Yanting Chai1, Ke Xiang2,3, Yezi Wu2, Te Zhang2, Ying Liu2, Xuewen Liu2, Weiguo Zhen2, Yuan Si2. 1. Child Health Center, Shiyan Maternal and Child Health Hospital, Shiyan, Hubei, China (mainland). 2. Laboratory of Molecular Target Therapy of Cancer, Biomedical Research Institute, Hubei University of Medicine, Shiyan, Hubei, China (mainland). 3. Department of Science and Education, Gucheng People's Hospital, Hubei University of Arts and Science, Xiangyang, Hubei, China (mainland).
Abstract
BACKGROUND Colorectal carcinoma (CRC) is one of the most frequently diagnosed malignancies. Cucurbitacin B (CuB) is a natural compound isolated from herbs and shows anticancer activity in several cancers. MATERIAL AND METHODS Here, we analyzed the effects of different CuB concentrations on the proliferative and invasive behaviors of CRC cells using MTT, clonogenic assay, Transwell invasion, and wound healing assays. Flow cytometry was performed to measure the apoptotic effects of CuB on CRC cells. Western blot and real-time PCR were used to investigate the expression of apoptosis and Hippo-YAP signaling pathway proteins. RESULTS CuB inhibited the proliferation and invasion of CRC cells while promoting apoptosis. In addition, the Western blot and real-time PCR results indicated that CuB suppressed YAP expression and its downstream target genes Cyr 61 and c-Myc in CRC cells. To assess the underlying mechanism, we investigated the upstream regulating factor LATS1, and the results revealed that CuB upregulated LATS1 expression in CRC cells. CONCLUSIONS In conclusion, our findings uncovered a novel therapeutic mechanism of CuB and suggest that there is therapeutic potential and feasibility in developing novel YAP inhibitors for cancer treatment.
BACKGROUND Colorectal carcinoma (CRC) is one of the most frequently diagnosed malignancies. Cucurbitacin B (CuB) is a natural compound isolated from herbs and shows anticancer activity in several cancers. MATERIAL AND METHODS Here, we analyzed the effects of different CuB concentrations on the proliferative and invasive behaviors of CRC cells using MTT, clonogenic assay, Transwell invasion, and wound healing assays. Flow cytometry was performed to measure the apoptotic effects of CuB on CRC cells. Western blot and real-time PCR were used to investigate the expression of apoptosis and Hippo-YAP signaling pathway proteins. RESULTS CuB inhibited the proliferation and invasion of CRC cells while promoting apoptosis. In addition, the Western blot and real-time PCR results indicated that CuB suppressed YAP expression and its downstream target genes Cyr 61 and c-Myc in CRC cells. To assess the underlying mechanism, we investigated the upstream regulating factor LATS1, and the results revealed that CuB upregulated LATS1 expression in CRC cells. CONCLUSIONS In conclusion, our findings uncovered a novel therapeutic mechanism of CuB and suggest that there is therapeutic potential and feasibility in developing novel YAP inhibitors for cancer treatment.
