Literature DB >> 30352598

A new hepatitis E virus genotype 2 strain identified from an outbreak in Nigeria, 2017.

Bo Wang1, Olusola Anuoluwapo Akanbi1, Dominik Harms1, Olufisayo Adesina1, Folakemi Abiodun Osundare1,2, Dhamari Naidoo3, Isabel Deveaux4, Opeayo Ogundiran4, Uzoma Ugochukwu4, Nwando Mba4, Chikwe Ihekweazu4, C-Thomas Bock5,6.   

Abstract

BACKGROUND: In 2017 the Nigerian Ministry of Health notified the World Health Organization (WHO) of an outbreak of hepatitis E located in the north-east region of the country with 146 cases with 2 deaths. The analysis of the hepatitis E virus (HEV) genotypes responsible for the outbreak revealed the predominance of HEV genotypes 1 (HEV-1) and 2 (HEV-2). Molecular data of HEV-2 genomes are limited; therefore we characterized a HEV-2 strain of the outbreak in more detail. FINDING: The full-length genome sequence of an HEV-2 strain (NG/17-0500) from the outbreak was amplified using newly designed consensus primers. Comparison with other HEV complete genome sequences, including the only HEV-2 strain (Mex-14) with available complete genome sequences and the availability of data of partial HEV-2 sequences from Sub-Saharan Africa, suggests that NG/17-0500 belongs to HEV subtype 2b (HEV-2b).
CONCLUSIONS: We identified a novel HEV-2b strain from Sub-Saharan Africa, which is the second complete HEV-2 sequence to date, whose natural history and epidemiology merit further investigation.

Entities:  

Keywords:  Complete genome; HEV genotype 2; HEV subtype 2b; Hepatitis E virus; Nigeria; Outbreak

Mesh:

Substances:

Year:  2018        PMID: 30352598      PMCID: PMC6199738          DOI: 10.1186/s12985-018-1082-8

Source DB:  PubMed          Journal:  Virol J        ISSN: 1743-422X            Impact factor:   4.099


