| Literature DB >> 30352598 |
Bo Wang1, Olusola Anuoluwapo Akanbi1, Dominik Harms1, Olufisayo Adesina1, Folakemi Abiodun Osundare1,2, Dhamari Naidoo3, Isabel Deveaux4, Opeayo Ogundiran4, Uzoma Ugochukwu4, Nwando Mba4, Chikwe Ihekweazu4, C-Thomas Bock5,6.
Abstract
BACKGROUND: In 2017 the Nigerian Ministry of Health notified the World Health Organization (WHO) of an outbreak of hepatitis E located in the north-east region of the country with 146 cases with 2 deaths. The analysis of the hepatitis E virus (HEV) genotypes responsible for the outbreak revealed the predominance of HEV genotypes 1 (HEV-1) and 2 (HEV-2). Molecular data of HEV-2 genomes are limited; therefore we characterized a HEV-2 strain of the outbreak in more detail. FINDING: The full-length genome sequence of an HEV-2 strain (NG/17-0500) from the outbreak was amplified using newly designed consensus primers. Comparison with other HEV complete genome sequences, including the only HEV-2 strain (Mex-14) with available complete genome sequences and the availability of data of partial HEV-2 sequences from Sub-Saharan Africa, suggests that NG/17-0500 belongs to HEV subtype 2b (HEV-2b).Entities:
Keywords: Complete genome; HEV genotype 2; HEV subtype 2b; Hepatitis E virus; Nigeria; Outbreak
Mesh:
Substances:
Year: 2018 PMID: 30352598 PMCID: PMC6199738 DOI: 10.1186/s12985-018-1082-8
Source DB: PubMed Journal: Virol J ISSN: 1743-422X Impact factor: 4.099
Primers used for HEV quantification, genotyping, and complete genome sequencing
| Primera | Sequence (5′-3′) | Locationb | Use | Reference |
|---|---|---|---|---|
| HEV-07_f | GGTGGTTTCTGGGGTGAC | 5261–5278 | HEV-1 to HEV-4 quantification | [ |
| HEV-TM3_f | FAM-TGATTCTCAGCCCTTCGC-MGB | 5284–5301 | ||
| HEV-08_r | AGGGGTTGGTTGGATGAA | 5330–5313 | ||
| HEV-38_f | GARGCYATGGTBGAGAARG | 4084–4102 | HEV-1 to HEV-4 genotyping in ORF1 | [ |
| HEV-39_r | GCCATRTTCCARACRGTRTTCC | 4622–4601 | ||
| HEV-37_f | GGTTYCGYGCYATTGARAARG | 4277–4297 | ||
| HEV-27_r | TCRCCRGARTGYTTCTTCC | 4583–4565 | ||
| HEV-30_f | CCGACAGAATTRATTTCGTCGG | 6296–6317 | HEV-1 to HEV-4 genotyping in ORF2 | |
| HEV-32_f | GTCTCRGCCAATGGCGAGCCRRC | 6350–6372 | ||
| HEV-31_r | GTYTTRGARTACTGCTGR | 6750–6733 | ||
| HEV-266_f | GCARGCTGCTCTRGCWGCGGC | 78–98 | HEV-2 complete genome sequencing | This study |
| HEV-274_f | TGGTGGTTAGGCCTTTTCTCTC | 122–143 | ||
| HEV-275_f | CCGATCCAGCGTGTCATACATA | 223–244 | ||
| HEV-267_r | GGRGCWGWRTACCARCGCTG | 392–373 | ||
| HEV-268_f | AYCTYCGYGGYATTAGCTAYAAGG | 1055–1078 | ||
| HEV-276_r | CGTTGATGGCAAATTGTGAGGT | 1178–1157 | ||
| HEV-277_f | ATCTCTCGTCTCTACAGCTGGT | 1246–1267 | ||
| HEV-278_f | GGGCCGTCAGTTGCAATTTTAT | 1299–1320 | ||
| HEV-283_f | GTAGCTGCCGGACTATTGCT | 1397–1416 | ||
| HEV-270_r | ARCCACYKCATAAARCARC | 1457–1439 | ||
| HEV-284_f | ACCAGGGCCATGACAATGAG | 1508–1527 | ||
| HEV-285_r | GAGGCCTGGTCAGCAACTAG | 2186–2164 | ||
| HEV-271_f | AACCCMAAGAGGCUYGAGGC | 2620–2639 | ||
| HEV-272_f | GCCTGGGARCGKAAYCAYCG | 2734–2753 | ||
| HEV-279_f | TGTTCAACGTAGGATGATCCGG | 2833–2812 | ||
| HEV-280_f | TTTGAGCATACTGGTCTGGTCC | 3220–3241 | ||
| HEV-273_r | CARCGRUGKGURACAUGCCACC | 3296–3275 | ||
| HEV-235_r | CYGCCTGGGTGAACACTAG | 3421–3403 | ||
| HEV-265_f | ATGGGGACGCCTATGATGAATC | 4337–4358 | ||
| HEV-282_r | TTCTGGGTCGAGTCAAACTCAG | 4439–4418 | ||
| HEV-281_r | CACTCCTCCATAATAGCGCACT | 4481–4460 | ||
