D Bosc1,2, L Vezenkov1,3, S Bortnik4,5, J An4, J Xu4,6, C Choutka4,6, A M Hannigan4, S Kovacic1, S Loo1, P G K Clark1, G Chen1, R N Guay-Ross1, K Yang4,6, W H Dragowska7, F Zhang8, N E Go4, A Leung4, N S Honson9, T A Pfeifer9, M Gleave8, M Bally7, S J Jones4,5,6, S M Gorski10,11,12, R N Young13. 1. Department of Chemistry, Simon Fraser University, Burnaby, BC, V5A 1S6, Canada. 2. Inserm, Institut Pasteur de Lille, U1177 Drugs & Molecules for Living Systems, Université de Lille, F-59000, Lille, France. 3. Institut des Biomolécules Max Mousseron (IBMM), UMR 5247 CNRS, Université de Montpellier, ENSCM, Faculté de Pharmacie, 15 avenue Charles Flahault, 34093, Montpellier, France. 4. Canada's Michael Smith Genome Sciences Centre, BC Cancer Agency, Vancouver, BC, V5Z 4E6, Canada. 5. Interdisciplinary Oncology Program, University of British Columbia, Vancouver, Canada. 6. Department of Molecular Biology and Biochemistry, Simon Fraser University, Burnaby, BC, V5A 1S6, Canada. 7. Experimental Therapeutics, BC Cancer Agency, Vancouver, BC, V5Z 4E6, Canada. 8. Department of Urologic Sciences and Vancouver Prostate Centre, University of British Columbia, Vancouver, BC, V6H 3Z6, Canada. 9. Centre for Drug Research and Development, 2405 Wesbrook Mall - 4th Floor, Vancouver, BC, V6T 1Z3, Canada. 10. Canada's Michael Smith Genome Sciences Centre, BC Cancer Agency, Vancouver, BC, V5Z 4E6, Canada. sgorski@bcgsc.ca. 11. Interdisciplinary Oncology Program, University of British Columbia, Vancouver, Canada. sgorski@bcgsc.ca. 12. Department of Molecular Biology and Biochemistry, Simon Fraser University, Burnaby, BC, V5A 1S6, Canada. sgorski@bcgsc.ca. 13. Department of Chemistry, Simon Fraser University, Burnaby, BC, V5A 1S6, Canada. robert_young@sfu.ca.
Abstract
The cysteine protease ATG4B is a key component of the autophagy machinery, acting to proteolytically prime and recycle its substrate MAP1LC3B. The roles of ATG4B in cancer and other diseases appear to be context dependent but are still not well understood. To help further explore ATG4B functions and potential therapeutic applications, we employed a chemical biology approach to identify ATG4B inhibitors. Here, we describe the discovery of 4-28, a styrylquinoline identified by a combined computational modeling, in silico screening, high content cell-based screening and biochemical assay approach. A structure-activity relationship study led to the development of a more stable and potent compound LV-320. We demonstrated that LV-320 inhibits ATG4B enzymatic activity, blocks autophagic flux in cells, and is stable, non-toxic and active in vivo. These findings suggest that LV-320 will serve as a relevant chemical tool to study the various roles of ATG4B in cancer and other contexts.
The cysteine protease ATG4B is a key component of the autophagy machinery, acting to proteolytically prime and recycle its substrate MAP1LC3B. The roles of ATG4B in cancer and other diseases appear to be context dependent but are still not well understood. To help further explore ATG4B functions and potential therapeutic applications, we employed a chemical biology approach to identify ATG4B inhibitors. Here, we describe the discovery of 4-28, a styrylquinoline identified by a combined computational modeling, in silico screening, high content cell-based screening and biochemical assay approach. A structure-activity relationship study led to the development of a more stable and potent compound LV-320. We demonstrated that LV-320 inhibits ATG4B enzymatic activity, blocks autophagic flux in cells, and is stable, non-toxic and active in vivo. These findings suggest that LV-320 will serve as a relevant chemical tool to study the various roles of ATG4B in cancer and other contexts.
