Literature DB >> 28222808

Detection and genome characterization of four novel bat hepadnaviruses and a hepevirus in China.

Bo Wang1,2, Xing-Lou Yang1, Wen Li1, Yan Zhu1, Xing-Yi Ge1, Li-Biao Zhang3, Yun-Zhi Zhang4, Claus-Thomas Bock2, Zheng-Li Shi5.   

Abstract

BACKGROUND: In recent years, novel hepadnaviruses, hepeviruses, hepatoviruses, and hepaciviruses have been discovered in various species of bat around the world, indicating that bats may act as natural reservoirs for these hepatitis viruses. In order to further assess the distribution of hepatitis viruses in bat populations in China, we tested the presence of these hepatitis viruses in our archived bat liver samples that originated from several bat species and various geographical regions in China.
METHODS: A total of 78 bat liver samples (involving two families, five genera, and 17 species of bat) were examined using nested or heminested reverse transcription PCR (RT-PCR) with degenerate primers. Full-length genomic sequences of two virus strains were sequenced followed by phylogenetic analyses.
RESULTS: Four samples were positive for hepadnavirus, only one was positive for hepevirus, and none of the samples were positive for hepatovirus or hepacivirus. The hepadnaviruses were discovered in the horseshoe bats, Rhinolophus sinicus and Rhinolophus affinis, and the hepevirus was found in the whiskered bat Myotis davidii. The full-length genomic sequences were determined for one of the two hepadnaviruses identified in R. sinicus (designated BtHBVRs3364) and the hepevirus (designated BtHEVMd2350). A sequence identity analysis indicated that BtHBVRs3364 had the highest degree of identity with a previously reported hepadnavirus from the roundleaf bat, Hipposideros pomona, from China, and BtHEVMd2350 had the highest degree of identity with a hepevirus found in the serotine bat, Eptesicus serotinus, from Germany, but it exhibited high levels of divergence at both the nucleotide and the amino acid levels.
CONCLUSIONS: This is the first study to report that the Chinese horseshoe bat and the Chinese whiskered bat have been found to carry novel hepadnaviruses and a novel hepevirus, respectively. The discovery of BtHBVRs3364 further supports the significance of host switches evolution while opposing the co-evolutionary theory associated with hepadnaviruses. According to the latest criterion of the International Committee on Taxonomy of Viruses (ICTV), we hypothesize that BtHEVMd2350 represents an independent genotype within the species Orthohepevirus D of the family Hepeviridae.

Entities:  

Keywords:  Bat; Genome characterization; Hepadnavirus; Hepevirus; Natural reservoir

Mesh:

Year:  2017        PMID: 28222808      PMCID: PMC5320732          DOI: 10.1186/s12985-017-0706-8

Source DB:  PubMed          Journal:  Virol J        ISSN: 1743-422X            Impact factor:   4.099


Background

Nearly 60% of emerging infectious diseases in humans are zoonotic, with up to 70% of them being found to originate from wildlife [1]. Bats have been identified as natural reservoirs of many viruses. Some of these viruses cause outbreaks of severe disease in humans [2], including the Ebola virus, the lyssavirus, the severe acute respiratory syndrome coronavirus, and henipaviruses [3]. Interestingly, these viruses rarely cause apparent clinical signs in bats [2]. Bats possess unique characteristics that may contribute to their ability to act as a major natural reservoir for viruses, including a high level of species diversity, a long lifespan, a high population density, and high levels of spatial mobility [4]. Previous studies mainly focused on bat-borne viruses that are transmitted via respiratory droplets [3]. However, in recent years, several hepatitis virus-related sequences, including those associated with hepadnaviruses, hepeviruses, hepatoviruses, and hepaciviruses, have been found in bats across the globe, indicating the importance of bats as the natural reservoirs of these viruses [5-9]. Hepatitis viruses include hepatitis viruses A, B, C, D, and E, which cause human hepatitis diseases. Hepatitis A virus (HAV) is classified as belonging to the genus Hepatovirus in the family Picornaviridae. Hepatitis B virus (HBV) is classified as belonging to the genus Orthohepadnavirus in the family Hepadnaviridae. Hepatitis C virus (HCV) is classified as belonging to the genus Hepacivirus in the family Flaviriridae. Hepatitis D virus (HDV) is considered to be a subviral satellite because it can only propagate in the presence of HBV. Hepatitis E virus (HEV) is classified as belonging to the genus Orthohepevirus in the family Hepeviridae. Hepatovirus-related sequences have been identified in 13 species of bat collected in North America, Europe, and Africa [5]. Hepadnavirus-related sequences have been discovered in five species of bat collected in Panama, Gabon, Myanmar, and China [6, 8–10]. Highly diverse hepacivirus-related sequences have been detected in 20 species of bat across the world [11]. Hepevirus-related sequences have been discovered in bats in Ghana, Panama, and Germany [7]. These results indicate that bats may be important reservoirs of these hepatitis viruses (Table 1).
Table 1