Main text

Hepatitis E virus (HEV) is the prototype of the family Hepeviridae and a common causative agent of acute viral hepatitis. HEV is a small, (non)enveloped spherical particle of about 34 nm in diameter harboring a single stranded, positive sense RNA genome of approximately 7.5 kb [1]. Eight HEV genotypes are recognized within the species Orthohepevirus A based on the pairwise distances of entire viral genomes (HEV-1 to HEV-8). The different HEV genotypes have various reservoirs, distinct distribution, and transmission patterns. Four major HEV genotypes (HEV-1 to HEV-4) are well recognized as human pathogens while HEV-5 and HEV-6 have been detected only in wild boars so far. HEV-7 from dromedary camels has been reported to infect humans and cause chronic hepatitis E. HEV-8 is identified in Bactrian camels with an unknown zoonotic potential [2-4]. HEV-1 and HEV-2 are transmitted through the waterborne/fecal-oral route and responsible for large HEV outbreaks and epidemics in endemic areas like the Indian subcontinent and Africa, whereas HEV-3 and HEV-4 are linked to zoonotic transmission causing sporadic infections mainly in industrialized countries [5]. HEV-2 was firstly identified during a hepatitis E outbreak in Mexico in 1986 while the complete genome sequence (HPENSSP, GenBank accession No. M74506) was subsequently characterized [6]. Recently, additional HEV-2 full-length genome sequences were obtained from an individual patient of same Hepatitis E outbreak in Mexico (Mex-14, KX578717) showing 99.5% nucleotide identity to M74506 [7]. However, the sequences for M74506 and KX578717 are from the same isolate. Since M74506 has been referred to as Mexico [8], Mexico-14 [9], and Telixtac-14 [10], the stool sample was re-analysed at the Paul Ehrlich Institute (PEI), Germany, with the isolate designation Mex-14, and the sequences were submitted to GenBank receiving the accession number KX578717. Additionally, several studies have reported that HEV-2 is distributed in Africa. However, only partial ORF2 gene sequences were amplified [11-14]. According to the report of Lu et al. and the International Committee on Taxonomy of Viruses (ICTV) Hepeviridae Study Group, Mex-14 is the proposed HEV subtype 2a (HEV-2a) reference sequence, and HEV subtype 2b (HEV-2b) was assigned to the partial sequences AF173231 and AF173232 from Nigeria and AY903950 from Chad [15, 16]. In June 2017, the Nigerian Ministry of Health reported to the World Health Organization (WHO) an HEV outbreak in north-east Nigeria, with 146 laboratory confirmed cases and two outbreak-associated cases of death in pregnant [17]. In order to identify the corresponding viral pathogens of this hepatitis E outbreak, we determined HEV genotypes from outbreak samples. The genotyping results showed mainly HEV-1 and HEV-2 strains being predominant within the outbreak, the genotype distribution of isolates from this outbreak as determined by the Nigerian center of disease control (NCDC) and Robert Koch Institute (RKI) was 40% HEV-1 and 60% HEV-2. However, a number of HEV-positive outbreak samples could not genotyped. Since full-length genome sequences of HEV-2 strains are rare, we here report the full-length genome sequence of the HEV-2 strain (NG/17–0500) from an isolate of the Nigerian outbreak. The virus was detected from an individual from Borno state, Nigeria, and initially tested serologically positive for HEV using Wantai HEV-IgM Rapid Test and Wantai HEV-IgM ELISA (Sanbio, Uden, Netherland). Viral RNA from an anonymized serum sample (NG/17–0500) was extracted using High Pure Viral Nucleic Acid Kit (Roche, Mannheim, Germany) following cDNA synthesis using SuperScript™ III First-Strand Synthesis System (Invitrogen, Carlsbad, CA, USA) according to the manufacturer’s instructions. Molecular approaches with sensitive real-time PCR and consensus nested PCR assays were conducted as described recently [18]. To amplify the entire genome sequence of NG/17–0500 and to verify the geno/subtyping results, universal primers were designed based on 38 complete HEV-1 and HEV-2 sequences from the GenBank database. Using genome walking method, gene-specific primers were designed to amplify the gaps. Primers and probe used are listed in Table 1. The complete viral genome of NG/17–0500 was amplified using KAPA HiFi HotStart ReadyMix PCR kit (Roche, Mannheim, Germany). 5′ and 3′ sequences were determined using 5′ and 3′ rapid amplification of cDNA ends (Roche, Mannheim, Germany). Sense and antisense strands of PCR amplicons were sequenced with BigDye Terminator version 3.1 cycle sequencing kit (Thermo Fisher Scientific, USA). Whole genome sequence was assembled and analyzed using Geneious software version 10.0.5. (Biomatters Limited, Auckland, New Zealand) [19].
Table 1

Primers used for HEV quantification, genotyping, and complete genome sequencing

PrimeraSequence (5′-3′)LocationbUseReference
HEV-07_fGGTGGTTTCTGGGGTGAC5261–5278HEV-1 to HEV-4 quantification[18]
HEV-TM3_fFAM-TGATTCTCAGCCCTTCGC-MGB5284–5301
HEV-08_rAGGGGTTGGTTGGATGAA5330–5313
HEV-38_fGARGCYATGGTBGAGAARG4084–4102HEV-1 to HEV-4 genotyping in ORF1[18]
HEV-39_rGCCATRTTCCARACRGTRTTCC4622–4601
HEV-37_fGGTTYCGYGCYATTGARAARG4277–4297
HEV-27_rTCRCCRGARTGYTTCTTCC4583–4565
HEV-30_fCCGACAGAATTRATTTCGTCGG6296–6317HEV-1 to HEV-4 genotyping in ORF2
HEV-32_fGTCTCRGCCAATGGCGAGCCRRC6350–6372
HEV-31_rGTYTTRGARTACTGCTGR6750–6733
HEV-266_fGCARGCTGCTCTRGCWGCGGC78–98HEV-2 complete genome sequencingThis study
HEV-274_fTGGTGGTTAGGCCTTTTCTCTC122–143
HEV-275_fCCGATCCAGCGTGTCATACATA223–244
HEV-267_rGGRGCWGWRTACCARCGCTG392–373
HEV-268_fAYCTYCGYGGYATTAGCTAYAAGG1055–1078
HEV-276_rCGTTGATGGCAAATTGTGAGGT1178–1157
HEV-277_fATCTCTCGTCTCTACAGCTGGT1246–1267
HEV-278_fGGGCCGTCAGTTGCAATTTTAT1299–1320
HEV-283_fGTAGCTGCCGGACTATTGCT1397–1416
HEV-270_rARCCACYKCATAAARCARC1457–1439
HEV-284_fACCAGGGCCATGACAATGAG1508–1527
HEV-285_rGAGGCCTGGTCAGCAACTAG2186–2164
HEV-271_fAACCCMAAGAGGCUYGAGGC2620–2639
HEV-272_fGCCTGGGARCGKAAYCAYCG2734–2753
HEV-279_fTGTTCAACGTAGGATGATCCGG2833–2812
HEV-280_fTTTGAGCATACTGGTCTGGTCC3220–3241
HEV-273_rCARCGRUGKGURACAUGCCACC3296–3275
HEV-235_rCYGCCTGGGTGAACACTAG3421–3403
HEV-265_fATGGGGACGCCTATGATGAATC4337–4358
HEV-282_rTTCTGGGTCGAGTCAAACTCAG4439–4418
HEV-281_rCACTCCTCCATAATAGCGCACT4481–4460
HEV-286_fTTCTGCTGTTGCTCCTCCTG5169–5188
HEV-301_fAGACGTCTGGTGTTGCTGAG5937–5956
HEV-288_rTTTACTGTCGGCTCGGCATT6384–6365
HEV-287_rGCTGGGCATTCTCCACAGAT6413–6394
HEV-233_fGCCTSTTTTGTGATGCGCG6755–6773