Autophagy has been associated with numerous disorders including neurodegenerative diseases, metabolic diseases, cardiovascular diseases, infectious diseases and cancer[1-3], resulting in subsequent efforts to discover and develop target-selective and potent modulators of the autophagy process[3-9]. Although several autophagy modulators, both activators and inhibitors, have been described in the literature, few of them possess good pharmacokinetic properties, specificity and potency (reviewed in Triola and Vakifahmetoglu-Norberg)[10,11]. Chloroquine and other lysosomal inhibitors[12] have shown utility in many disease models and spurred the initiation of numerous cancer clinical trials[13]. While lysosomal inhibitors may prove useful in some contexts, their effects are at least partially autophagy-independent[14], leaving autophagy-related (ATG) protein inhibitors still largely unexplored.ATG4B is an autophagy protein of interest as a potential therapeutic target due to its roles in autophagosome formation and maturation[15-17]. Proteolytic cleavage by ATG4B of the cytoplasmic pro-microtubule-associated-protein 1 light chain 3B (pro-MAP1LC3B or pro-LC3B) generates LC3B-I that displays a C-terminal glycine. With mediation by ATG7, ATG3 and the ATG5-ATG12 complex, this glycine is then lipidated with phosphatidylethanolamine generating LC3B-II. The conjugation enables the lipidated form to anchor to the isolation membrane during the formation of the autophagosome[18]. After the elongation of the membrane, a subsequent deconjugation of LC3B-II by ATG4B on the cytosolic face of the autophagosome releases LC3B-I[19], which was shown to implement the fusion of the autophagosome with lysosomes and promote autophagic flux in the analogous yeast system[20]. Thus, ATG4B is important for autophagosome biogenesis by processing and recycling LC3 forms[21,22] and a reduction in ATG4B protein and/or activity was shown to lead to an accumulation of LC3B-II due to blocked recycling[22-24].In humans, there are four ATG4 family members (ATG4A, ATG4B, ATG4C and ATG4D) but their individual functions are not yet well characterized. ATG4B was shown to have the highest affinity and broadest spectrum of cleavage activity against autophagy-related substrates, LC3B, ATG8L, GATE16 and GABARAP[25]. ATG4B knockout mice show a reduction in basal and starvation-induced autophagy, but are viable and fertile[26,27]. Several studies have shown that dysregulation of ATG4B is implicated in cancer[24], inflammatory bowel diseases[28], lung fibrosis[29] or hepatitis C virus infection[30], but the role of ATG4B in these and other diseases is still unclear. For example, Liu et al.[31] reported that ATG4B promotes proliferation in colorectal cancer cells via an autophagy-independent pathway. In prostate cancer cells, inhibition of ATG4B with a dominant negative form of the protease resulted in a cell line-specific sensitivity to chemotherapy and modulation of autophagy[32]. Similarly, in cervical cancer, decreased levels of ATG4B enhanced cell sensitivity to the anticancer drug pirarubicin[33]. In breast cancer, one study reported that ATG4B inhibited growth of triple-negative breast cancer cell lines and a candidate agonist of ATG4B, Flubendazole, displayed anti-proliferative effects[34]. Another study identified an association between HER2 and ATG4B and showed that HER2 positive breast cancer cells are sensitive to ATG4B inhibition under stress conditions[35]. Collectively, these studies indicate context- and tissue-dependent roles of ATG4B.Some active site directed irreversible inhibitors of ATG4B are known[36-39] but such inhibitors generally have issues of selectivity and metabolic stability that limit their use, especially in vivo. Recently, a small molecule, NCS185058, was reported to be an inhibitor of ATG4B and to inhibit LC3 lipidation and autophagy. This inhibitor was reported to suppress autophagy and curb the in vivo growth of osteosarcoma tumors[40] and glioblastoma tumors[41]. While NCS185058 may have potential in therapies for bone cancer and other tumor types, the pharmacokinetic properties, selectivity, and in vivo enzyme inhibitory potency of this compound have not yet been reported.Identification of further molecular probes with improved potency, cell-permeability, pharmacokinetic properties and selectivity will be beneficial to explore in depth the pathological roles of ATG4B and its potential as a drug target. Moreover, it is important to have several structurally unrelated molecular probes available to reliably define the role of intervention with a macromolecular target in biology[42].In this context, we set out to develop new small molecule inhibitors of ATG4B. Herein is described a compound, 4–28, discovered from an in silico and function-based screening effort. Its structure-based optimization led to LV-320, a more potent inhibitor of ATG4B, with an excellent pharmacokinetic profile that we report here along with its initial characterization in vitro and in vivo.