Hepatitis virus-like sequences detected in bats

Virus familyOrder: ChiropteraSampling site (s) (year)Isolation sourceGenomic sequenceReference
FamilyGeneraSpecies
HepatoviridaeEmballonuridae Coleura C. afra Ghana (2011), Gabon (2009)Feces, bloodFull[5]
Pteropodidae Eidolon E. helvum Ghana (2010/2011)BloodFull
Natalidae Natalus N. lanatus Costa Rica (2010)FecesFull
Rhinolophidae Rhinolophus R. landeri Ghana (2011)FecesFull
R. ferrumequinum Romania (2008/2009), Bulgaria (2008/2009), Luxemburg (2011)FecesFull
Rhinolophus R. hipposideros Bulgaria (2008/2009), Spain (2010)FecesFull
Vespertilionidae Glauconycteris G. spec. Côte d’Ivoire (2013)IntestinesFull
Miniopterus M. cf. manavi Madagascar (2014)LiverFull
M. schreibersii Romania (2008)FecesFull
Myotis M. dasycneme Germany (2008)FecesFull
M. myotis Romania (2008), Germany (2008/2010)FecesFull
Nyctalus N. noctula Romania (2008/2009), Germany (2009)FecesFull
Pipistrellus P. kuhlii Ukraine (2010/2011)FecesFull
HepadnaviridaeVespertilionidae Miniopterus Miniopterus spp. Myanmar (2010)LiverFull[8]
Hipposideridae Hipposideros H. pomona China (2011)LiverFull[9]
H. cf. ruber Gabon (2009)BloodFull[6]
Phyllostomidae Uroderma U. bilobatum Panama (2010/2011)BloodFull
Rhinolophidae Rhinolophus R. alcyone Gabon (2009)BloodFull
R. sinicus China (2012) Liver Full This study
R. affinis China (2013) Liver Partial
HepaciviridaeEmballonuridae Taphozous Not identifiedCameroon (2010)BloodPartial[11]
Hipposideridae Hipposideros H. vittatus Kenya (2010)BloodFull
H. gigas Nigeria (2008/2010)BloodPartial
Molossidae Chaerephon Not identifiedCameroon (2010), Kenya (2010)BloodPartial
Mops M. condylurus DRC (2011)BloodFull
Otomops O. martiensseni Kenya (2010)BloodFull
Nyctinomops N. macrotis Mexico (2011)BloodPartial
Phyllostomidae Artibeus A. watsoni Mexico (2011)BloodPartial
Carollia C. perspicillata Guatemala (2010), Mexico (2011)BloodFull
Desmodus D. rotundus Guatemala (2010),BloodPartial
Glossophaga G. commissarisi Mexico (2011)BloodPartial
Sturnira S. lilium Guatemala (2010)BloodFull
S. ludovici Mexico (2011)BloodPartial
Trachops T. cirrhosus Mexico (2011)BloodPartial
Pteropodidae Eidolon E. helvum Cameroon (2010), DRC (2011)BloodFull
Epomophorus E. labiatus Kenya (2010)BloodPartial
Megaloglossus M. woermanni DRC (2011)BloodFull
Rousettus R. aegyptiacus Kenya (2010), Nigeria (2008/2010)BloodFull
Vespertilionidae Scotoecus Not identifiedKenya (2010)BloodPartial
Scotophilus S. dingani Kenya (2010)BloodFull
S. nigrita Nigeria (2008/2010)BloodPartial
UnknownNigeria (2008/2010), Mexico (2010/2011)BloodPartial
HepeviridaeHipposideridaeHipposideros H. abae Ghana (2009)FecesPartial[7]
PhyllostomidaeVampyrodes V. caraccioli Panama (2011)BloodPartial
VespertilionidaeEptesicus E. serotinus Germany (2008)LiverFull
MyotisMyotis M. bechsteinii Germany (2008)FecesPartial
M. daubentonii Germany (2008)FecesPartial
M. davidii China (2011) Liver Full This study

DRC Democratic Republic of the Congo

Hepatitis virus-like sequences detected in bats DRC Democratic Republic of the Congo There are around 120 species of bat in China; however, only limited information has been reported regarding the hepatitis viruses, a novel Orthohepadnavirus in pomona roundleaf bats from Yunnan province was identified in 2015 [9]. In this study, we report the discovery of four novel hepadnaviruses and a hepevirus in our archived bat liver samples that had been collected from several bat species and various geographical regions in China.

Methods

Samples

A total of 78 liver tissue samples were collected from dead bats caused by accident during sampling, which comprised two families, five genera, and 17 species, and used for virus screening (Table 2). Different tissues (heart, liver, spleen, lung, kidney, brain and intestine) were collected separately and used for analyzing virus tissue tropism. The animals were firstly identified based on their morphology and then the species that they belonged to were further confirmed using DNA sequencing of the mitochondrial cytochrome b (CytB) gene following previously described methods [12].
Table 2

Detection of hepadnavirus and hepevirus in bats in China between 2008 and 2013

FamilyGenusSpeciesNo. of samplesNo. of hepadnavirus positive samplesNo. of hepevirus positive samplesSampling site (s) (year)
Vespertilionidae Myotis M. adversus 4Yunnan (2008)
M. pilosus 7Yunnan (2008)
M. chinensis 1Hubei (2008)
M. davidii 121 Hubei (2011), Yunnan (2011)
M. ikonnikovi 3Yunan (2009), Hubei (2011)
M. formosus 1Yunnan (2011)
Miniopterus M. fuliginosus 1Henan (2010)
Aselliscus A. stoliczkanus 1Yunnan (2012)
Rhinolophidae Rhinolophus R. sinicus 192Hubei (2008/2011), Sichuan (2011), Yunnan (2009/2012/2013)
R. monoceros 3Hubei (2011), Chongqing (2011)
R. affinis 72Henan (2010), Hubei (2011) Yunnan (2012/2013),
R. pusillus 4Yunnan (2012/2013)
R. pearsonii 1Chongqing (2011)
Hipposideros H. pratti 2Hubei (2010)
H. armiger 4Sichuan (2011)
H. pomona 7Yunnan (2013)
H. larvatus 1Yunnan (2011)
Total5 genera17 species7841
Detection of hepadnavirus and hepevirus in bats in China between 2008 and 2013