aForward primer designations end with _f; reverse primer designations end with _r

bNumbering is according the HEV prototype strain Burma (GenBank accession No. M73218)

Primers used for HEV quantification, genotyping, and complete genome sequencing aForward primer designations end with _f; reverse primer designations end with _r bNumbering is according the HEV prototype strain Burma (GenBank accession No. M73218) Real-time PCR assay targeting the HEV ORF2 and ORF3 overlapping region (ORF2/3) demonstrated viremic HEV infection with a viral load of 1.2 × 10E + 7 IU/mL. Sequence analysis of partial ORF1 and ORF2 genes indicated that NG/17–0500 preliminary belongs to HEV-2. After de novo assembly of the amplicons, the NG/17–0500 full-length sequence showed 7198 nucleotides, excluding the 3′-poly (A) tail, with a G + C content of 57.5% harboring the typical 3 HEV ORFs. Phylogenetic analysis of the complete genome sequence revealed that NG/17–0500 grouped with HEV-2 Mex-14 strain (Fig. 1a), and this was all true for phylogenetic analysis of individual ORFs (data not shown). These relationships were also observed for sequence identities between NG/17–500 and other HEV complete genome or nucleotide or amino acid sequence identities of individual ORFs (Table 2).
Fig. 1

Phylogenetic relationships of NG/17–0500 within the species Orthohepevirus A. HEV-2 strains are designated with geno/subtype, accession number, country, and collection year. NG/17–0500 of this study is shown in red. Phylogenetic analyses were performed with MEGA software version 7.0.26. Maximum likelihood trees based on General Time Reversible model with Gamma distributed with Invariant sites was inferred. The values at nodes indicate the bootstrap values (using 1000 replications). Values below 70% are hidden for clarity of presentation. Reference sequences for HEV genotypes were as proposed from the ICTV Hepeviridae Study Group. Nucleotide (nt) and amino acid (aa) sequences were aligned using MAFFT software version 7.222. a Phylogenetic relationships based on complete genome sequences of representative HEV reference strains. HEV-2 strains are highlighted with red branches. b Phylogenetic relationships based on 641 nt of ORF 2 corresponding to nt positions 6453 to 7093 (numbered according to the HEV prototype strain from Burma GenBank accession No. M73218). HEV-2b strains are highlighted with red branches

Table 2

Nucleotide and amino acid sequence identities between NG/17–0500 and reference HEV strains within the family Hepeviridaea