Colorectal cancer (CRC) is one of most common cancers in the world, and it is also a major cause of cancer-related death. In 2012, it was estimated there were 1.4 million new cases of CRC and 693 900 related deaths worldwide [1]. Both the morbidity and mortality of CRC are increasing rapidly in Asian countries. In China, CRC is the fifth leading cause of cancer deaths [2]. Current treatment options consist of surgery and adjuvant or palliative chemotherapy. Chemotherapy is the most common therapeutic option for advanced CRC; however, it has limited effectiveness, with poor prognosis and cancer relapse [3]. Therefore, finding novel therapeutic strategies and key target molecules for CRC treatment remains important.The Hippo pathway is critical in regulating cell growth, apoptosis, and stem cell self-renewal [4]. Deregulation of this pathway occurs in many human solid cancers, including CRC [5-7]. The core kinase components of the Hippo pathway are MST1/2, SAV1, LATS1/2, and MOB1. The phosphorylation cascades of these components suppress the transcriptional activity of co-activators Yes-associated protein (YAP) and transcriptional co-activator with a PDZ binding motif (TAZ) [4]. YAP and TAZ have critical roles downstream of the Hippo pathway. With the activation of Hippo signaling, MST1/2 cooperates with SAV1 to phosphorylate and activate LATS1/2. Next, LATS1/2 phosphorylates and suppresses the activity of YAP and TAZ. YAP and TAZ function as transcription factors in the nucleus and combine with TEAD (TEA domain family member) to promote expression of target genes such as c-Myc, Ctgf, CDK6, Cyr61, and AXL [8]. As an oncogene, YAP facilitates tumor progression mainly through TEAD-mediated gene transcription. Therefore, YAP/TEAD-mediated transcription is considered to be a critical therapy target to inhibit YAP-promoted tumor proliferation and to identify novel therapeutic drugs to target YAP/TEAD in CRC patients.Cucurbitacins are natural tetracyclic triterpene compounds extracted from several plant families, such as Cruciferae and Cucurbitaceae [9]. These compounds have a broad spectrum of pharmacological activities, including antioxidant, antiinflammatory, antidiabetic, anticancer, and hepatoprotective effects [10,11]. As one of the most active cucurbitacins, Cucurbitacin B (CuB, Figure 1A) has been most widely used [12,13]. It has been reported to suppress the proliferation and invasion of various humancancers such as gastric, breast, and glioma cell lines [14-17]. Here, we examined the anticancer effects and possible mechanisms of action of CuB in the CRC cell lines SW620 and HT29.
Figure 1
Effect of CuB on CRC cells. (A) Chemical structure of CuB. (B, C) The inhibitory effects of CuB on SW620 and HT29 cells were tested by the MTT assay. (D, E) Inhibitory effects of CuB on cell viability of SW620 and HT29 cells were detected by trypan blue exclusion assay. (F) The colony formation assays of SW620 cells treated with CuB at the indicated concentration. ** P<0.01, *** P<0.001 (for D–F).
Material and Methods
Reagents
CuB (purity 98%) purchased from Shanghai Yuanye Biotechnology Co. (Shanghai, China) was dissolved in dimethyl sulfoxide (DMSO; Sigma-Aldrich, St. Louis, MO, USA), as a 40 mM stock solution and stored at −20°C.
Cell culture
Two CRC cell lines, SW620 and HT29, were purchased from the American Type Culture Collection (ATCC, Manassas, VA, USA). SW620 cells were placed in Leibovitz’s-15 (L-15) medium (Gibco; Thermo Fisher Scientific, Inc., Waltham, MA) containing 10% fetal bovine serum (FBS; HyClone; GE Healthcare Life Sciences, Chalfont, UK) and antibiotics. HT29 cells were cultured in Dulbecco’s modified Eagle’s medium (DMEM; Gibco; Thermo Fisher Scientific, Inc., Waltham, MA, USA) containing 10% FBS and antibiotics. All cells were then incubated at 37°C in a humidified atmosphere of 5% CO2.
Cytotoxic assay and cell viability
The MTT assay was used to detect the cytotoxicity of the cells. We seeded 1×105 cells/well in 96-well plates, preincubated them for 24 h, and then treated them with CuB for 24 or 48 h. Absorbance was measured at 490 nm using an enzyme immunoassay analyzer (BioTek Instruments, Inc., Winooski, VT, USA), and the inhibition rate was calculated as follows: Inhibition rate (%)=(average A490 of the control group–A490 of the mean test group)/(average A490 for control group–average A490 for blank group) ×100%. Trypan blue dye exclusion was used to detect cell viability [18].
Soft-agar colony formation assay
The assay was first performed in L-15 containing 0.6% low melting point agarose and 10% FBS. We seeded 1000 cells in 1 ml of L-15 containing 10% FBS and 0.3% low melting point agarose (Amresco, Cleveland, OH, USA) and laminated it to the substrate. Two weeks later, the plates were stained with 0.2% crystal violet and the number of cell colonies was counted under an optical microscope (IX70; Olympus Corporation, Tokyo, Japan) [19,20].