RNA extraction and PCR

RNA was extracted from tissue using the QIAamp Viral RNA Mini Kit (Qiagen, Hilden, Germany) following manufacturer’s instructions, and cDNA was synthesized using Moloney Murine Leukemia Virus (M-MLV) Reverse Transcriptase (Promega, Madison, WI, USA). The extracted RNA from liver was tested by nested or heminested reverse transcription PCR (RT-PCR) using degenerate primers based on the conserved domain of the RNA-dependent RNA polymerase (RdRp) gene of viruses in the genus Hepatovirus, the polymerase gene of viruses in the family Hepadnaviridae, the RdRp gene of viruses in the genus Hepacivirus [11], and the RdRp gene of viruses in the family Hepeviridae [7] (Table 3). Standard precautions were taken to avoid contamination of the PCR procedure, and no false-positives were observed in the negative controls. The PCR products underwent gel purification with MinElute Gel Extraction Kit (Qiagen, Germany) and they were sequenced with both forward and reverse primers using the 3100 Sequencer (ABI, Waltham, MA, USA).
Table 3

Primers used for virus RT-PCR screening and virus quantification

PrimerSequence (5′-3′)a PolarityTargeted virusReference
HAV-3D-F1CYTATHTRAARGATGAGCTKAGA+HepatovirusThis study
HAV-3D-F2ACRTCATCICCRTARCAIAGRA+
HAV-3D-R1RTCIAARACWAGRGCNATYG-
HAV-3D-R2TACCWAATCATRAATGGACT-
HBV-pol-F1TAGACTSGTGGTGGACTTCTC+HepadnavirusThis study
HBV-pol-F2AGTRAAYTGAGCCAGGAGAAAC+
HBV-pol-R1TGCCATCTTCTTGTTGGTTC-
HBV-pol-R1CATATAASTRAAAGCCAYACAG-
BHV-1-F1GTAGCGGAGAAGATGTATCTGGG+Hepacivirus[11]
BHV-1-R1GCCTTAGCCTTGAGAAAGCAGGTGAT+
BHV-1-F2GAGAAGATGTATCTGGGGGACGT+
BHV-1-R2AGAAAGCAGGTGATGGTATTGCC+
BHV-2-F1CCAAARGTWGTBAAGGCTGTGCT-
BHV-2-R1ACTTTGAKCCASGCAGTKARACAGTT-
BHV-2-F2GCTGTGCTSAAGGAMGAGTACGGCT+
BHV-2-R2CCASGCAGTKARACAGTTACTRGAG-
DE-F4228ACYTTYTGTGCYYTITTTGGTCCITGGTT+Hepevirus[7]
DE-R4598GCCATGTTCCAGAYGGTGTTCCA-
DE-R4565CCGGGTTCRCCIGAGTGTTTCTTCCA-
BtHEV-qFATGTCCGTGTTCAGGTTCC+Bat hepevirusThis study
BtHEV-qRGCCAACCCTCATTTGCAAC-
BtHBV-qFTGTTGGTTCTCCTGGATTGGAG+Bat hepadnavirusesThis study
BtHBV-qRTGAAGGAATGGGCCAGCAGGTG-

R: G/A; Y: C/T; S: G/C; W: A/T; M: A/C; K: G/T; H: A/C/T; N: A/T/C/G; I: inosine

Primers used for virus RT-PCR screening and virus quantification R: G/A; Y: C/T; S: G/C; W: A/T; M: A/C; K: G/T; H: A/C/T; N: A/T/C/G; I: inosine

Genomic sequencing

The complete genomic sequences of one hepadnavirus strain and one hepevirus strain were amplified using PCR with degenerate primers (the primers are available upon request). The genome ends were amplified using a 5′-Full RACE Kit (TaKaRa, Japan). The PCR products underwent gel purification with MinElute Gel Extraction Kit (Qiagen, Germany) and they were sequenced with both forward and reverse primers using the 3100 Sequencer. The sequencing chromatograms were inspected for overlapping multicolor peaks, which are an indicator of sequence heterogeneity in the amplicons. The PCR products were cloned using the pGEM-T Easy Vector System (Promega, Germany) and at least three clones for each PCR fragment were sequenced to obtain a consensus sequence.