Results
Computational Modeling Predicts 4 Druggable Binding Pockets in ATG4B
Several crystal structures of ATG4B are publicly available, including crystal structures of the free, closed, inactive conformation[43,44] and LC3B complexes with catalytically inert ATG4B co-crystallized as open, “active” conformations[19,43]. To bind the LC3B substrate, both the N-terminus and the regulatory loop (amino acids 259:262) of the free form of ATG4B have to undergo conformational changes[19] (Fig. 1a). To identify candidate inhibitors of ATG4B, we used these structural data and the PocketFinder[45] program. We identified two pockets at the surface of the inactive structure that could be used for in silico screening of candidate ATG4B inhibitors. One pocket is located at the back of the regulatory loop and another at the hinge of the N-terminus (Fig. 1b). Our hypothesis was that small molecules bound to those sites could obstruct the conformational changes necessary for inactive ATG4B to become active. Using the PocketFinder program we also identified two pockets for the active conformation (Fig. 1c). One is located at the catalytic center and another at the substrate-binding interface close to the center. Any compound bound to those pockets would directly interfere with the LC3B-ATG4B interaction.
Figure 1
Binding pocket prediction in ATG4B. (a) Ribbon model to show the conformational changes from a free, inactive form (blue) to an active, substrate-binding form (red) of ATG4B. Key catalytic residues and the N-terminal Tyr8 are displayed and labelled. LC3B is in the green ribbon model. Two significant conformational changes occurred at the regulatory loop and the N-terminus. (b) Two pockets (green and orange) identified on the inactive conformation (grey skin model). The active conformation is displayed in red ribbon. The skin formed by the N-terminal of the inactive conformation is colored pink. (c) Two pockets (red and blue) identified on the surface of the active conformation (grey skin model). The LC3 is shown in green ribbon.
Binding pocket prediction in ATG4B. (a) Ribbon model to show the conformational changes from a free, inactive form (blue) to an active, substrate-binding form (red) of ATG4B. Key catalytic residues and the N-terminal Tyr8 are displayed and labelled. LC3B is in the green ribbon model. Two significant conformational changes occurred at the regulatory loop and the N-terminus. (b) Two pockets (green and orange) identified on the inactive conformation (grey skin model). The active conformation is displayed in red ribbon. The skin formed by the N-terminal of the inactive conformation is colored pink. (c) Two pockets (red and blue) identified on the surface of the active conformation (grey skin model). The LC3 is shown in green ribbon.
Large-scale In Silico Screening and High Content Screening Identify Candidate Small Molecule Inhibitors of ATG4B
To identify candidate small molecule inhibitors of ATG4B, a computational screen was carried out using ICM[46]. Small molecule databases of National Cancer Institute (NCI, 230,000 compounds) and Chembridge (500,000 compounds) were screened. Each compound from the databases was docked to the four pockets with the “flexible ligand – rigid receptor” protocol[47]. Following database screening, the best scoring compounds were inspected visually and evaluated according to their chemical and drug-like properties, as well as three-dimensional conformations of the docked ligand-receptor complex. To help identify ATG4B-specific compounds for biological validation, all selected candidates were docked to a pocket database of all human protease and ubiquitin-like proteins for which crystal structures are available. Compounds that docked to those proteins better than to ATG4B were removed (for detailed description of the methodology see Supplemental Information).One hundred of the predicted best binding ATG4B inhibitors were obtained to test for effects on GFP-LC3B puncta levels in SKBR3-hrGFP-LC3Bbreast cancer cells cultured in standard fed conditions. Based on our observations using ATG4B-siRNAs (Figs 2a,b and S1) and several reports in the literature[22-24], we expected that reduced ATG4B function would primarily affect LC3B-II recycling and lead to an increase in GFP-LC3B puncta, whereas complete loss of ATG4B would also affect pro-LC3B processing and lead to a decrease in GFP-LC3B puncta formation[27]. Compounds were initially tested at three concentrations (100 nM, 1 µM and 10 µM) and two treatment periods (6 hour and 24 hour). In parallel, all compounds were tested at a single concentration (8 µM) in a FRET-LC3ATG4B enzymatic assay developed in our group[36]. From this set of compounds, five were found to both significantly affect LC3B puncta levels at one or more concentrations and timepoints (Fig. 2c,d; compounds are depicted with their screening codes and relate to NCI codes shown in Table S1) and to inhibit ATG4B enzyme activity in a dose dependent manner when subsequently titrated (Table S1). Calculations predicted that compound 1–4 bound to closed binding site#1 (Fig. S2) while 2–22 and 3–22 bound to open site#2 (Fig. S3) and 4–6 and 4–28 bound to closed site#2 (Figs S4 and S5). Of these, compounds 1–4 and 4–6 are biphenols which are potentially metabolically unstable by oxidation, sulfation and glucuronidation pathways[48]. Compound 2–22 and 3–22 have electrophilic sites, which are drawbacks for drug development as they are prone to metabolic transformation and could lead to covalent bond formation with biological nucleophiles[49]. Compound 4–28 initially gave 43% inhibition at 8 µM in the screening FRET assay but was inconsistent in subsequent titrations. It was nonetheless selected for further follow-up based on its favorable structural characteristics and resemblance to the known drugs and lysosomal-related autophagy inhibitors, chloroquine and hydroxychloroquine, and to the styrylquinoline, MK-571, a selective antagonist of leukotriene D4 known to have an excellent pharmacokinetic profile in terms of oral bioavailability and long duration of action[50]. Notably however, chloroquine and hydroxychloroquine did not show significant inhibition of activity of purified ATG4B up to 175 and 200 µM respectively in our fluorescent peptide assay for ATG4B activity.