Invasion assay
Invasion assays were performed using 24-well plates (Corning, Inc., NY, USA). A polyvinylpyrrolidone-free polycarbonate filter (8-μm pore size) (Corning) was coated with 100 μl of Matrigel (BD Biosciences, Franklin Lakes, NJ, USA). The lower chamber was filled with medium containing 20% FBS as a chemoattractant. The coated upper chamber was placed on the lower chamber. Cells pretreated with CuB for 30 minutes (2×104 cells/well) were seeded into the upper chamber wells. After incubation at 37°C for 20 h, 4% paraformaldehyde was used for fixation, and the upper chamber was stained with 2% ethanol containing 0.2% crystal violet for 15 min. After drying, the stained cells were counted under a light microscope with a 10-fold objective. Further, infiltrated cells on the other side of the membrane were dissolved with 33% acetic acid, absorbance was measured at 570 nm, and quantification was performed.
Wound healing assay
We seeded 4×105 cells in 6-well plates and cultured them at 37°C until 90~100% coverage density. After that, the fused cells were scratched with a 200-μl pipette tip, then washed with PBS, and then re-suspended in L-15. After 24 h of CuB treatment, 4% paraformaldehyde was used for fixation, 0.2% crystal violet powder was used to stain, and we photographed them under a light microscope with a 4× objective. We calculated the number of cells that migrated to the scratched area.
Apoptosis determination by DAPI staining
Coverslips were placed in 12-well plates in advance and approximately 1×106 cells (about 50~60% coverage density) were seeded into each well. After 24 h of culture, the cells were treated with CuB for 24 h. Then, DAPI staining was performed on the CuB-treated group and control group. A representative image was captured using a fluorescence microscope [21].
Flow cytometric assays for Annexin V (AV)
Apoptosis was detected using the AV-FITC kit (BD Biosciences, San Jose, CA, USA). The samples (about 3×106 cells) were subjected to flow cytometry, according to the manufacturer’s instructions, to detect apoptotic cells [22].
Western blot
We harvested 1×106 cells and lysed them with RIPA buffer to extract total protein. Total protein was loaded on 8% to 12% SDS-PAGE. Subsequently, the gel was electrophoretically transferred to a PVDF membrane (Millipore, Kenilworth, NJ, USA). After blocking with 5% nonfat dry milk for 1 hat room temperature, the membrane was incubated with the primary antibody overnight at 4°C and washed 3 times with Tris-buffered saline containing 0.5% Tween20. The primary antibodies used were anti-YAP (1: 500 dilution; catalog no. sc-101199), anti-Cyr61 (1: 500 dilution; catalog no. sc-374129) (Santa Cruz Biotechnology, Santa Cruz, CA, USA), anti-caspase-3 (1: 1000 dilution; catalog no. 9662), anti-PARP (1: 1000 dilution; catalog no. 9542), anti-phospho-YAP (S127) (1: 1000 dilution; catalog no. 4911), anti-LATS1 (1: 1000 dilution; catalog no. 3477) (Cell Signaling Technology, Danvers, MA, USA), anti-c-Myc (1: 2000 dilution; catalog no. 10828-1-AP) (Proteintech Group, Inc, Rosemont, USA), anti-GAPDH (1: 5000 dilution; catalog no. M20006), and anti-Lamin B1 (1: 5000 dilution; catalog no. T40003) (Abmart, Shanghai, China). Subsequently, the membranes were incubated with horseradish peroxidase (HRP)-conjugated secondary antibody (1: 5000 dilution; catalog no. E030120-01 and E030110-01; EarthOx, LLC, San Francisco, CA, USA) at room temperature for 1.5 h. Detection was performed by using a SuperSignal® West Pico Trial kit (catalog no. QA210131; Pierce Biotechnology, Inc., Rockford, IL, USA) [19].
Isolation of nuclear and cytoplasmic fractionation
Nuclear and cytoplasmic extracts were prepared with the NE-PER Nuclear and Cytoplasmic Extraction Kit (Thermo Scientific). The purity of nuclear and cytoplasmic extracts was assessed by Western blot with anti-Lamin B and anti-GAPDH antibodies, respectively.