Sequence analysis

The preliminary sequence management and analysis were carried out using Geneious version 9.1.3 (Biomatters Ltd., Auckland, New Zealand) and the sequence alignment and editing were performed using MAFFT [13]. The phylogenetic analysis of hepadnavirus used the neighbor-joining (NJ) method with Hasegawa-Kishino-Yano substitution model and complete deletion option and hepevirus used the maximum-likelihood (ML) method with the nucleotide percentage distance substitution matrix and the complete deletion option in MEGA version 7 [14]. The sequences and GenBank accession numbers of the representative viruses in the families Hepadnaviridae and Hepeviridae used in the phylogenetic analyses are presented in Figs. 1 and 2.
Fig. 1

Phylogenetic analysis of bat hepadnavirus based on the full-length genomic sequences. Maximum likelihood phylogenetic tree was constructed based on the complete genomes of BtHBVRs3364 (in bold) and representative members of the family Hepadnaviridae using the Hasegawa-Kishino-Yano substitution model and complete deletion option in MEGA version 7. The values at the nodes indicate the bootstrap values (using 1,000 replications). The branches are labeled with the strain designation, the host species, and the GenBank accession number. The classification of the family Hepadnaviridae is indicated on the right

Fig. 2

Phylogenetic analysis of bat hepevirus based on the full-length genomic sequences. Neighbor joining phylogenetic tree was constructed based on the alignment of the complete genomes of BtHEVMd2350 (in bold) and representative members of the family Hepeviridae using nucleotide percentage distance substitution matrix and complete deletion option implemented in MEGA version 7. The values at nodes indicate the bootstrap values (using 1,000 replications). The branches are labeled with the strain designation, the host species, and the GenBank accession number. The classification of the family Hepeviridae is indicated on the right

Phylogenetic analysis of bat hepadnavirus based on the full-length genomic sequences. Maximum likelihood phylogenetic tree was constructed based on the complete genomes of BtHBVRs3364 (in bold) and representative members of the family Hepadnaviridae using the Hasegawa-Kishino-Yano substitution model and complete deletion option in MEGA version 7. The values at the nodes indicate the bootstrap values (using 1,000 replications). The branches are labeled with the strain designation, the host species, and the GenBank accession number. The classification of the family Hepadnaviridae is indicated on the right Phylogenetic analysis of bat hepevirus based on the full-length genomic sequences. Neighbor joining phylogenetic tree was constructed based on the alignment of the complete genomes of BtHEVMd2350 (in bold) and representative members of the family Hepeviridae using nucleotide percentage distance substitution matrix and complete deletion option implemented in MEGA version 7. The values at nodes indicate the bootstrap values (using 1,000 replications). The branches are labeled with the strain designation, the host species, and the GenBank accession number. The classification of the family Hepeviridae is indicated on the right

Quantification real-time PCR

Virus load of bat hepevirus and hepadnaviruese of different tissues was measured by using photometrically quantified in vitro RNA transcripts and specific real-time RT-PCR primers (Table 3). Quantification was done by using 5 μL of RNA extract, 300 nM each primer, using the One Step SYBR PrimeScript™ PLUS RT-PCR Kit (TaKaRa, Japan). Cycling in a Biorad CFX Connect instrument involved the following steps: 42 °C for 5 min, 95 °C for 10 s, and 40 cycles of 95 °C 5 s and 60 °C 20 s with measurement of fluorescence.

Results

Detection of four hepadnaviruses and a hepevirus in bat liver samples

Among the 78 bat liver samples, four were positive for hepadnavirus from Jinning city, Yunnan province and only one was positive for hepevirus from Xianning city, Hubei province (Fig. 3). However, none were positive for hepatovirus or hepacivirus. The nucleotide sequences of the four novel hepadnaviruses and the hepevirus described in this study are available from GenBank under the accession numbers KX513949–KX513953.
Fig. 3

Representation map of China and Yunnan province. Circle indicates the sampling site where the hepevirus (BtHEVMd2350) was detected. Triangles indicates the sampling sites where the hepadnaviruses were detected

Representation map of China and Yunnan province. Circle indicates the sampling site where the hepevirus (BtHEVMd2350) was detected. Triangles indicates the sampling sites where the hepadnaviruses were detected

Sequence analysis of the bat hepadnavirus

All four of the hepadnavirus-positive samples were from horseshoe bats, two each from R. sinicus (designated BtHBVRs3364 and BtHBVRs3366) and R. affinis (designated BtHBVRa4325 and BtHBVRa4328) (Table 2). The four partial polymerase gene sequences had 92.1–97.5% nucleotide sequence identity and they were found to be closely related to the roundleaf bat hepadnavirus from Yunnan province, China, with nucleotide identities of 88.8–95.5% [9]. The full-length genomic sequence of a sample from R. sinicus (designated bat HBV Rs3364, or BtHBVRs3364) was determined and it was found to have a length of 3,272 nucleotides. The virus has an identical genomic organization to other hepadnaviruses, with four open reading frames (ORFs) encoding the surface (S), polymerase (P), core (C), and X proteins. In addition, the typical direct repeat (DR) sequences for viral genome replication and the secondary structure Ɛ–loops for viral reverse transcription were present in the BtHBVRs3364 genome. A detailed comparison of the full-length genomic sequence and the ORFs of the virus with other known hepadnaviruses is shown in Table 4. The results showed that the four genes of BtHBVRs3364 have the highest degree of identity with the roundleaf bat hepadnavirus from Yunnan province, at both the nucleotide and the amino acid levels [9]. Notably, we found large differences between BtHBVRs3364 and other hepadnaviruses from the African horseshoe and roundleaf bats, the long-fingered bat from Myanmar, and the tent-making bat from Panama.
Table 4

Nucleotide and amino acid sequence identity between BtHBVRs3364 and representative orthohepadnavirus strainsa

