichizo Nishino; Mireia Niso-Santano; Hua Niu; Ralph A Nixon; Vincent Co Njar; Takeshi Noda; Angelika A Noegel; Elsie Magdalena Nolte; Erik Norberg; Koenraad K Norga; Sakineh Kazemi Noureini; Shoji Notomi; Lucia Notterpek; Karin Nowikovsky; Nobuyuki Nukina; Thorsten Nürnberger; Valerie B O'Donnell; Tracey O'Donovan; Peter J O'Dwyer; Ina Oehme; Clara L Oeste; Michinaga Ogawa; Besim Ogretmen; Yuji Ogura; Young J Oh; Masaki Ohmuraya; Takayuki Ohshima; Rani Ojha; Koji Okamoto; Toshiro Okazaki; F Javier Oliver; Karin Ollinger; Stefan Olsson; Daniel P Orban; Paulina Ordonez; Idil Orhon; Laszlo Orosz; Eyleen J O'Rourke; Helena Orozco; Angel L Ortega; Elena Ortona; Laura D Osellame; Junko Oshima; Shigeru Oshima; Heinz D Osiewacz; Takanobu Otomo; Kinya Otsu; Jing-Hsiung James Ou; Tiago F Outeiro; Dong-Yun Ouyang; Hongjiao Ouyang; Michael Overholtzer; Michelle A Ozbun; P Hande Ozdinler; Bulent Ozpolat; Consiglia Pacelli; Paolo Paganetti; Guylène Page; Gilles Pages; Ugo Pagnini; Beata Pajak; Stephen C Pak; Karolina Pakos-Zebrucka; Nazzy Pakpour; Zdena Palková; Francesca Palladino; Kathrin Pallauf; Nicolas Pallet; Marta Palmieri; Søren R Paludan; Camilla Palumbo; Silvia Palumbo; Olatz Pampliega; Hongming Pan; Wei Pan; Theocharis Panaretakis; Aseem Pandey; Areti Pantazopoulou; Zuzana Papackova; Daniela L Papademetrio; Issidora Papassideri; Alessio Papini; Nirmala Parajuli; Julian Pardo; Vrajesh V Parekh; Giancarlo Parenti; Jong-In Park; Junsoo Park; Ohkmae K Park; Roy Parker; Rosanna Parlato; Jan B Parys; Katherine R Parzych; Jean-Max Pasquet; Benoit Pasquier; Kishore Bs Pasumarthi; Daniel Patschan; Cam Patterson; Sophie Pattingre; Scott Pattison; Arnim Pause; Hermann Pavenstädt; Flaminia Pavone; Zully Pedrozo; Fernando J Peña; Miguel A Peñalva; Mario Pende; Jianxin Peng; Fabio Penna; Josef M Penninger; Anna Pensalfini; Salvatore Pepe; Gustavo Js Pereira; Paulo C Pereira; Verónica Pérez-de la Cruz; María Esther Pérez-Pérez; Diego Pérez-Rodríguez; Dolores Pérez-Sala; Celine Perier; Andras Perl; David H Perlmutter; Ida Perrotta; Shazib Pervaiz; Maija Pesonen; Jeffrey E Pessin; Godefridus J Peters; Morten Petersen; Irina Petrache; Basil J Petrof; Goran Petrovski; James M Phang; Mauro Piacentini; Marina Pierdominici; Philippe Pierre; Valérie Pierrefite-Carle; Federico Pietrocola; Felipe X Pimentel-Muiños; Mario Pinar; Benjamin Pineda; Ronit Pinkas-Kramarski; Marcello Pinti; Paolo Pinton; Bilal Piperdi; James M Piret; Leonidas C Platanias; Harald W Platta; Edward D Plowey; Stefanie Pöggeler; Marc Poirot; Peter Polčic; Angelo Poletti; Audrey