Hepeviridae Degree of identity (%)
Complete genomeORF1ORF2ORF3
ntbntaantaantaa
HEV-175.072.383.581.094.890.987.8
HEV-283.582.392.786.898.294.191.1
HEV-373.171.281.578.791.283.976.4
HEV-473.571.180.680.791.180.678.9
HEV-572.670.180.178.689.175.074.1
HEV-672.870.979.478.088.575.570.5
HEV-772.369.880.678.889.879.079.8
HEV-872.270.079.977.989.478.581.6
Avian HEV46.344.941.346.243.325.621.1
Rat HEV52.150.148.055.154.838.127.1
Bat HEV47.245.841.655.148.130.615.9

aThe sequences were aligned using MAFFT software version 7.222. The evolutionary analyses were conducted using MEGA 7 software version 7.0.26. The GenBank accession numbers are for HEV-1 (M73218), HEV-2 (KX578717), HEV-3 (AF082843), HEV-4 (AJ272108), HEV-5 (AB573435), HEV-6 (AB602441), HEV-7 (KJ496143), HEV-8 (KX387865), Avian HEV (AY535004), Rat HEV (GU345042), and Bat HEV (JQ001749)

bnt and aa represent nucleotide and amino acid, respectively

Phylogenetic relationships of NG/17–0500 within the species Orthohepevirus A. HEV-2 strains are designated with geno/subtype, accession number, country, and collection year. NG/17–0500 of this study is shown in red. Phylogenetic analyses were performed with MEGA software version 7.0.26. Maximum likelihood trees based on General Time Reversible model with Gamma distributed with Invariant sites was inferred. The values at nodes indicate the bootstrap values (using 1000 replications). Values below 70% are hidden for clarity of presentation. Reference sequences for HEV genotypes were as proposed from the ICTV Hepeviridae Study Group. Nucleotide (nt) and amino acid (aa) sequences were aligned using MAFFT software version 7.222. a Phylogenetic relationships based on complete genome sequences of representative HEV reference strains. HEV-2 strains are highlighted with red branches. b Phylogenetic relationships based on 641 nt of ORF 2 corresponding to nt positions 6453 to 7093 (numbered according to the HEV prototype strain from Burma GenBank accession No. M73218). HEV-2b strains are highlighted with red branches Nucleotide and amino acid sequence identities between NG/17–0500 and reference HEV strains within the family Hepeviridaea aThe sequences were aligned using MAFFT software version 7.222. The evolutionary analyses were conducted using MEGA 7 software version 7.0.26. The GenBank accession numbers are for HEV-1 (M73218), HEV-2 (KX578717), HEV-3 (AF082843), HEV-4 (AJ272108), HEV-5 (AB573435), HEV-6 (AB602441), HEV-7 (KJ496143), HEV-8 (KX387865), Avian HEV (AY535004), Rat HEV (GU345042), and Bat HEV (JQ001749) bnt and aa represent nucleotide and amino acid, respectively Due to inadequate sanitation and lack of clean drinking water, hepatitis E is a severe public health issue in several regions of Africa [20]. Partial HEV-2 sequences have been reported from Sub-Sahara African countries mainly during HEV outbreaks including Namibia in 1995 [12], Sudan in 2004 [13], and the Central African Republic in 2002 [14]. In addition, a single study reported of the analysis of HEV isolates from ten sporadic cases in Port-Harcourt city, southern Nigeria in 1997. Phylogenetic analysis of partial ORF2 fragments indicated that the Nigerian isolates from 1997 are most closely related to the HEV-2a reference Mex-14 strain and have been proposed as HEV-2b [11, 15, 16]. In this regard, comparison of NG/17–0500 sequence to the previously characterized Nigerian HEV-2b isolates displayed a 91.2% to 92.2% nt identity. Phylogenetic analysis of the availability of data of partial HEV-2 sequences from Sub-Saharan Africa showed that NG/17–0500 clustered with proposed HEV-2b sequences, indicating NG/17–0500 belongs to HEV-2b (Fig. 1b). Comparison of partial ORF2 sequences of NG/17–0500 to Chad (AY903950) and Central African Republic (DQ151640) HEV-2b isolates shared 90.3% and 88.4% identity, respectively. No evidence of recombination in NG/17–500 was detected by either Identity Plot or Bootscan analysis (Fig. 2). The complete genome sequence of NG/17–0500 has been deposited in GenBank under the accession number MH809516.
Fig. 2

Detection of potential recombination events of NG/17–0500 within HEV-1 to HEV-4. a Identity Plot and b BootScan analyses of full-length sequences were performed using SimPlot software program version 3.5.1 with an F84 distance model, a sliding window size of 300 base pairs and a step size of 15 base pairs increment. Positions containing gaps were stripped from the alignment