Figure 2
Screening of candidate ATG4B inhibitors. (a) Representative images of SKBR3-hrGFP-LC3B cells treated with control scramble-siRNA, ATG4B-siRNA, or bafilomycin A1 with quantitation of GFP-LC3B puncta shown in the bar graph below. Five randomly selected fields for each condition were analyzed in 2 independent experiments; error bars, SEM. (b) Representative western blot (n = 3) shows elevated LC3B-II levels in SKBR3 cells treated with ATG4B-siRNA compared to the control scramble-siRNA. Full-length blots are presented in Fig. S1. (c) Effect of small molecule compounds on the fraction of live cells with greater than five GFP-LC3B puncta in SKBR3 hrGFP-LC3 cells. Compounds were tested at three concentrations (100 nM, 1 μM and 10 μM) and two time-points, 6 h (top graph) and 24 h (bottom graph). The average values (normalized to DMSO vehicle control) from 3 independent experiments are shown. Colored triangles indicate 5 compounds that showed a statistically significant difference (p < 0.05) compared to vehicle control at one or more concentrations and timepoints and also inhibited ATG4B enzyme activity in a dose dependent manner (Table S1). Of these 5 compounds, only 2–22 and 3–22 showed a statistically significant difference at the 6 h time-point, while all 5 compounds showed a significant difference at one or more concentrations at the 24 h time-point. (d) Structure of 5 inhibitors of ATG4B. Compounds are named by screening codes and relate to NCI codes as depicted in Table S1. Titration curves are presented in Table S1.
Screening of candidate ATG4B inhibitors. (a) Representative images of SKBR3-hrGFP-LC3B cells treated with control scramble-siRNA, ATG4B-siRNA, or bafilomycin A1 with quantitation of GFP-LC3B puncta shown in the bar graph below. Five randomly selected fields for each condition were analyzed in 2 independent experiments; error bars, SEM. (b) Representative western blot (n = 3) shows elevated LC3B-II levels in SKBR3 cells treated with ATG4B-siRNA compared to the control scramble-siRNA. Full-length blots are presented in Fig. S1. (c) Effect of small molecule compounds on the fraction of live cells with greater than five GFP-LC3B puncta in SKBR3 hrGFP-LC3 cells. Compounds were tested at three concentrations (100 nM, 1 μM and 10 μM) and two time-points, 6 h (top graph) and 24 h (bottom graph). The average values (normalized to DMSO vehicle control) from 3 independent experiments are shown. Colored triangles indicate 5 compounds that showed a statistically significant difference (p < 0.05) compared to vehicle control at one or more concentrations and timepoints and also inhibited ATG4B enzyme activity in a dose dependent manner (Table S1). Of these 5 compounds, only 2–22 and 3–22 showed a statistically significant difference at the 6 h time-point, while all 5 compounds showed a significant difference at one or more concentrations at the 24 h time-point. (d) Structure of 5 inhibitors of ATG4B. Compounds are named by screening codes and relate to NCI codes as depicted in Table S1. Titration curves are presented in Table S1.