H Poon; Hana Popelka; Blagovesta Popova; Izabela Poprawa; Shibu M Poulose; Joanna Poulton; Scott K Powers; Ted Powers; Mercedes Pozuelo-Rubio; Krisna Prak; Reinhild Prange; Mark Prescott; Muriel Priault; Sharon Prince; Richard L Proia; Tassula Proikas-Cezanne; Holger Prokisch; Vasilis J Promponas; Karin Przyklenk; Rosa Puertollano; Subbiah Pugazhenthi; Luigi Puglielli; Aurora Pujol; Julien Puyal; Dohun Pyeon; Xin Qi; Wen-Bin Qian; Zheng-Hong Qin; Yu Qiu; Ziwei Qu; Joe Quadrilatero; Frederick Quinn; Nina Raben; Hannah Rabinowich; Flavia Radogna; Michael J Ragusa; Mohamed Rahmani; Komal Raina; Sasanka Ramanadham; Rajagopal Ramesh; Abdelhaq Rami; Sarron Randall-Demllo; Felix Randow; Hai Rao; V Ashutosh Rao; Blake B Rasmussen; Tobias M Rasse; Edward A Ratovitski; Pierre-Emmanuel Rautou; Swapan K Ray; Babak Razani; Bruce H Reed; Fulvio Reggiori; Markus Rehm; Andreas S Reichert; Theo Rein; David J Reiner; Eric Reits; Jun Ren; Xingcong Ren; Maurizio Renna; Jane Eb Reusch; Jose L Revuelta; Leticia Reyes; Alireza R Rezaie; Robert I Richards; Des R Richardson; Clémence Richetta; Michael A Riehle; Bertrand H Rihn; Yasuko Rikihisa; Brigit E Riley; Gerald Rimbach; Maria Rita Rippo; Konstantinos Ritis; Federica Rizzi; Elizete Rizzo; Peter J Roach; Jeffrey Robbins; Michel Roberge; Gabriela Roca; Maria Carmela Roccheri; Sonia Rocha; Cecilia Mp Rodrigues; Clara I Rodríguez; Santiago Rodriguez de Cordoba; Natalia Rodriguez-Muela; Jeroen Roelofs; Vladimir V Rogov; Troy T Rohn; Bärbel Rohrer; Davide Romanelli; Luigina Romani; Patricia Silvia Romano; M Isabel G Roncero; Jose Luis Rosa; Alicia Rosello; Kirill V Rosen; Philip Rosenstiel; Magdalena Rost-Roszkowska; Kevin A Roth; Gael Roué; Mustapha Rouis; Kasper M Rouschop; Daniel T Ruan; Diego Ruano; David C Rubinsztein; Edmund B Rucker; Assaf Rudich; Emil Rudolf; Ruediger Rudolf; Markus A Ruegg; Carmen Ruiz-Roldan; Avnika Ashok Ruparelia; Paola Rusmini; David W Russ; Gian Luigi Russo; Giuseppe Russo; Rossella Russo; Tor Erik Rusten; Victoria Ryabovol; Kevin M Ryan; Stefan W Ryter; David M Sabatini; Michael Sacher; Carsten Sachse; Michael N Sack; Junichi Sadoshima; Paul Saftig; Ronit Sagi-Eisenberg; Sumit Sahni; Pothana Saikumar; Tsunenori Saito; Tatsuya Saitoh; Koichi Sakakura; Machiko Sakoh-Nakatogawa; Yasuhito Sakuraba; María Salazar-Roa; Paolo Salomoni; Ashok K Saluja; Paul M Salvaterra; Rosa Salvioli; Afshin Samali; Anthony Mj Sanchez; José A Sánchez-Alcázar; Ricardo Sanchez-Prieto; Marco Sandri; Miguel A Sanjuan; Stefano Santaguida; Laura Santambrogio; Giorgio Santoni; Claudia