Hepadnavirus (no. of strains compared)Degree of identity (%)
Full genomeS gene (1–672)X gene (1217–1645)C gene (1657–2301)P gene (2147–1475)
NucleotidesNucleotidesAmino acidsNucleotidesAmino acidsNucleotidesAmino acidsNucleotidesAmino acids
Asian roundleaf bat hepadnavirus (3)81.2–81.990.5–93.983.5–90.286.775.485.2–85.391.2–91.780.1–80.977.4–77.9
African horseshoe bat hepadnavirus (1)72.289.084.878.865.575.277.971.865.9
African roundleaf bat hepadnavirus (4)72.0–72.189.0–89.286.281.8–82.170.4–71.176.9–77.177.972.3–72.465.6–66.0
Long-fingered bat hepadnavirus (3)69.0–69.279.7–80.167.469.2–70.249.3–51.474.2–74.575.6–76.068.1–68.361.5–61.8
Tent-making bat hepadnavirus (4)56.7–56.873.5–74.261.0–61.958.9–59.343.4–44.151.649.556.8–57.149.1–49.2
Primate HBV (15)59.5–61.176.5–77.865.0–66.862.1–64.946.5–52.161.0–67.963.0–66.557.0–59.750.2–52.0
Woolly monkey hepadnavirus (1)61.575.367.163.250.064.261.460.351.9
Ground squirrel hepadnavirus (2)64.0–65.178.7–78.867.9–68.360.6–63.945.1–46.571.1–71.470.9–74.058.9–59.149.3–50.2
Woodchuck hepadnavirus (1)59.877.967.463.947.269.872.558.850.9
Duck hepadnavirus (1)31.144.128.7NANA31.320.935.123.2

aThe sequences were aligned using MAFFT. The evolutionary analyses were conducted using MEGA version 7. The GenBank accession numbers are as follows: KF939648, KF939649, and KF939650 for the Asian roundleaf bat hepadnaviruses; KC790377 for the African horseshoe bat hepadnavirus; KC790374, KC790375, KC790373, and KC790376 for the African roundleaf bat hepadnaviruses; KC790378, KC790379, KC790380, and KC790381 for the Tent-making bat hepadnaviruses; AF160501, AY090454, X69798, AF193863, U46935, AB486012, AF305327, AB117758, D23678, AM282986, AF241409, AB205192, FJ349213, AB126581, and JN040752 for the Primate HBVs; AF046996 for the woolly monkey hepadnavirus; NC 001484 and U29144 for the ground squirrel hepadnaviruses; NC_004107 for the woodchuck hepadnavirus; and EU429324 for the duck hepadnaviruses. NA not available

Nucleotide and amino acid sequence identity between BtHBVRs3364 and representative orthohepadnavirus strainsa aThe sequences were aligned using MAFFT. The evolutionary analyses were conducted using MEGA version 7. The GenBank accession numbers are as follows: KF939648, KF939649, and KF939650 for the Asian roundleaf bat hepadnaviruses; KC790377 for the African horseshoe bat hepadnavirus; KC790374, KC790375, KC790373, and KC790376 for the African roundleaf bat hepadnaviruses; KC790378, KC790379, KC790380, and KC790381 for the Tent-making bat hepadnaviruses; AF160501, AY090454, X69798, AF193863, U46935, AB486012, AF305327, AB117758, D23678, AM282986, AF241409, AB205192, FJ349213, AB126581, and JN040752 for the Primate HBVs; AF046996 for the woolly monkey hepadnavirus; NC 001484 and U29144 for the ground squirrel hepadnaviruses; NC_004107 for the woodchuck hepadnavirus; and EU429324 for the duck hepadnaviruses. NA not available

Phylogenetic analysis of the bat hepadnavirus

A phylogenetic tree was constructed based on the alignment of the full-length genomic sequence of BtHBVRs3364 with those of representative hepadnavirus strains available in GenBank. As shown in Fig. 1, the previously reported bat hepadnaviruses formed three clusters, with clear specificities for particular hosts. Although BtHBVRs3364 clustered with the bat hepadnaviruses, it formed an independent branch. Interestingly, the BtHBVRs3364 detected in the horseshoe bat is phylogenetically closer to viruses from the Asian roundleaf bat compared to viruses from the African horseshoe bat, despite the fact that it was found in an Asian horseshoe bat.

Sequence analysis of the bat hepevirus

One sample found in the whiskered bat, M. davidii, from Hubei province was positive for hepevirus (designated bat HEV Md2350, or BtHEVMd2350). The genomic sequence of BtHEVMd2350 was found to have a length of 6,607 nucleotides (excluding the poly(A) tail at the 3′ end). This is slightly shorter than BS7 (which has a genomic sequence length of 6,671 nucleotides), the only reported bat hepevirus with a fully sequenced genome, which was identified from the serotine bat, Eptesicus serotinus, in Germany [7]. BtHEVMd2350 was found to have a 5′ untranslated region (UTR) of 33 nucleotides and a 3′ UTR of 76 nucleotides. The three unique ORFs that are found in other members of the family Hepeviridae were also found in BtHEVMd2350: ORF1 encodes a nonstructural polyprotein that includes the RdRp, ORF2 encodes the capsid protein, and ORF3 encodes a multifunctional protein. Notably, most of the elements and domains characterized in BS7 could be found in BtHEVMd2350, but with a high level of divergence (Table 5).
Table 5

Nucleotide and amino acid sequence identity between BtHEVMd2350 and representative hepevirus strainsa