Small Molecule 4–28 Inhibits Cleavage of LC3B in Cell-free Assays and reduces autophagy in cultured cells
The initial inconsistent results obtained with 4–28 in our screening enzyme assay suggested that it may not be stable under the assay conditions. 4–28 is a 4-aminostyrylquinoline, a structural class known to be photo-reactive[51]. In preliminary assays under standard conditions with the reducing agent TCEP present, we noted the formation of isomers and adducts between 4–28 and TCEP (Fig. 3b). Thus, to confirm the ability of 4–28 to inhibit ATG4B activity, we used a mass spectrometry assay using a GFP-LC3-YFP substrate[36] and by using activation of the enzyme with TCEP on solid support, which can be easily removed after the activation and prior to incubation with the inhibitor. Using this approach, we obtained a dose-response curve where 4–28 displayed an IC50 of 116 ± 14 µM (Fig. 3c). A similar IC50 (79 ± 9 µM) was obtained using a fluorometric assay optimized with minimized irradiations and with TCEP on solid support, using a small fluorogenic peptide substrate developed in our laboratory[52] (Fig. 3d). HPLC analysis (Figs S6 and S7) showed that only 4% of the cis-isomer of 4–28 was formed under the assay conditions (1 irradiation at 350 nm each 15 min for 2 h) indicating that the integrity of 4–28 was preserved during the assay. By these two assays, we confirmed the ability of 4–28 to inhibit ATG4B catalytic activity.
Figure 3
4–28 inhibits ATG4B and blocks autophagic flux in cells. (a) Predicted binding model of compound 4–28 bound to ATG4B pocket closed#2. (b) Reactivity of 4–28 under UV irradiation affording the cis-isomer and hypothetically the cyclized form (blue pathway) and under TCEP treatment (red pathway). (c) Dose response curve of 4–28 obtained by mass spectrometry assay using GFP-LC3-YFP assay. n = 3; error bars, SEM (d) Dose response curve of 4–28 with fluorimetric assay. n = 3; error bars represent SEM (e) LC3B-based autophagy flux assay for ATG4B-siRNA. MCF7 cells treated with control scramble-siRNA, ATG4B-siRNA1, or ATG4B-siRNA2, in the absence or presence of bafilomycin A1 (Baf A1). n = 3; error bars, SEM; *p < 0.05. Full-length blots are presented in Fig. S1. (f) LC3B-based autophagy flux assay for 4–28. MCF7 cells were treated with vehicle control or the indicated amounts of 4–28, in the absence or presence of bafilomycin A1 (Baf A1). n = 3; error bars, SEM; *p < 0.05. Full-length blots are presented in Fig. S1.
4–28 inhibits ATG4B and blocks autophagic flux in cells. (a) Predicted binding model of compound 4–28 bound to ATG4B pocket closed#2. (b) Reactivity of 4–28 under UV irradiation affording the cis-isomer and hypothetically the cyclized form (blue pathway) and under TCEP treatment (red pathway). (c) Dose response curve of 4–28 obtained by mass spectrometry assay using GFP-LC3-YFP assay. n = 3; error bars, SEM (d) Dose response curve of 4–28 with fluorimetric assay. n = 3; error bars represent SEM (e) LC3B-based autophagy flux assay for ATG4B-siRNA. MCF7 cells treated with control scramble-siRNA, ATG4B-siRNA1, or ATG4B-siRNA2, in the absence or presence of bafilomycin A1 (Baf A1). n = 3; error bars, SEM; *p < 0.05. Full-length blots are presented in Fig. S1. (f) LC3B-based autophagy flux assay for 4–28. MCF7 cells were treated with vehicle control or the indicated amounts of 4–28, in the absence or presence of bafilomycin A1 (Baf A1). n = 3; error bars, SEM; *p < 0.05. Full-length blots are presented in Fig. S1.To confirm the effects of 4–28 on autophagy, we assayed endogenous LC3B in MCF7 cells, in the presence and absence of bafilomycin A1. Similar to the effects observed with ATG4B-siRNAs (Figs 2a,b and 3e), 4–28 resulted in an accumulation of LC3B-II that was not additive to bafilomycin A1 (Fig. 3f). While the effects observed were modest, this observation is consistent with reduced LC3B-II recycling and reduced autophagic flux.Despite its promising activity, 4–28 showed instability under UV irradiation as well as a propensity for addition of nucleophiles (TCEP) to the styryl double bond (as noted above). In our case, with incubation of 4–28 for 1 h under UV-irradiation, the formation of the cis compound was observed by HPLC and 1H NMR along with other compounds consistent with further electrocyclization (Figs 3b and S6 and S7). Given these observed instabilities and reactivity, a structure-activity relationship study was initiated with an aim to identify an analog with improved stability and enhanced potency against ATG4B and with a pharmacokinetic profile suitable to support in vivo testing.