Nunes Dos Santos; Shweta Saran; Marco Sardiello; Graeme Sargent; Pallabi Sarkar; Sovan Sarkar; Maria Rosa Sarrias; Minnie M Sarwal; Chihiro Sasakawa; Motoko Sasaki; Miklos Sass; Ken Sato; Miyuki Sato; Joseph Satriano; Niramol Savaraj; Svetlana Saveljeva; Liliana Schaefer; Ulrich E Schaible; Michael Scharl; Hermann M Schatzl; Randy Schekman; Wiep Scheper; Alfonso Schiavi; Hyman M Schipper; Hana Schmeisser; Jens Schmidt; Ingo Schmitz; Bianca E Schneider; E Marion Schneider; Jaime L Schneider; Eric A Schon; Miriam J Schönenberger; Axel H Schönthal; Daniel F Schorderet; Bernd Schröder; Sebastian Schuck; Ryan J Schulze; Melanie Schwarten; Thomas L Schwarz; Sebastiano Sciarretta; Kathleen Scotto; A Ivana Scovassi; Robert A Screaton; Mark Screen; Hugo Seca; Simon Sedej; Laura Segatori; Nava Segev; Per O Seglen; Jose M Seguí-Simarro; Juan Segura-Aguilar; Ekihiro Seki; Christian Sell; Iban Seiliez; Clay F Semenkovich; Gregg L Semenza; Utpal Sen; Andreas L Serra; Ana Serrano-Puebla; Hiromi Sesaki; Takao Setoguchi; Carmine Settembre; John J Shacka; Ayesha N Shajahan-Haq; Irving M Shapiro; Shweta Sharma; Hua She; C-K James Shen; Chiung-Chyi Shen; Han-Ming Shen; Sanbing Shen; Weili Shen; Rui Sheng; Xianyong Sheng; Zu-Hang Sheng; Trevor G Shepherd; Junyan Shi; Qiang Shi; Qinghua Shi; Yuguang Shi; Shusaku Shibutani; Kenichi Shibuya; Yoshihiro Shidoji; Jeng-Jer Shieh; Chwen-Ming Shih; Yohta Shimada; Shigeomi Shimizu; Dong Wook Shin; Mari L Shinohara; Michiko Shintani; Takahiro Shintani; Tetsuo Shioi; Ken Shirabe; Ronit Shiri-Sverdlov; Orian Shirihai; Gordon C Shore; Chih-Wen Shu; Deepak Shukla; Andriy A Sibirny; Valentina Sica; Christina J Sigurdson; Einar M Sigurdsson; Puran Singh Sijwali; Beata Sikorska; Wilian A Silveira; Sandrine Silvente-Poirot; Gary A Silverman; Jan Simak; Thomas Simmet; Anna Katharina Simon; Hans-Uwe Simon; Cristiano Simone; Matias Simons; Anne Simonsen; Rajat Singh; Shivendra V Singh; Shrawan K Singh; Debasish Sinha; Sangita Sinha; Frank A Sinicrope; Agnieszka Sirko; Kapil Sirohi; Balindiwe Jn Sishi; Annie Sittler; Parco M Siu; Efthimios Sivridis; Anna Skwarska; Ruth Slack; Iva Slaninová; Nikolai Slavov; Soraya S Smaili; Keiran Sm Smalley; Duncan R Smith; Stefaan J Soenen; Scott A Soleimanpour; Anita Solhaug; Kumaravel Somasundaram; Jin H Son; Avinash Sonawane; Chunjuan Song; Fuyong Song; Hyun Kyu Song; Ju-Xian Song; Wei Song; Kai Y Soo; Anil K Sood; Tuck Wah Soong; Virawudh Soontornniyomkij; Maurizio Sorice; Federica Sotgia; David R Soto-Pantoja; Areechun Sotthibundhu; Maria João Sousa; Herman P