Hepevirus (no. of strains compared)Degree of identity (%)
Full genomeORF1 (genome positions 56–4699)ORF2 (genome positions 4700–6607)ORF3 (genome positions 4779–5192)
NucleotidesNucleotidesAmino acidsNucleotidesAmino acidsNucleotidesAmino acids
Bat hepevirus (1)67.865.572.070.979.273.244.3
Avian hepevirus (4)50.9–51.748.2–49.044.3–44.546.0–47.344.4–44.919.9–21.15.3–6.1
HEV genotype 3 (22)44.6–46.043.4–45.539.1–40.947.4–49.944.6–47.430.7–31.814.8–18.9
HEV genotype 4 (5)45.2–46.044.9–45.940.4–41.047.5–48.245.8–47.130.0–31.614.6–16.3
HEV genotype 1 (3)45.6–45.945.0–45.540.5–41.148.7–49.346.6–46.931.9–32.617.1
HEV genotype 2 (1)45.645.340.849.747.131.617.1
Rodent hepevirus (3)44.0–44.445.9–46.141.6–42.047.9–48.445.4–46.725.2–27.49.0
Ferret hepevirus (1)44.046.442.648.346.025.58.0–12.8
Trout hepevirus (1)33.734.924.530.215.521.19.8

aThe sequences were aligned using MAFFT. The evolutionary analyses were conducted using MEGA version 7. The GenBank accession numbers are as follows: JQ001749 for the bat hepevirus; AM943646, AM943647, KF511797, and AY535004 for the avian hepeviruses; AB189070, AB189075, AP003430, AB091394, AB222183, AB073912, AY115488, AF060669, AF082843, HQ389544, JN564006, AB290312, FJ998008, FJ705359, KC618402, AF455784, AB248521, EU360977, EU495148, FJ956757, FJ906895, and JQ013793 for the HEVs genotype 3; AB856243, AB602440, AB161717, AJ272108, and EU366959 for the HEVs genotype 4; AY230202, AF076239, and M80581 for the HEVs genotype 1; M74506 for HEV genotype 2; GU345042, AB847306, and JX120573 for the rodent hepeviruses; JN998607 for the ferret hepevirus; and NC_015521 for the trout hepevirus

Nucleotide and amino acid sequence identity between BtHEVMd2350 and representative hepevirus strainsa aThe sequences were aligned using MAFFT. The evolutionary analyses were conducted using MEGA version 7. The GenBank accession numbers are as follows: JQ001749 for the bat hepevirus; AM943646, AM943647, KF511797, and AY535004 for the avian hepeviruses; AB189070, AB189075, AP003430, AB091394, AB222183, AB073912, AY115488, AF060669, AF082843, HQ389544, JN564006, AB290312, FJ998008, FJ705359, KC618402, AF455784, AB248521, EU360977, EU495148, FJ956757, FJ906895, and JQ013793 for the HEVs genotype 3; AB856243, AB602440, AB161717, AJ272108, and EU366959 for the HEVs genotype 4; AY230202, AF076239, and M80581 for the HEVs genotype 1; M74506 for HEV genotype 2; GU345042, AB847306, and JX120573 for the rodent hepeviruses; JN998607 for the ferret hepevirus; and NC_015521 for the trout hepevirus

Phylogenetic analysis of the bat hepevirus

A phylogenetic tree was constructed based on the alignment of the full-length genomic sequence of BtHEVMd2350 with those of representative full-length hepevirus genomic sequences (Fig. 2). The results showed that bat hepeviruses (BtHEVMd2350 and BS7) cluster into a separate monophyletic clade within the family Hepeviridae.

Quantification of novel viruses

Viral load detected by qPCR in different tissues were presented in the Fig. 4. The highest viral load of the BtHEVMd2350 was found in the liver (1.9 × 1010 RNA copies per gram of tissue) and followed by spleen (7.3 × 108 RNA copies per gram of tissue), intestine and kidney, but not detectable in the brain. For bat hepadnavirus, the highest viral load was found in the liver of BtHBVRs3364 (2.0 × 1010 RNA copies per gram of tissue), the virus load of tissues of BtHBVRs3366, BtHBVRa4325, and BtHBVRa4328 were relatively similar (medien, 6.2 × 106 RNA copies per gram of tissue; range, 4.9 × 105 to 2.7 × 1010 RNA copies per gram of tissue).
Fig. 4

Tissue distribution of bat hepevirus and hepadnaviruses. Virus concentrations assessed by virus-specific one-step real-time RT-PCR using quantified in vitro-transcribed RNA controls

Tissue distribution of bat hepevirus and hepadnaviruses. Virus concentrations assessed by virus-specific one-step real-time RT-PCR using quantified in vitro-transcribed RNA controls