A Structure-Activity Relationship (SAR) Study identified Compound LV-320 with Improved Stability and ATG4B Potency
In our binding models compound 4–28 was predicted to bind to pocket closed#2 (Figs 1b, 3a, and S5). The volume of 4–28 is 390.7 Å3 and its binding pocket is 486.8 Å3. There are two crystal structures of ATG4B with closed conformation in PDB from two independent labs (PDB entries 2CY7 and 2D1I). This pocket is conserved in both closed conformational structures, but not in any of the three available active conformation structures (2ZZP, 2Z0D and 2Z0E) due to the large conformational changes of the N-terminal tails and a segment of another loop (Cys301:Pro305) which formed part of the pocket. The major interactions are formed by the hydrogen bond between the acid moiety to Phe19 of the N-terminal residue and the hydrophobic interactions between the rest of the compound with the pocket, especially the aromatic ring of the compound which positioned in a hydrophobic “hole” formed by hydrophobic residues Leu43, Val46, Cys301 and Pro305. (See Fig. S5a,b). The quinoline ring of 4–28 lies in a hydrophobic pocket and the acid moiety binds to the Phe19 residue. Modeling suggested modifications to the quinolone moiety, alkyl and acidic chains could be tolerated within the putative binding pocket and thus an exploratory SAR study was undertaken. A small library of analogs of 4–28 was synthesized (Supplemental Information, Table S2) and assessed for inhibitory activity against ATG4B. Compound 4–28 presents a structural motif with a flat 4-styrylquinoline core to which is appended a lipophilic chain and a carboxylic acid bearing chain arrayed on the 4′-amino group. As the conjugation of the amino function to the styryl unit was considered to be largely responsible for the reactivity towards nucleophiles and the photo-instability, we sought to replace or displace the amino group and also to optimize the heterocyclic (quinoline) moiety as well as the two chains. In summary, these studies (Table S2) indicated that the anilinenitrogen was not critical for activity and could be displaced or replaced by a carbon atom and that the two chains could be appended via a dithioacetal or as a mono-thioether. One carboxylic acid function was necessary for activity, with the thiopropionic chain being optimal, and the optimal lipophilic chain was found to be the thioethylphenyl group. The dithioacetal could be placed in the 4′ or 3′ position with similar potency. The quinolone ring was found to be optimal but could be replaced with other bicyclic aromatic or heteroaromatic groups. However, monocyclic analogs (e.g. pyridyl) lost activity. Given that unsubstituted quinolines are known to be potentially toxic through metabolic activation via oxidation[53], and that such metabolism could impair pharmacokinetics, introduction of quinolone substituents was evaluated and a 7-chloro group was found to have the best profile of those tested. Thus the compound LV-320 was identified (Fig. 4a) and selected for further profiling. Using the fluorescent peptide substrate assay for ATG4B inhibition[52], LV-320 gave an IC50 of 24.5 µM (95% CI 20.7 to 29.1 µM) (Fig. 4b).
Figure 4
LV-320 arose from the SAR study and binds ATG4B. (a) Structure of LV-320. (b) IC50 of LV-320 in ATG4B cleavage assay using the fluorescent peptide pim-FG-PABA-AMC as substrate; n = 3; error bars, SEM (c) Binding of LV-320 with ATG4B determined by MST. (n = 3) (d) and (e). LV-320 depresses both the Vmax (d) and KM (e) in an ATG4B enzymatic assay with a fluorogenic peptide substrate, concordant with an uncompetitive mode of inhibition. Error bars, SEM. Experiments were performed with technical quadruplicates and representative biological duplication. (f) IC50 of LV-320 in ATG4A cleavage assay using pim-FG-PABA-AMC as substrate. n = 4; error bars, SEM.