Spaink; Paul N Span; Anne Spang; Janet D Sparks; Peter G Speck; Stephen A Spector; Claudia D Spies; Wolfdieter Springer; Daret St Clair; Alessandra Stacchiotti; Bart Staels; Michael T Stang; Daniel T Starczynowski; Petro Starokadomskyy; Clemens Steegborn; John W Steele; Leonidas Stefanis; Joan Steffan; Christine M Stellrecht; Harald Stenmark; Tomasz M Stepkowski; Stęphan T Stern; Craig Stevens; Brent R Stockwell; Veronika Stoka; Zuzana Storchova; Björn Stork; Vassilis Stratoulias; Dimitrios J Stravopodis; Pavel Strnad; Anne Marie Strohecker; Anna-Lena Ström; Per Stromhaug; Jiri Stulik; Yu-Xiong Su; Zhaoliang Su; Carlos S Subauste; Srinivasa Subramaniam; Carolyn M Sue; Sang Won Suh; Xinbing Sui; Supawadee Sukseree; David Sulzer; Fang-Lin Sun; Jiaren Sun; Jun Sun; Shi-Yong Sun; Yang Sun; Yi Sun; Yingjie Sun; Vinod Sundaramoorthy; Joseph Sung; Hidekazu Suzuki; Kuninori Suzuki; Naoki Suzuki; Tadashi Suzuki; Yuichiro J Suzuki; Michele S Swanson; Charles Swanton; Karl Swärd; Ghanshyam Swarup; Sean T Sweeney; Paul W Sylvester; Zsuzsanna Szatmari; Eva Szegezdi; Peter W Szlosarek; Heinrich Taegtmeyer; Marco Tafani; Emmanuel Taillebourg; Stephen Wg Tait; Krisztina Takacs-Vellai; Yoshinori Takahashi; Szabolcs Takáts; Genzou Takemura; Nagio Takigawa; Nicholas J Talbot; Elena Tamagno; Jerome Tamburini; Cai-Ping Tan; Lan Tan; Mei Lan Tan; Ming Tan; Yee-Joo Tan; Keiji Tanaka; Masaki Tanaka; Daolin Tang; Dingzhong Tang; Guomei Tang; Isei Tanida; Kunikazu Tanji; Bakhos A Tannous; Jose A Tapia; Inmaculada Tasset-Cuevas; Marc Tatar; Iman Tavassoly; Nektarios Tavernarakis; Allen Taylor; Graham S Taylor; Gregory A Taylor; J Paul Taylor; Mark J Taylor; Elena V Tchetina; Andrew R Tee; Fatima Teixeira-Clerc; Sucheta Telang; Tewin Tencomnao; Ba-Bie Teng; Ru-Jeng Teng; Faraj Terro; Gianluca Tettamanti; Arianne L Theiss; Anne E Theron; Kelly Jean Thomas; Marcos P Thomé; Paul G Thomes; Andrew Thorburn; Jeremy Thorner; Thomas Thum; Michael Thumm; Teresa Lm Thurston; Ling Tian; Andreas Till; Jenny Pan-Yun Ting; Vladimir I Titorenko; Lilach Toker; Stefano Toldo; Sharon A Tooze; Ivan Topisirovic; Maria Lyngaas Torgersen; Liliana Torosantucci; Alicia Torriglia; Maria Rosaria Torrisi; Cathy Tournier; Roberto Towns; Vladimir Trajkovic; Leonardo H Travassos; Gemma Triola; Durga Nand Tripathi; Daniela Trisciuoglio; Rodrigo Troncoso; Ioannis P Trougakos; Anita C Truttmann; Kuen-Jer Tsai; Mario P Tschan; Yi-Hsin Tseng; Takayuki Tsukuba; Allan Tsung; Andrey S Tsvetkov; Shuiping Tu; Hsing-Yu Tuan; Marco Tucci; David A Tumbarello; Boris Turk; Vito Turk; Robin Fb