| Literature DB >> 30552024 |
Mattia Bonsignori1, Eric Scott2, Kevin Wiehe3, David Easterhoff3, S Munir Alam3, Kwan-Ki Hwang2, Melissa Cooper2, Shi-Mao Xia2, Ruijun Zhang2, David C Montefiori4, Rory Henderson2, Xiaoyan Nie5, Garnett Kelsoe6, M Anthony Moody7, Xuejun Chen8, M Gordon Joyce8, Peter D Kwong8, Mark Connors9, John R Mascola8, Andrew T McGuire10, Leonidas Stamatatos10, Max Medina-Ramírez11, Rogier W Sanders12, Kevin O Saunders4, Thomas B Kepler13, Barton F Haynes14.
Abstract
Elicitation of VRC01-class broadly neutralizing antibodies (bnAbs) is an appealing approach for a preventative HIV-1 vaccine. Despite extensive investigations, strategies to induce VRC01-class bnAbs and overcome the barrier posed by the envelope N276 glycan have not been successful. Here, we inferred a high-probability unmutated common ancestor (UCA) of the VRC01 lineage and reconstructed the stages of lineage maturation. Env immunogens designed on reverted VRC01-class bnAbs bound to VRC01 UCA with affinity sufficient to activate naive B cells. Early mutations defined maturation pathways toward limited or broad neutralization, suggesting that focusing the immune response is likely required to steer B cell maturation toward the development of neutralization breadth. Finally, VRC01 lineage bnAbs with long CDR H3s overcame the HIV-1 N276 glycan barrier without shortening their CDR L1, revealing a solution for broad neutralization in which the heavy chain, not CDR L1, is the determinant to accommodate the N276 glycan.Entities:
Keywords: B lymphocytes; HIV-1; cell lineage; clonal evolution; glycans; immunogen design; indel mutation; monoclonal antibody VRC01; neutralizing antibodies; vaccines
Mesh:
Substances:
Year: 2018 PMID: 30552024 PMCID: PMC6303191 DOI: 10.1016/j.immuni.2018.10.015
Source DB: PubMed Journal: Immunity ISSN: 1074-7613 Impact factor: 43.474
Figure 1VRC01 UCA IgH and IgL Amino Acid Sequences Differed from Those of VRC01 Lineage GL Antibodies
(A) VRC01 UCA IgH (top) and IgL (bottom) aa sequences numbered according to the Kabat system (Kabat et al., 1991).
(B) Ig heavy (top) and light (bottom) chain alignment of VRC01 UCA to VRC01 lineage GL mAbs. The sequence of the mature VRC01 bnAb is shown as reference and mature VRC01 residues involved in interactions with gp120 Env (Zhou et al., 2010) are indicated with closed circle.
(C) VRC01 UCA CDR H3 aa sequence (positions 95 through 102) aligned to CDR H3s of VRC01 lineage GL mAbs. Cysteines shown in green shade. Differences in CDR H3 length, indels, and aa identity to VRC01 UCA are shown on the right.
See also Figure S1.
Figure 2VRC01 UCA Bound to Immunogens Designed of GL VRC01-Class mAbs
(A) VRC01 UCA (red) and GL VRC01-class mAbs (black) dissociation constants against six immunogens. Each data point shows the average of at least duplicate experiments. mAbs that did not display measurable binding are shown with KD > 100 μM.
(B) On-rates (x-axis) and off-rates (y-axis) for the same mAbs and immunogens. Only mAbs with KD < 100 μM are shown.
(C) B cell activation mediated by immunogens (red) measured by calcium flux (y-axis) on Ramos B cells expressing VRC01 UCA IgM BCR over 300 s (x-axis). Immunogen mutants with either D279K/D368R or D268R/E370A double mutation are shown in black (“KO mutants”). For the GT1 trimer, BG505 SOSIP was used as KO mutant. Results are expressed as percentage of the maximum signal obtained with an anti-IgM F(ab)2 antibody and are representative of at least duplicate experiments.
(D) Binding of monomeric (left), heptameric (middle), and icositetrameric (right) TM4ΔV1-3 core (green) and eOD-GT8 (blue) to VRC01 UCA IgG. KO mutants are shown with dotted lines. Results are representative of duplicate experiments.