Real-time quantitative PCR (QPCR)
Expression of the Cyr61 and c-Myc gene was examined by real-time quantitative PCR (QPCR) normalized to expression of GAPDH. Total RNA was extracted from cells using Trizol reagent (Invitrogen; Thermo Fisher Scientific, Inc., Waltham, MA, USA) according to the manufacturer’s protocol. QPCR analysis of Cyr61 and c-Myc was performed with 2 μg of total RNA and ReverTra Ace qPCR RT Kit (Toyobo Co., Ltd. Life Science Department, Osaka Japan). Mixed 2 μg RNA, 4 μl 5×RT Buffer, 1μl RT Enzyme Mix, 1 μl Primer Mix, and Nuclease-free Water up to 20 μl volume. The reverse transcription step was: 37°C for 15 min; 98°C for 5 min, then stored at −20°C. QPCR was performed in an ABI StepOnePlus™ Real-Time PCR System (ABI; Thermo Fisher Scientific, Inc., Waltham, MA, USA) using SYBR® Green Realtime PCR Master Mix (Toyobo Co., Ltd. Life Science Department, Osaka Japan). We mixed the SYBR Green PCR Master Mix 10 μl with forward and reverse primers 200 nM, cDNA template 100 ng, and ddH2O up to 20 μl volume. PCR conditions consisted of the following: 95°C for 3 min for denaturation; 95°C for 15 s for annealing; and 60°C for 1 min for extension, for 40 cycles. The threshold cycle for each sample was selected from the linear range and converted to a starting quantity by interpolation from a standard curve generated on the same plate for each set of primers (Table 1). The Cyr61 and c-Myc mRNA levels were normalized for each well to the GAPDH mRNA levels using the 2−ΔΔCq method [23]. Each experiment was repeated 3 times.
Table 1
Primer sequences for QPCR.
Gene
Primer sequence
Cyr61
F: GGGCTGGAATGCAACTTCG
R: GGCGCCATCAATACATGTGC
c-Myc
F: TACATCCTGTCGGTCCAA
R: AACTGTTCTCGCCTCTTC
GAPDH
F: TGTTGCCATCAATGACCCCTT
R: CTCCACGACGTACTCAGCG
F – forward; R – reverse.
Statistical analysis
All experiments were repeated at least 3 times and the data are presented as the mean ±SD, unless noted otherwise. All statistical analyses were conducted using GraphPad Prism5 (GraphPad Software, Inc., La Jolla, CA, USA) and SPSS 22.0 (IBM Corp., Armonk, NY, USA). Results were analyzed using unpaired the t test or one-way analysis of variance followed by Bonferroni post-test. P<0.05 was considered to indicate a statistically significant difference. All experiments were repeated at least 3 times.
Results
CuB inhibits the growth of CRC cells
The effect of CuB on cell growth was investigated with 2 CRC cell lines, SW620 and HT29. The MTT assay showed that CuB inhibits cell growth in these lines with an IC50 of 0.46 μM to 0.68 μM. As shown in Figure 1B and 1C, CuB was effective at inhibiting the growth of SW620 and HT29 CRC cells. Cell viability assessment showed that CuB decreased the viability of SW620 (Figure 1D) and HT29 cells (Figure 1E) in a dosage- and time-dependent mode. Colony formation activity suggested that CuB markedly reduced the clonogenic ability of SW620 (Figure 1F).
CuB suppresses the invasive behavior of CRC cells
We assessed the ability of CuB to suppress the invasive behavior of CRC cells. Figure 2A suggested that CuB (0–0.06 μM) markedly suppressed the invasion of HT29 cells. To detect the effect of CuB on migration, HT29 cells were pretreated with CuB (0–0.06 μM) and then cell migration was detected. The result indicates that CuB reduced HT29 cell migration in a dosage-dependent manner (Figure 2B). These data indicate that CuB exerted anti-invasive and antimigration effects on CRC cells.
Figure 2
CuB inhibits the invasion and migration of CRC cells. (A) HT29 cells were pretreated with CuB for 30 min. The invasion assay was performed using modified 24-well microchemotaxis chambers. Then, randomly chosen areas were photographed (×100), and the number of cells that migrated to the lower surface was counted as a percentage of invasion. (B) Confluent HT29 cells were scratched and then treated with CuB in a basic medium for 24 h. Cells that migrated into the scratched area were photographed (×40). * P<0.05; ** P<0.01 (for A, B).