Turner; Anders A Tveita; Suresh C Tyagi; Makoto Ubukata; Yasuo Uchiyama; Andrej Udelnow; Takashi Ueno; Midori Umekawa; Rika Umemiya-Shirafuji; Benjamin R Underwood; Christian Ungermann; Rodrigo P Ureshino; Ryo Ushioda; Vladimir N Uversky; Néstor L Uzcátegui; Thomas Vaccari; Maria I Vaccaro; Libuše Váchová; Helin Vakifahmetoglu-Norberg; Rut Valdor; Enza Maria Valente; Francois Vallette; Angela M Valverde; Greet Van den Berghe; Ludo Van Den Bosch; Gijs R van den Brink; F Gisou van der Goot; Ida J van der Klei; Luc Jw van der Laan; Wouter G van Doorn; Marjolein van Egmond; Kenneth L van Golen; Luc Van Kaer; Menno van Lookeren Campagne; Peter Vandenabeele; Wim Vandenberghe; Ilse Vanhorebeek; Isabel Varela-Nieto; M Helena Vasconcelos; Radovan Vasko; Demetrios G Vavvas; Ignacio Vega-Naredo; Guillermo Velasco; Athanassios D Velentzas; Panagiotis D Velentzas; Tibor Vellai; Edo Vellenga; Mikkel Holm Vendelbo; Kartik Venkatachalam; Natascia Ventura; Salvador Ventura; Patrícia St Veras; Mireille Verdier; Beata G Vertessy; Andrea Viale; Michel Vidal; Helena L A Vieira; Richard D Vierstra; Nadarajah Vigneswaran; Neeraj Vij; Miquel Vila; Margarita Villar; Victor H Villar; Joan Villarroya; Cécile Vindis; Giampietro Viola; Maria Teresa Viscomi; Giovanni Vitale; Dan T Vogl; Olga V Voitsekhovskaja; Clarissa von Haefen; Karin von Schwarzenberg; Daniel E Voth; Valérie Vouret-Craviari; Kristina Vuori; Jatin M Vyas; Christian Waeber; Cheryl Lyn Walker; Mark J Walker; Jochen Walter; Lei Wan; Xiangbo Wan; Bo Wang; Caihong Wang; Chao-Yung Wang; Chengshu Wang; Chenran Wang; Chuangui Wang; Dong Wang; Fen Wang; Fuxin Wang; Guanghui Wang; Hai-Jie Wang; Haichao Wang; Hong-Gang Wang; Hongmin Wang; Horng-Dar Wang; Jing Wang; Junjun Wang; Mei Wang; Mei-Qing Wang; Pei-Yu Wang; Peng Wang; Richard C Wang; Shuo Wang; Ting-Fang Wang; Xian Wang; Xiao-Jia Wang; Xiao-Wei Wang; Xin Wang; Xuejun Wang; Yan Wang; Yanming Wang; Ying Wang; Ying-Jan Wang; Yipeng Wang; Yu Wang; Yu Tian Wang; Yuqing Wang; Zhi-Nong Wang; Pablo Wappner; Carl Ward; Diane McVey Ward; Gary Warnes; Hirotaka Watada; Yoshihisa Watanabe; Kei Watase; Timothy E Weaver; Colin D Weekes; Jiwu Wei; Thomas Weide; Conrad C Weihl; Günther Weindl; Simone Nardin Weis; Longping Wen; Xin Wen; Yunfei Wen; Benedikt Westermann; Cornelia M Weyand; Anthony R White; Eileen White; J Lindsay Whitton; Alexander J Whitworth; Joëlle Wiels; Franziska Wild; Manon E Wildenberg; Tom Wileman; Deepti Srinivas Wilkinson; Simon Wilkinson; Dieter Willbold; Chris Williams; Katherine Williams; Peter R Williamson; Konstanze