See also Table S1, Figures S2 and S3.
Figure 3VRC01 Phylogeny from the VRC01 UCA Detailed the Maturation Pathways of VRC01 Lineage Antibodies
VRC01 phylogeny reconstructed from 45 mAbs with natural paired IgH and IgL sequences. Inferred maturation intermediate antibodies IA1 through IA6 are colored based on clade membership (right). Indels (aa) are mapped on the tree. Units of branch-length estimates are nt substitutions per site.
Figure 4CDR H3 and CDR L1 Maturation Was Divergent across VRC01 Lineage Clades
Alignment of CDR H3 (left) and CDR L1 (right) aa sequences of the observed VRC01 lineage mAbs to the VRC01 UCA sequence (green). Sequences are grouped by clade and subclade membership. mAbs are listed by their respective sequences. mAbs with sequences that clustered outside their subclade membership are indicated with an asterisk.
Figure 5VRC01+07 and VRC08 Clade Antibodies Acquired Broad Neutralization whereas VRC03+06 Antibodies Displayed Limited Neutralization Breadth
(A) Neutralization was measured against the 12-virus global panel and expressed as percentage (y-axis). mAbs were grouped by clade membership: 16 in clade 03+06, 4 in clade 08, and 23 in clade 01+07. Subclade 06 mAbs are shown as clear dots. Lines indicate geometric mean. Results are representative of duplicate observations. Significance was evaluated using Kruskal-Wallis and Dunn’s multiple comparisons tests at the alpha 0.05 level.
(B) Neutralization potency (IC50) expressed in μg/mL (y-axis). Differences in potency across clades were not statistically significant.
See also Tables S2 and S3.
Figure 6Heavy Chain, Not CDR L1, Is the Determinant to Accommodate the N276 Glycan in VRC08 bnAb and Initiate Breadth
(A) Superposition of the VRC08 structure onto the JRFL SOSIP structure in complex with VRC01. Coloring scheme is as follows: heavy chain (blue), light chain (gray), CDR H3 (red), CDR H3 contact surface (cyan), gp120s (green shades), and gp41s (orange shades). Glycans are shown in stick representation. The N301 glycan was removed from the view for clarity.
(B) Structure of VRC01 in complex with JR-FL SOSIP used to superpose VRC08, with same color scheme of (A).
(C) Heat map analysis of neutralization data of VRC01 UCA, VRC08H/UCAL chimera, and mature VRC08 bnAb (columns) against the 426c wild-type HIV-1 strain and its N276D mutant (in which the potential N-linked glycosylation site at position 276 was abrogated) and the 12-virus global panel. MLV-SVA is shown as negative control. Neutralization potency IC50 is expressed in μg/mL and coloring ranges from white (>50 μg/mL) to dark red (<0.023 μg/mL). Results are representative of at least duplicate experiments.
See also Figure S4, Videos S1 and S2.
Figure 7Lack of Relationship between Auto- and Polyreactivity and Neutralization Breadth in Mature VRC01 Lineage bnAbs
(A) UBE3A reactivity (red), polyreactivity (blue), and anti-nuclear antigens (ANA) autoreactivity are shown for each mAb.
(B and C) Neutralization breadth (B) and potency (C) of non-auto-/polyreactive (n = 9) and auto-polyreactive (n = 34) antibodies as defined in (A). Significance was evaluated with the Mann-Whitney U test at the alpha 0.05 level.
(D and E) Lack of correlation between neutralization breadth (D) or potency (E) and polyreactivity.