CuB activates caspase-dependent apoptosis in CRC cells
Next, we investigated whether CuB can induce apoptosis. DAPI staining suggested that CuB induced typical apoptotic nuclear morphological changes, including chromatin condensation and fragmentation in SW620 cells (Figure 3A). Therefore, we used flow cytometry assays to confirm that CuB activated apoptosis in SW620 and HT29 cells (Figure 3B, 3C). Furthermore, Western blot analysis suggested that CuB induced a significant reduction in the prosomal form of caspase-3 (pro-cas-3) and cleavage of PARP (cleaved PARP) in the 2 cell lines (Figure 3D, 3E). These data indicate that CuB activates caspase-dependent apoptosis in CRC cells.
Figure 3
CuB induces caspase-dependent apoptosis in CRC cells. (A) SW620 cells were incubated with various concentrations of CuB for 24 h. Cells were examined by DAPI staining. Arrows: apoptotic nuclear morphology. (B, C) SW620 and HT29 cells were treated with increasing concentrations of CuB for 24 h, and cell apoptosis was analyzed by annexin V/PI staining and flow cytometry. (D, E) SW620 and HT29 cells were treated with increasing concentrations of CuB for 24 h. Western blot analyses were carried out using the indicated antibodies. * P<0.05; ** P<0.01 vs. 0 μM (for B, C).
CuB regulates the Hippo pathway activation in CRC cells
We determined the effect of CuB on the Hippo pathway proteins by Western blot. We found that treatment with CuB at 0.05–0.15 μM could downregulate YAP expression in SW620 cells (0.1–0.3 μM in HT29 cells). Meanwhile, we detected the serine 127 phosphorylation of YAP (pYAP) and found that CuB elevated YAP phosphorylation in 2 cell lines (Figure 4A, 4B). To detect whether CuB inhibits the nuclear translocation of YAP, we prepared nuclear and cytoplasmic extracts of CuB-treated and untreated cells by using NE-PER Nuclear and Cytoplasmic Extraction Kit. Exposure to CuB substantially inhibited the translocation of YAP from the cytoplasm to the nucleus (Figures 4C, 4D). Furthermore, we investigated 2 downstream target genes of the Hippo pathway, c-Myc and Cyr61 and found that CuB decreased c-Myc and Cyr61 in a dose-dependent manner (Figure 4E, 4F). Our data conclude that CuB decreased the protein expression of YAP and its downstream target genes.
Figure 4
CuB reduces the protein expression of the Hippo pathway through downregulation of YAP. (A, B) SW620 and HT29 cells were incubated with CuB at the indicated concentrations for 24 h, followed by Western blot analysis using indicated antibodies. (C, D) Cytoplasmic and nuclear fractions of SW620 and HT29 cells were isolated, the concentrations of nuclear and cytoplasmic protein were measured by Bradford assay, the same amount of nuclear and cytoplasmic protein was subjected to SDS gel, and Western blot analysis was performed with anti-YAP, GAPDH, and Lamin B1 antibodies. C – cytoplasmic extract; N – nuclear extract. (E, F) The mRNA level of Cyr61 and c-Myc in SW620 and HT29 cells treated with CuB for 24 h was investigated by QPCR. (G–H): SW620 and HT29 cells were incubated with CuB at the indicated concentrations for 24 h, followed by Western blot analysis using indicated antibodies. * P<0.05, ** P<0.01 vs. 0 μM (for E, F).
CuB activates the Hippo pathway by upregulation of LATS1
Phosphorylation of YAP at Ser127 by LATS1/2 induces YAP cytoplasmic retention and degradation [4]. Furthermore, we investigated the potential mechanisms of activation of the Hippo pathway upon CuB treatment. The data showed that CuB-treated SW620 and HT29 cells had dramatically elevated LATS1 protein expression (Figure 5A, 5B), suggesting that CuB activates the Hippo pathway by upregulation of LATS1.
Figure 5
CuB activates the Hippo pathway by upregulation of LATS1. (A, B) SW620 and HT29 cells were incubated with CuB at the indicated concentrations for 24 h, followed by Western blot analysis using indicated antibodies.