F Winklhofer; Steven S Witkin; Stephanie E Wohlgemuth; Thomas Wollert; Ernst J Wolvetang; Esther Wong; G William Wong; Richard W Wong; Vincent Kam Wai Wong; Elizabeth A Woodcock; Karen L Wright; Chunlai Wu; Defeng Wu; Gen Sheng Wu; Jian Wu; Junfang Wu; Mian Wu; Min Wu; Shengzhou Wu; William Kk Wu; Yaohua Wu; Zhenlong Wu; Cristina Pr Xavier; Ramnik J Xavier; Gui-Xian Xia; Tian Xia; Weiliang Xia; Yong Xia; Hengyi Xiao; Jian Xiao; Shi Xiao; Wuhan Xiao; Chuan-Ming Xie; Zhiping Xie; Zhonglin Xie; Maria Xilouri; Yuyan Xiong; Chuanshan Xu; Congfeng Xu; Feng Xu; Haoxing Xu; Hongwei Xu; Jian Xu; Jianzhen Xu; Jinxian Xu; Liang Xu; Xiaolei Xu; Yangqing Xu; Ye Xu; Zhi-Xiang Xu; Ziheng Xu; Yu Xue; Takahiro Yamada; Ai Yamamoto; Koji Yamanaka; Shunhei Yamashina; Shigeko Yamashiro; Bing Yan; Bo Yan; Xianghua Yan; Zhen Yan; Yasuo Yanagi; Dun-Sheng Yang; Jin-Ming Yang; Liu Yang; Minghua Yang; Pei-Ming Yang; Peixin Yang; Qian Yang; Wannian Yang; Wei Yuan Yang; Xuesong Yang; Yi Yang; Ying Yang; Zhifen Yang; Zhihong Yang; Meng-Chao Yao; Pamela J Yao; Xiaofeng Yao; Zhenyu Yao; Zhiyuan Yao; Linda S Yasui; Mingxiang Ye; Barry Yedvobnick; Behzad Yeganeh; Elizabeth S Yeh; Patricia L Yeyati; Fan Yi; Long Yi; Xiao-Ming Yin; Calvin K Yip; Yeong-Min Yoo; Young Hyun Yoo; Seung-Yong Yoon; Ken-Ichi Yoshida; Tamotsu Yoshimori; Ken H Young; Huixin Yu; Jane J Yu; Jin-Tai Yu; Jun Yu; Li Yu; W Haung Yu; Xiao-Fang Yu; Zhengping Yu; Junying Yuan; Zhi-Min Yuan; Beatrice Yjt Yue; Jianbo Yue; Zhenyu Yue; David N Zacks; Eldad Zacksenhaus; Nadia Zaffaroni; Tania Zaglia; Zahra Zakeri; Vincent Zecchini; Jinsheng Zeng; Min Zeng; Qi Zeng; Antonis S Zervos; Donna D Zhang; Fan Zhang; Guo Zhang; Guo-Chang Zhang; Hao Zhang; Hong Zhang; Hong Zhang; Hongbing Zhang; Jian Zhang; Jian Zhang; Jiangwei Zhang; Jianhua Zhang; Jing-Pu Zhang; Li Zhang; Lin Zhang; Lin Zhang; Long Zhang; Ming-Yong Zhang; Xiangnan Zhang; Xu Dong Zhang; Yan Zhang; Yang Zhang; Yanjin Zhang; Yingmei Zhang; Yunjiao Zhang; Mei Zhao; Wei-Li Zhao; Xiaonan Zhao; Yan G Zhao; Ying Zhao; Yongchao Zhao; Yu-Xia Zhao; Zhendong Zhao; Zhizhuang J Zhao; Dexian Zheng; Xi-Long Zheng; Xiaoxiang Zheng; Boris Zhivotovsky; Qing Zhong; Guang-Zhou Zhou; Guofei Zhou; Huiping Zhou; Shu-Feng Zhou; Xu-Jie Zhou; Hongxin Zhu; Hua Zhu; Wei-Guo Zhu; Wenhua Zhu; Xiao-Feng Zhu; Yuhua Zhu; Shi-Mei Zhuang; Xiaohong Zhuang; Elio Ziparo; Christos E Zois; Teresa Zoladek; Wei-Xing Zong; Antonio Zorzano; Susu M Zughaier
Journal:  Autophagy       Date:  2016       Impact factor: 16.016

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.