See also Figures S5 and S6.
| REAGENT or RESOURCE | SOURCE | IDENTIFIER |
|---|---|---|
| VRC03 g (VRC01 lineage mAb isolated from individual NIH45) | Produced in house ( | GenBank: |
| VRC03 (VRC01 lineage mAb isolated from individual NIH45) | Produced in house ( | GenBank: |
| VRC03b (VRC01 lineage mAb isolated from individual NIH45) | Produced in house ( | GenBank: |
| VRC03f (VRC01 lineage mAb isolated from individual NIH45) | Produced in house ( | GenBank: |
| VRC03e (VRC01 lineage mAb isolated from individual NIH45) | Produced in house ( | GenBank: |
| VRC03i (VRC01 lineage mAb isolated from individual NIH45) | Produced in house ( | GenBank: |
| VRC03h (VRC01 lineage mAb isolated from individual NIH45) | Produced in house ( | GenBank: |
| VRC03d (VRC01 lineage mAb isolated from individual NIH45) | Produced in house ( | GenBank: |
| VRC06b (VRC01 lineage mAb isolated from individual NIH45) | Produced in house ( | GenBank: |
| VRC06d (VRC01 lineage mAb isolated from individual NIH45) | Produced in house ( | GenBank: |
| VRC06 g (VRC01 lineage mAb isolated from individual NIH45) | Produced in house ( | GenBank: |
| VRC06e (VRC01 lineage mAb isolated from individual NIH45) | Produced in house ( | GenBank: |
| VRC06f (VRC01 lineage mAb isolated from individual NIH45) | Produced in house ( | GenBank: |
| VRC06 (VRC01 lineage mAb isolated from individual NIH45) | Produced in house ( | GenBank: |
| VRC06c (VRC01 lineage mAb isolated from individual NIH45) | Produced in house ( | GenBank: |
| VRC08e (VRC01 lineage mAb isolated from individual NIH45) | Produced in house ( | GenBank: |
| VRC08c (VRC01 lineage mAb isolated from individual NIH45) | Produced in house ( | GenBank: |
| VRC08d (VRC01 lineage mAb isolated from individual NIH45) | Produced in house ( | GenBank: |
| VRC08 (VRC01 lineage mAb isolated from individual NIH45) | Produced in house ( | GenBank: |
| VRC02 (VRC01 lineage mAb isolated from individual NIH45) | Produced in house ( | GenBank: |
| VRC01c (VRC01 lineage mAb isolated from individual NIH45) | Produced in house ( | GenBank: |
| VRC01g (VRC01 lineage mAb isolated from individual NIH45) | Produced in house ( | GenBank: |
| VRC01b (VRC01 lineage mAb isolated from individual NIH45) | Produced in house ( | GenBank: |
| VRC01 (VRC01 lineage mAb isolated from individual NIH45) | Produced in house ( | GenBank: |
| VRC01i (VRC01 lineage mAb isolated from individual NIH45) | Produced in house ( | GenBank: |
| VRC01h (VRC01 lineage mAb isolated from individual NIH45) | Produced in house ( | GenBank: |
| VRC01f (VRC01 lineage mAb isolated from individual NIH45) | Produced in house ( | GenBank: |
| VRC01e (VRC01 lineage mAb isolated from individual NIH45) | Produced in house ( | GenBank: |
| VRC01j (VRC01 lineage mAb isolated from individual NIH45) | Produced in house ( | GenBank: |
| VRC01d (VRC01 lineage mAb isolated from individual NIH45) | Produced in house ( | GenBank: |
| VRC07e (VRC01 lineage mAb isolated from individual NIH45) | Produced in house ( | GenBank: |
| VRC07f (VRC01 lineage mAb isolated from individual NIH45) | Produced in house ( | GenBank: |
| VRC07d (VRC01 lineage mAb isolated from individual NIH45) | Produced in house ( | GenBank: |