Conclusions and discussion

Since the discovery of genetically diverse hepatitis virus-related sequences in bats, bats have been considered to be important natural reservoirs for hepatitis viruses, and potential sources of human diseases [10]. However, these hypotheses need to be proved by screening more bat samples from across the globe for hepatitis viruses. In this study, we screened for hepatitis viruses in bats from China and discovered four novel hepadnaviruses circulating in two species of horseshoe bat in Jinning city, Yunnan province and one hepevirus in the whiskered bat M. davidii in Xianning city, Hubei province. The full-length genomic sequences of one of the two hepadnaviruses from R. sinicus and the hepevirus from M. davidii were determined. The phylogenetic analysis indicates that the bat hepadnavirus found in this study is closely related to roundleaf bat hepadnaviruses, which were discovered in Pu’er city, Yunnan province in 2011 [9], but shows remarkable divergence when compared to the African horseshoe bat, despite the fact that it was found in an Asian horseshoe bat. A similar phylogenetic relationship was found between hepadnaviruses from the African roundleaf bat and the African horseshoe bat [6], indicating the separate evolution of these viruses and their hosts. Regarding the bat hepevirus, the phylogenetic analysis indicates that the known bat hepeviruses are highly divergent from other mammalian hepeviruses and that they form an independent branch in the family Hepeviridae. According to the latest proposal of the ICTV in 2016, amino acid distances of concatenated ORF1 and ORF2 (lacking hypervariable regions) greater than 0.088 could then act as threshold to demarcate intra- and inter- genotype distances [15]. The hepevirus detected in the whiskered bat, M. davidii, and that found in the German serotine bat, E. serotinus (the only reported bat hepevirus with a full-length genome) shared significant diversity from both nucleotide and amino acid levels, we propose that they can be grouped into the species Orthohepevirus D which is divided into two genotypes: D1 and D2. Our results provide further evidence to support the theory regarding the long-term co-evolution of hepadnaviruses and hepeviruses with their hosts, and the theory that bats act as major natural reservoirs for these hepatitis viruses. Our results have limitations due to the small sample size used, which was a result of the protection of bat populations in China, as bats play important roles in the pollination of plants and in pest control, as they feed on insects. However, based on our discovery of hepatitis viruses in bats, it is expected that there are many more hepatitis viruses circulating in numerous bat species and in various geographic regions. In order to obtain larger sample sizes, non-invasive methods of virus detection should be considered for future studies.
  15 in total

1.  MAFFT: a novel method for rapid multiple sequence alignment based on fast Fourier transform.

Authors:  Kazutaka Katoh; Kazuharu Misawa; Kei-ichi Kuma; Takashi Miyata
Journal:  Nucleic Acids Res       Date:  2002-07-15       Impact factor: 16.971

Review 2.  Bats: important reservoir hosts of emerging viruses.

Authors:  Charles H Calisher; James E Childs; Hume E Field; Kathryn V Holmes; Tony Schountz
Journal:  Clin Microbiol Rev       Date:  2006-07       Impact factor: 26.132

3.  Consensus proposals for classification of the family Hepeviridae.

Authors:  Donald B Smith; Peter Simmonds; Shahid Jameel; Suzanne U Emerson; Tim J Harrison; Xiang-Jin Meng; Hiroaki Okamoto; Wim H M Van der Poel; Michael A Purdy
Journal:  J Gen Virol       Date:  2015-05       Impact factor: 3.891

4.  MEGA7: Molecular Evolutionary Genetics Analysis Version 7.0 for Bigger Datasets.

Authors:  Sudhir Kumar; Glen Stecher; Koichiro Tamura
Journal:  Mol Biol Evol       Date:  2016-03-22       Impact factor: 16.240

5.  Emerging diseases in Chiroptera: why bats?

Authors:  Gudrun Wibbelt; Marianne S Moore; Tony Schountz; Christian C Voigt
Journal:  Biol Lett       Date:  2010-04-28       Impact factor: 3.703

6.  Bats worldwide carry hepatitis E virus-related viruses that form a putative novel genus within the family Hepeviridae.

Authors:  Jan Felix Drexler; Annika Seelen; Victor Max Corman; Adriana Fumie Tateno; Veronika Cottontail; Rodrigo Melim Zerbinati; Florian Gloza-Rausch; Stefan M Klose; Yaw Adu-Sarkodie; Samuel K Oppong; Elisabeth K V Kalko; Andreas Osterman; Andrea Rasche; Alexander Adam; Marcel A Müller; Rainer G Ulrich; Eric M Leroy; Alexander N Lukashev; Christian Drosten
Journal:  J Virol       Date:  2012-06-13       Impact factor: 5.103

7.  Evolutionary origins of hepatitis A virus in small mammals.

Authors:  Jan Felix Drexler; Victor M Corman; Alexander N Lukashev; Judith M A van den Brand; Anatoly P Gmyl; Sebastian Brünink; Andrea Rasche; Nicole Seggewiβ; Hui Feng; Lonneke M Leijten; Peter Vallo; Thijs Kuiken; Andreas Dotzauer; Rainer G Ulrich; Stanley M Lemon; Christian Drosten
Journal:  Proc Natl Acad Sci U S A       Date:  2015-11-02       Impact factor: 11.205

8.  Bats are a major natural reservoir for hepaciviruses and pegiviruses.

Authors:  Phenix-Lan Quan; Cadhla Firth; Juliette M Conte; Simon H Williams; Carlos M Zambrana-Torrelio; Simon J Anthony; James A Ellison; Amy T Gilbert; Ivan V Kuzmin; Michael Niezgoda; Modupe O V Osinubi; Sergio Recuenco; Wanda Markotter; Robert F Breiman; Lems Kalemba; Jean Malekani; Kim A Lindblade; Melinda K Rostal; Rafael Ojeda-Flores; Gerardo Suzan; Lora B Davis; Dianna M Blau; Albert B Ogunkoya; Danilo A Alvarez Castillo; David Moran; Sali Ngam; Dudu Akaibe; Bernard Agwanda; Thomas Briese; Jonathan H Epstein; Peter Daszak; Charles E Rupprecht; Edward C Holmes; W Ian Lipkin
Journal:  Proc Natl Acad Sci U S A       Date:  2013-04-22       Impact factor: 11.205

9.  Isolation and characterization of a bat SARS-like coronavirus that uses the ACE2 receptor.

Authors:  Xing-Yi Ge; Jia-Lu Li; Xing-Lou Yang; Aleksei A Chmura; Guangjian Zhu; Jonathan H Epstein; Jonna K Mazet; Ben Hu; Wei Zhang; Cheng Peng; Yu-Ji Zhang; Chu-Ming Luo; Bing Tan; Ning Wang; Yan Zhu; Gary Crameri; Shu-Yi Zhang; Lin-Fa Wang; Peter Daszak; Zheng-Li Shi
Journal:  Nature       Date:  2013-10-30       Impact factor: 49.962

Review 10.  Emerging infectious diseases associated with bat viruses.