| HEV-286_f | TTCTGCTGTTGCTCCTCCTG | 5169–5188 | ||
| HEV-301_f | AGACGTCTGGTGTTGCTGAG | 5937–5956 | ||
| HEV-288_r | TTTACTGTCGGCTCGGCATT | 6384–6365 | ||
| HEV-287_r | GCTGGGCATTCTCCACAGAT | 6413–6394 | ||
| HEV-233_f | GCCTSTTTTGTGATGCGCG | 6755–6773 |
aForward primer designations end with _f; reverse primer designations end with _r
bNumbering is according the HEV prototype strain Burma (GenBank accession No. M73218)
Fig. 1Phylogenetic relationships of NG/17–0500 within the species Orthohepevirus A. HEV-2 strains are designated with geno/subtype, accession number, country, and collection year. NG/17–0500 of this study is shown in red. Phylogenetic analyses were performed with MEGA software version 7.0.26. Maximum likelihood trees based on General Time Reversible model with Gamma distributed with Invariant sites was inferred. The values at nodes indicate the bootstrap values (using 1000 replications). Values below 70% are hidden for clarity of presentation. Reference sequences for HEV genotypes were as proposed from the ICTV Hepeviridae Study Group. Nucleotide (nt) and amino acid (aa) sequences were aligned using MAFFT software version 7.222. a Phylogenetic relationships based on complete genome sequences of representative HEV reference strains. HEV-2 strains are highlighted with red branches. b Phylogenetic relationships based on 641 nt of ORF 2 corresponding to nt positions 6453 to 7093 (numbered according to the HEV prototype strain from Burma GenBank accession No. M73218). HEV-2b strains are highlighted with red branches
Nucleotide and amino acid sequence identities between NG/17–0500 and reference HEV strains within the family Hepeviridaea
|
| Degree of identity (%) | ||||||
|---|---|---|---|---|---|---|---|
| Complete genome | ORF1 | ORF2 | ORF3 | ||||
| ntb | nt | aa | nt | aa | nt | aa | |
| HEV-1 | 75.0 | 72.3 | 83.5 | 81.0 | 94.8 | 90.9 | 87.8 |
| HEV-2 | 83.5 | 82.3 | 92.7 | 86.8 | 98.2 | 94.1 | 91.1 |
| HEV-3 | 73.1 | 71.2 | 81.5 | 78.7 | 91.2 | 83.9 | 76.4 |
| HEV-4 | 73.5 | 71.1 | 80.6 | 80.7 | 91.1 | 80.6 | 78.9 |
| HEV-5 | 72.6 | 70.1 | 80.1 | 78.6 | 89.1 | 75.0 | 74.1 |
| HEV-6 | 72.8 | 70.9 | 79.4 | 78.0 | 88.5 | 75.5 | 70.5 |
| HEV-7 | 72.3 | 69.8 | 80.6 | 78.8 | 89.8 | 79.0 | 79.8 |
| HEV-8 | 72.2 | 70.0 | 79.9 | 77.9 | 89.4 | 78.5 | 81.6 |
| Avian HEV | 46.3 | 44.9 | 41.3 | 46.2 | 43.3 | 25.6 | 21.1 |
| Rat HEV | 52.1 | 50.1 | 48.0 | 55.1 | 54.8 | 38.1 | 27.1 |
| Bat HEV | 47.2 | 45.8 | 41.6 | 55.1 | 48.1 | 30.6 | 15.9 |
aThe sequences were aligned using MAFFT software version 7.222. The evolutionary analyses were conducted using MEGA 7 software version 7.0.26. The GenBank accession numbers are for HEV-1 (M73218), HEV-2 (KX578717), HEV-3 (AF082843), HEV-4 (AJ272108), HEV-5 (AB573435), HEV-6 (AB602441), HEV-7 (KJ496143), HEV-8 (KX387865), Avian HEV (AY535004), Rat HEV (GU345042), and Bat HEV (JQ001749)
bnt and aa represent nucleotide and amino acid, respectively
Fig. 2Detection of potential recombination events of NG/17–0500 within HEV-1 to HEV-4. a Identity Plot and b BootScan analyses of full-length sequences were performed using SimPlot software program version 3.5.1 with an F84 distance model, a sliding window size of 300 base pairs and a step size of 15 base pairs increment. Positions containing gaps were stripped from the alignment