| NIH45-46 (VRC01 lineage mAb isolated from individual NIH45) | Produced in house ( | GenBank: |
| VRC07c (VRC01 lineage mAb isolated from individual NIH45) | Produced in house ( | GenBank: |
| VRC07b (VRC01 lineage mAb isolated from individual NIH45) | Produced in house ( | GenBank: |
| VRC01 V.Rev | See | |
| VRC03 V.Rev | This paper | See |
| VRC18b V.Rev | This paper | See |
| 3BNC60 V.Rev | This paper | See |
| 3BNC117 V.Rev | This paper | See |
| 12A12 V.Rev | This paper | See |
| VRC20 V.Rev | This paper | See |
| VRC23 V.Rev | This paper | See |
| VRC01 VJ.Rev (aka VRC01 GL.Rev) | See | |
| VRC03 VJ.Rev (aka VRC03 GL.Rev) | N/A | |
| VRC06 VJ.Rev (aka VRC06 GL.Rev) | N/A | |
| NIH-45-46 VJ.Rev (aka NIH45-46 GL.Rev) | N/A | |
| HIV-1 MN.3 pseudovirus | Produced in house. | Los Alamos Databases. HIV sequence database Accession number |
| HIV-1 strain BJOX2000 pseudovirus | Produced in house ( | NIH AIDS Reagent Program Cat. No. 12670 |
| HIV-1 strain CE1176 pseudovirus | Produced in house ( | NIH AIDS Reagent Program Cat. No. 12670 |
| HIV-1 strain X1632 pseudovirus | Produced in house ( | NIH AIDS Reagent Program Cat. No. 12670 |
| HIV-1 strain X2278 pseudovirus | Produced in house ( | NIH AIDS Reagent Program Cat. No. 12670 |
| HIV-1 strain 398F1 pseudovirus | Produced in house ( | NIH AIDS Reagent Program Cat. No. 12670 |
| HIV-1 strain 25710 pseudovirus | Produced in house ( | NIH AIDS Reagent Program Cat. No. 12670 |
| HIV-1 strain CNE8 pseudovirus | Produced in house ( | NIH AIDS Reagent Program Cat. No. 12670 |
| HIV-1 strain TRO11 pseudovirus | Produced in house ( | NIH AIDS Reagent Program Cat. No. 12670 |
| HIV-1 strain 246F3 pseudovirus | Produced in house ( | NIH AIDS Reagent Program Cat. No. 12670 |
| HIV-1 strain CE0217 pseudovirus | Produced in house ( | NIH AIDS Reagent Program Cat. No. 12670 |
| HIV-1 strain CH119 pseudovirus | Produced in house ( | NIH AIDS Reagent Program Cat. No. 12670 |
| HIV-1 strain CNE55 pseudovirus | Produced in house ( | NIH AIDS Reagent Program Cat. No. 12670 |
| PBMCs from patient NIH45 | VRC/NIAID | N/A |
| Synthetic construct eOD-GT6-Avi-3C-His (eOD-GT6) | Produced in house ( | GenBank: |
| Synthetic construct delta_eOD-GT6-Avi-3C-His gene (eOD-GT6 KO) | Produced in house ( | GenBank: |
| Synthetic construct eOD-GT8-Avi-3C-His gene (eOD-GT8) (monomer) | Produced in house ( | GenBank: |
| Synthetic construct delta_eOD-GT8-Avi-3C-His (eOD-GT8 KO) (monomer) | Produced in house ( | GenBank: |
| Synthetic construct clone 426c-degly3.coreE-AviHis mutant envelope glycoprotein (TM1ΔV1-3) | Produced in house ( | GenBank: |
| Synthetic construct clone 426c-degly3.D279K/D368R.coreE-AviHis mutant envelope glycoprotein (TM1ΔV1-3 KO) | Produced in house ( | GenBank: |
| Synthetic construct chimeric gp120 core C13.G3 precursor (C13) | Produced in house ( | GenBank: |
| Synthetic construct chimeric gp120 core C13.G3 D279K precursor (C13 KO) | Produced in house ( | N/A |
| eOD-GT8 (heptamer) | Produced in house. | N/A |
| eOD-GT8 (24-mer) | Produced in house. | N/A |
| TM4ΔV1-3 (monomer) | Produced in house ( | N/A |
| TM4ΔV1-3 KO (monomer) | Produced in house ( | N/A |
| TM4ΔV1-3 (heptamer) | Produced in house ( | N/A |