Detection of potential recombination events of NG/17–0500 within HEV-1 to HEV-4. a Identity Plot and b BootScan analyses of full-length sequences were performed using SimPlot software program version 3.5.1 with an F84 distance model, a sliding window size of 300 base pairs and a step size of 15 base pairs increment. Positions containing gaps were stripped from the alignment In conclusion, to the best of our knowledge the novel HEV-2b strain NG/17–0500 from Nigerian hepatitis E outbreak 2017 represents the first complete HEV-2 genomic sequence from Sub-Sahara Africa and the second complete HEV-2 sequence worldwide, which contributes to our knowledge of the diversity of HEV-2. Nevertheless, the natural history of NG/17–0500 requires further comprehensive genetic and epidemiological analyses.
  16 in total

Review 1.  Pathogenesis and treatment of hepatitis e virus infection.

Authors:  Heiner Wedemeyer; Sven Pischke; Michael P Manns
Journal:  Gastroenterology       Date:  2012-05       Impact factor: 22.682

2.  Genetic heterogeneity of hepatitis E virus in Darfur, Sudan, and neighboring Chad.

Authors:  Elisabeth Nicand; Gregory L Armstrong; Vincent Enouf; Jean Paul Guthmann; Jean-Philippe Guerin; Mélanie Caron; Jacques Yves Nizou; Roberta Andraghetti
Journal:  J Med Virol       Date:  2005-12       Impact factor: 2.327

3.  Comprehensive Molecular Approach for Characterization of Hepatitis E Virus Genotype 3 Variants.

Authors:  Bo Wang; Dominik Harms; C Patrick Papp; Sandra Niendorf; Sonja Jacobsen; Marc Lütgehetmann; Sven Pischke; Heiner Wedermeyer; Jörg Hofmann; C-Thomas Bock
Journal:  J Clin Microbiol       Date:  2018-04-25       Impact factor: 5.948

4.  Proposed reference sequences for hepatitis E virus subtypes.

Authors:  Donald B Smith; Peter Simmonds; Jacques Izopet; Edmilson F Oliveira-Filho; Rainer G Ulrich; Reimar Johne; Matthias Koenig; Shahid Jameel; Tim J Harrison; Xiang-Jin Meng; Hiroaki Okamoto; Wim H M Van der Poel; Michael A Purdy
Journal:  J Gen Virol       Date:  2016-01-07       Impact factor: 3.891

5.  Identification of a new strain of hepatitis E virus from an outbreak in Namibia in 1995.

Authors:  Hazel T Maila; Sheila M Bowyer; Robert Swanepoel
Journal:  J Gen Virol       Date:  2004-01       Impact factor: 3.891

6.  Molecular cloning and sequencing of the Mexico isolate of hepatitis E virus (HEV).

Authors:  C C Huang; D Nguyen; J Fernandez; K Y Yun; K E Fry; D W Bradley; A W Tam; G R Reyes
Journal:  Virology       Date:  1992-12       Impact factor: 3.616

7.  Chronic Infection With Camelid Hepatitis E Virus in a Liver Transplant Recipient Who Regularly Consumes Camel Meat and Milk.

Authors:  Guan-Huei Lee; Boon-Huan Tan; Esmeralda Chi-Yuan Teo; Seng-Gee Lim; Yock-Young Dan; Aileen Wee; Pauline Poh Kim Aw; Yuan Zhu; Martin Lloyd Hibberd; Chee-Kiat Tan; Michael A Purdy; Chong-Gee Teo
Journal:  Gastroenterology       Date:  2015-11-06       Impact factor: 22.682

8.  A Single Lineage of Hepatitis E Virus Causes Both  Outbreaks and Sporadic Hepatitis in Sudan.

Authors:  Adel Hussein Elduma; Mai Mohammed Adam Zein; Marie Karlsson; Isam M E Elkhidir; Heléne Norder
Journal:  Viruses       Date:  2016-10-06       Impact factor: 5.048

9.  Hepatitis E, Central African Republic.

Authors:  Josep M Escribà; Emmanuel Nakoune; Carlos Recio; Péguy-Martial Massamba; Marcelle Diane Matsika-Claquin; Charles Goumba; Angela M C Rose; Elisabeth Nicand; Elsa García; Cornelia Leklegban; Boniface Koffi
Journal:  Emerg Infect Dis       Date:  2008-04       Impact factor: 6.883

10.  ICTV Virus Taxonomy Profile: Hepeviridae.

Authors:  Michael A Purdy; Tim J Harrison; S Jameel; X-J Meng; H Okamoto; W H M Van der Poel; Donald B Smith
Journal:  J Gen Virol       Date:  2017-10-12       Impact factor: 3.891

View more
  12 in total

1.  Two mutations in the ORF1 of genotype 1 hepatitis E virus enhance virus replication and may associate with fulminant hepatic failure.