Authors:  ZhengLi Shi
Journal:  Sci China Life Sci       Date:  2013-08-07       Impact factor: 6.038

View more
  31 in total

1.  Diverse RNA viruses of arthropod origin in the blood of fruit bats suggest a link between bat and arthropod viromes.

Authors:  Andrew J Bennett; Trenton Bushmaker; Kenneth Cameron; Alain Ondzie; Fabien R Niama; Henri-Joseph Parra; Jean-Vivien Mombouli; Sarah H Olson; Vincent J Munster; Tony L Goldberg
Journal:  Virology       Date:  2018-12-18       Impact factor: 3.616

2.  Comprehensive Molecular Approach for Characterization of Hepatitis E Virus Genotype 3 Variants.

Authors:  Bo Wang; Dominik Harms; C Patrick Papp; Sandra Niendorf; Sonja Jacobsen; Marc Lütgehetmann; Sven Pischke; Heiner Wedermeyer; Jörg Hofmann; C-Thomas Bock
Journal:  J Clin Microbiol       Date:  2018-04-25       Impact factor: 5.948

3.  Chevrier's Field Mouse (Apodemus chevrieri) and Père David's Vole (Eothenomys melanogaster) in China Carry Orthohepeviruses that form Two Putative Novel Genotypes Within the Species Orthohepevirus C.

Authors:  Bo Wang; Wen Li; Ji-Hua Zhou; Bei Li; Wei Zhang; Wei-Hong Yang; Hong Pan; Li-Xia Wang; C Thomas Bock; Zheng-Li Shi; Yun-Zhi Zhang; Xing-Lou Yang
Journal:  Virol Sin       Date:  2018-03-02       Impact factor: 4.327

4.  Evolution of Hepatitis B Virus Receptor NTCP Reveals Differential Pathogenicities and Species Specificities of Hepadnaviruses in Primates, Rodents, and Bats.

Authors:  Lucie Etienne; Dominique Pontier; Stéphanie Jacquet; Jean-Baptiste Pons; Ariel De Bernardo; Barthélémy Ngoubangoye; François-Loic Cosset; Corinne Régis
Journal:  J Virol       Date:  2019-02-19       Impact factor: 5.103

5.  Roles of the 5' Untranslated Region of Nonprimate Hepacivirus in Translation Initiation and Viral Replication.

Authors:  Tomohisa Tanaka; Teruhime Otoguro; Atsuya Yamashita; Hirotake Kasai; Takasuke Fukuhara; Yoshiharu Matsuura; Kohji Moriishi
Journal:  J Virol       Date:  2018-03-14       Impact factor: 5.103

6.  Identification of a Novel Hepatitis E Virus Genotype 3 Strain Isolated from a Chronic Hepatitis E Virus Infection in a Kidney Transplant Recipient in Switzerland.

Authors:  Bo Wang; Dominik Harms; Jörg Hofmann; Diana Ciardo; Agnes Kneubühl; C-Thomas Bock
Journal:  Genome Announc       Date:  2017-05-18

7.  Detection and Characterization of Homologues of Human Hepatitis Viruses and Pegiviruses in Rodents and Bats in Vietnam.

Authors:  Dung Van Nguyen; Cuong Van Nguyen; David Bonsall; Tue Tri Ngo; Juan Carrique-Mas; Anh Hong Pham; Juliet E Bryant; Guy Thwaites; Stephen Baker; Mark Woolhouse; Peter Simmonds
Journal:  Viruses       Date:  2018-02-28       Impact factor: 5.048

8.  Genomic Characterization of a Novel Hepatovirus from Great Roundleaf Bats in China.

Authors:  Wen Li; Bo Wang; Bei Li; Wei Zhang; Yan Zhu; Zheng-Li Shi; Xing-Lou Yang
Journal:  Virol Sin       Date:  2018-02-19       Impact factor: 4.327

9.  Metagenomic analysis of fecal and tissue samples from 18 endemic bat species in Switzerland revealed a diverse virus composition including potentially zoonotic viruses.

Authors:  Isabelle Hardmeier; Nadja Aeberhard; Weihong Qi; Katja Schoenbaechler; Hubert Kraettli; Jean-Michel Hatt; Cornel Fraefel; Jakub Kubacki
Journal:  PLoS One       Date:  2021-06-16       Impact factor: 3.240

10.  A Novel Hepadnavirus Identified in an Immunocompromised Domestic Cat in Australia.

Authors:  Mahdis Aghazadeh; Mang Shi; Vanessa R Barrs; Alicia J McLuckie; Scott A Lindsay; Barbara Jameson; Bronte Hampson; Edward C Holmes; Julia A Beatty
Journal:  Viruses       Date:  2018-05-17       Impact factor: 5.048

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.