Discussion
This study documents the ability of CuB to activate the Hippo signaling pathway in CRC in vitro. The Hippo pathway activation occurs at the same concentrations that inhibit CRC cell growth, migration, and invasion. CuB acts proximally in the Hippo signaling cascade by increasing LATS1 expression and YAP phosphorylation and by inhibiting the expression of YAP, thus preventing the expression of the downstream target genes of YAP (c-Myc and Cyr61).CuB has been reported as an anticancer therapy for many years because of its effects on the molecular targets STAT3, CIP2A, mTOR, NF-κB, and HER2 [17,24-26]. However, the effect and target of CuB in CRC has not been thoroughly investigated. Here, we demonstrated that CuB shows anti-CRC activities in vitro. CuB inhibits CRC cells with IC50 values in the low micromolar concentrations (Figure 1). CuB also suppresses the invasive behavior of CRC cells (Figure 2).Activation of cell apoptosis is an effective cancer treatment. Here, we showed that CuB induced chromatin condensation and nuclear shrinkage (Figure 3A), indicating that CuB induces apoptosis in CRC cells. Flow cytometry assays showed that 0.15 μM or 0.3 μM CuB activated apoptosis at a rate of 28.12% and 30.25% in SW620 and HT29 cells, respectively (Figure 3B, 3C). These data further indicated that CuB induces apoptosis in CRC cells. The apoptotic pathways cause activation of effector caspases (such as casp-3), which is associated with PARP cleavage; a hallmark of apoptosis is the activation of effector caspases [27,28]. We detected caspase activation by Western blot and found that CuB caused PARP cleavage and pro-casp-3 downregulation (Figure 3D, 3E). Therefore, CuB may induce caspase-dependent apoptosis in CRC cells.The occurrence of CRC is accompanied by mutations in several genes, although K-Ras is the most frequently mutated gene [29]. In addition, Shao et al. proved that YAP1 can substitute for loss of K-Ras in humancancers [30]. Thus, YAP and K-Ras may synergistically promote cancer progression in CRC. Recently, Li et al. reported that YAP can inhibit apoptosis and promote invasion by interacting directly with JNK [31]. Therefore, targeting YAP based on its oncoprotein properties is considered to be an attractive therapeutic strategy for humancancer treatment. We investigated the protein and phosphorylation levels of YAP after CuB treatment. The results suggested that CuB could upregulate YAP phosphorylation and downregulate YAP expression (Figure 4A, 4B). The results of nuclear separation showed that CuB inhibited YAP entry into the nucleus (Figure 4C, 4D). Additionally, we detected the mRNA and protein expression of Cyr61 and c-Myc, which are the downstream transcriptional target genes of YAP [8,32]. The results suggested that CuB could downregulate Cyr61 and c-Myc expression (Figure 4E–4H). Actually, another cucurbitacin, cucurbitacin I, has been reported to inhibit the nuclear localization of YAP [33]. Therefore, the nuclear translocation of YAP might be one of the most critical targets for cucurbitacins in CRC. To further investigate the potential mechanism by which CuB influences the Hippo pathway, we detected the expression of LATS1 and showed that CuB increased LATS1 expression in a dose-dependent manner (Figure 5). LATS1 restricts YAP to the cytoplasm through phosphorylation, while dephosphorylated YAP can translocate to the cell nucleus and promote the transcription of target genes [8]. LATS1 can inhibit cell migration through the inhibition of the YAP transcriptional activity [5]. Thus, CuB increased phospho-YAP by upregulating LATS1 expression. In conclusion, we demonstrated the mechanism by which CuB induces proliferation and invasion inhibition and causes cancer cell apoptosis in CRC, which is, at least in part, by activating the Hippo-YAP signaling pathway.
Conclusions
This study indicates that CuB suppresses the growth, invasion, migration, and induced apoptosis of CRC cells in a concentration-dependent manner. Moreover, we found that CuB inhibits the expression of Hippo-YAP signaling pathway proteins to inhibit proliferation and induce apoptosis. Our results suggest that CuB is a potential therapeutic agent for treatment of CRC.
Authors: Kin Tak Chan; Fan Yan Meng; Qian Li; Cheong Yip Ho; Tsz Shan Lam; Yu To; Wai Him Lee; Miao Li; Kee Hung Chu; Melvin Toh Journal: Cancer Lett Date: 2010-02-11 Impact factor: 8.679