Authors:  Bo Wang; Debin Tian; Harini Sooryanarain; Hassan M Mahsoub; C Lynn Heffron; Anna M Hassebroek; Xiang-Jin Meng
Journal:  Proc Natl Acad Sci U S A       Date:  2022-08-15       Impact factor: 12.779

2.  Update: proposed reference sequences for subtypes of hepatitis E virus (species Orthohepevirus A).

Authors:  Donald B Smith; Jacques Izopet; Florence Nicot; Peter Simmonds; Shahid Jameel; Xiang-Jin Meng; Heléne Norder; Hiroaki Okamoto; Wim H M van der Poel; Gábor Reuter; Michael A Purdy
Journal:  J Gen Virol       Date:  2020-07       Impact factor: 3.891

3.  Hepatitis E virus infection in high-risk populations in Osun State, Nigeria.

Authors:  Folakemi Abiodun Osundare; Patrycja Klink; Olusola Aanuoluwapo Akanbi; Bo Wang; Dominik Harms; Olusola Ojurongbe; Moses Adedapo Ajayi; Emmanuel Oluwagbenga Babaranti; C-Thomas Bock; Oladele Oluyinka Opaleye
Journal:  One Health       Date:  2021-04-28

Review 4.  The Current Host Range of Hepatitis E Viruses.

Authors:  Scott P Kenney
Journal:  Viruses       Date:  2019-05-17       Impact factor: 5.048

Review 5.  Hepatitis E Virus Drug Development.

Authors:  Volker Kinast; Thomas L Burkard; Daniel Todt; Eike Steinmann
Journal:  Viruses       Date:  2019-05-28       Impact factor: 5.048

6.  Hepatitis E Virus Infections among Patients with Acute Febrile Jaundice in Burkina Faso.

Authors:  Chloé Dimeglio; Dramane Kania; Judith Mbombi Mantono; Thérèse Kagoné; Sylvie Zida; Souleymane Tassembedo; Amadou Dicko; Bachirou Tinto; Seydou Yaro; Hervé Hien; Jérémi Rouamba; Brice Bicaba; Isaïe Medah; Nicolas Meda; Oumar Traoré; Edouard Tuaillon; Florence Abravanel; Jacques Izopet
Journal:  Viruses       Date:  2019-06-14       Impact factor: 5.048

Review 7.  Mode and tempo of human hepatitis virus evolution.

Authors:  Rachele Cagliani; Diego Forni; Manuela Sironi
Journal:  Comput Struct Biotechnol J       Date:  2019-10-25       Impact factor: 7.271

Review 8.  Advances in Hepatitis E Virus Biology and Pathogenesis.

Authors:  Shaoli Lin; Yan-Jin Zhang
Journal:  Viruses       Date:  2021-02-09       Impact factor: 5.048

9.  Identification of a Putative Novel Genotype of Avian Hepatitis E Virus from Apparently Healthy Chickens in Southwestern Nigeria.

Authors:  Fisayo Temilade Osamudiamen; Olusola Aanuoluwapo Akanbi; Steffen Zander; Daniel Oladimeji Oluwayelu; Claus-Thomas Bock; Patrycja Klink
Journal:  Viruses       Date:  2021-05-21       Impact factor: 5.048

10.  Hepatitis E virus outbreak associated with rainfall in the Central African Republic in 2008-2009.

Authors:  Vianney Tricou; Julie Bouscaillou; Gina-Laure Laghoe-Nguembe; Aubin Béré; Xavier Konamna; Benjamin Sélékon; Emmanuel Nakouné; Mirdad Kazanji; Narcisse P Komas
Journal:  BMC Infect Dis       Date:  2020-04-03       Impact factor: 3.090

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.