| TM4ΔV1-3 D368R/E370A (heptamer) | Produced in house ( | N/A |
| TM4ΔV1-3 (24-mer) | Produced in house ( | N/A |
| TM4ΔV1-3 D368R/E370A (24-mer) | Produced in house ( | N/A |
| BG505 SOSIP v4.1-GT1 | Produced in house ( | N/A |
| BG505 SOSIP | Produced in house ( | N/A |
| Resurfaced Core Protein-3 (RSC3) | Produced in house ( | N/A |
| Resurfaced Core Protein-3 delta 371I/P363N | Produced in house ( | N/A |
| UBE3A | UBPBio | Cat No. K1410 |
| SureBlue Reserve TMB | KPL | Cat. No. 53-00-03 |
| Jo-1 antigen | ImmunoVision | Cat. No. JO1-3000 |
| nRNP Complex (Sm/RNP) | ImmunoVision | Cat. No. SRC-3000 |
| Scl-70 antigen | ImmunoVision | Cat. No. SCL-3000 |
| Smith (Sm) antigen | ImmunoVision | Cat. No. SMA-3000 |
| SSA (Ro) antigen | ImmunoVision | Cat. No. SSA-3000 |
| SSB (La) antigen | ImmunoVision | Cat. No. SSB-3000 |
| Centromere protein B | Prospec | Cat. No. PRO-390 |
| Deoxyribonucleic Acid, Calf Thymus Source | Worthington | Cat. No. LS002105 |
| Poly-lysine | Sigma Aldrich | Cat. No. P6285 |
| ExpiFectamine 293 transfection kit | ThermoFisher Scientific | Cat. No. A14525 |
| FLIPR Calcium 6 Assay Kit | Molecular Devices | Cat. No. R8190 |
| ANA HEp-2 test system | Zeuss Scientific | Cat. No. FA2400 |
| ProtoArray Human Protein Microarray | Invitrogen | Cat. No. PAH0525101 |
| VRC01 UCA | GenBank | MK032222, MK032237 |
| DH651.1 (VRC01 lineage mAb isolated from individual NIH45) | GenBank | MK032223, MK032238 |
| DH651.2 (VRC01 lineage mAb isolated from individual NIH45) | GenBank | MK032224, MK032239 |
| DH651.3 (VRC01 lineage mAb isolated from individual NIH45) | GenBank | MK032225, MK032240 |
| DH651.4 (VRC01 lineage mAb isolated from individual NIH45) | GenBank | MK032226, MK032241 |
| DH651.5 (VRC01 lineage mAb isolated from individual NIH45) | GenBank | MK032227, MK032242 |
| DH651.6 (VRC01 lineage mAb isolated from individual NIH45) | GenBank | MK032228, MK032243 |
| DH651.7 (VRC01 lineage mAb isolated from individual NIH45) | GenBank | MK032229, MK032244 |
| DH651.8 (VRC01 lineage mAb isolated from individual NIH45) | GenBank | MK032230, MK032245 |
| DH651.9 (VRC01 lineage mAb isolated from individual NIH45) | GenBank | MK032231, MK032246 |
| MS40L cells | N/A | |
| Ramos cells | ATCC CRL-1596 | |
| TZM-bl cells | Dr. John C. Kappes and Dr. Xiaoyun Wu | NIH AIDS Reagent Program Cat. No. 8129 |
| gggcttctggatatgaatttattgattgttatctaaa | ThermoFisher | N/A |
| ggatatgaatttattgattgtacgatgaattggattc | ThermoFisher | N/A |
| Cloanalyst | ||
| Clustal Omega | ||
| PhyML | ||
| DNAML | ||
| BioEdit v 7.1.3.0 | ||
| EMBOSS Water | EMBL-EBI | |
| Biacore S200 Evaluation Software | GE Healthcare | |
| Modeler | ||
| Rosetta | RosettaCommons | |
| NAMD 2.12 | ||
| GenePix Pro 5.0 | Molecular Devices | |
| SoftMax Pro 5.4.1 | Molecular Devices | |
| ARMADiLLO | Inquiries to K. Wiehe of the DHVI | |
| Prism v 7.03 | GraphPad | |
| Analyze Align Tool | Los Alamos HIV database web interface | |
| Biacore S200 | GE Healthcare | N/A |
| FlexStation 3 | Molecular Devices | N/A |
| Olympus AX70 fluorescent microscope | Olympus | N/A |
| GenePix 4000B scanner | Molecular Devices | N/A |
| SpectraMax 384PLUS | Molecular Devices | N/A |
| Biomek FX | Beckman Coulter | N/A |