LV-320 arose from the SAR study and binds ATG4B. (a) Structure of LV-320. (b) IC50 of LV-320 in ATG4B cleavage assay using the fluorescent peptide pim-FG-PABA-AMC as substrate; n = 3; error bars, SEM (c) Binding of LV-320 with ATG4B determined by MST. (n = 3) (d) and (e). LV-320 depresses both the Vmax (d) and KM (e) in an ATG4B enzymatic assay with a fluorogenic peptide substrate, concordant with an uncompetitive mode of inhibition. Error bars, SEM. Experiments were performed with technical quadruplicates and representative biological duplication. (f) IC50 of LV-320 in ATG4A cleavage assay using pim-FG-PABA-AMC as substrate. n = 4; error bars, SEM.
LV-320 binds to ATG4B and is an uncompetitive inhibitor of ATG4B
To confirm binding of LV-320 to ATG4B, a microscale thermophoresis (MST) experiment was conducted and showed that LV-320 binds to ATG4B with a KD of 16 ± 1 µM (Fig. 4c). Based on our binding pocket model, we predicted that LV-320 acted as an allosteric inhibitor of ATG4B. To test this, kinetic analyses were carried out for inhibition of ATG4B with LV-320 using a varying concentration of enzyme and substrate (fluorescent peptide assay). Analysis of data indicated that increasing concentrations of LV-320 led to suppression of Vmax while also lowering KM, consistent with uncompetitive inhibition (Fig. 4d,e).
Selectivity on ATG4 isoforms and relevant cysteine proteases
To evaluate selectivity of inhibition, LV-320 was tested for activity as an inhibitor of the homologous enzyme ATG4A and also the cysteine proteases caspase-3 and cathepsin B. Notably LV-320 was shown to inhibit ATG4A with an IC50 of 35.5 µM (95% CI = 31.4 to 40.2) (Fig. 4f) but did not show meaningful inhibition for caspase-3 (6% inhibition at 60 µM) (Fig. S8a) or cathepsin B (32% inhibition at concentrations up to 60 µM) (Fig. S8b).
LV-320 reduces autophagic flux in vitro and is bioavailable and active in vivo
To determine whether LV-320 alters autophagy, we first investigated its effects on endogenous LC3B in multiple breast cancer cell lines, SKBR3, MCF7, JIMT1 and MDA-MB-231. Treatment with LV-320 resulted in a dose-dependent increase in endogenous LC3B-II levels in all four cell lines, with changes first detected at 50 to 75 µM LV-320 (Fig. 5a). Consistent with a block in autophagy, we also detected a dose-dependent increase in the autophagy cargo adaptor protein p62 (Fig. 5a). To further confirm that the increase in LC3B-II represented a block in autophagy flux, the levels of endogenous LC3B-II were quantitated in the presence and absence of bafilomycin A1 (Baf A1). Similar to ATG4B-siRNA, treatment of cells with LV-320 led to an increase in LC3B-II, that was not further increased in the presence of Baf A1 (Fig. 5b), indicating that LV-320 blocks autophagic flux. Since uncleaved pro-LC3B migrates at a similar position to LC3B-II in SDS-PAGE[54], we used gene editing to create an ATG4B-knockout (KO) JIMT-1 cell line as a positive control for pro-LC3B. Side-by-side comparisons, using a 4–12% gradient gel and all in the JIMT-1 cell line background, showed that the pro-LC3B band detected in ATG4B-KO cells migrated at a position intermediate to the LC3B-I and LC3B-II bands detected in both the LV-320 and ATG4B-siRNA treated cells (Fig. 5c). This observation confirms that LV-320, like ATG4B-siRNA, leads to an accumulation of LC3B-II but not pro-LC3B. Reduced levels of GABARAP, an alternate ATG4B substrate, were observed in ATG4B knockout cells[27,55]. We tested effects of LV-320 on levels of endogenous GABARAP, and found that LV-320 resulted in a significant decrease in GABARAP levels (Fig. 5d). These observations further support the on-target effects of LV-320 in cells.
Figure 5
LV-320 blocks starvation-induced autophagic flux in vitro. (a) LV-320 treatment of SKBR3, MCF7, JIMT1, and MDA-MB-231 cells results in accumulation of LC3B-II and p62 in a dose dependent manner. Corresponding mean LC3B-II/actin values were determined using densitometry analysis; error bars, SEM (n = 3). Full-length blots are presented in Fig. S1. (b) LV-320 treatment, similar to ATG4B knockdown, results in inhibition of autophagic flux in MDA-MB-231 cells. Autophagic flux assay using saturating (40 nM) concentrations of bafilomycin A1 (Baf A1) was applied for the assessment of LC3B-II accumulation. Top: The representative western blot shows higher accumulation of LC3B-II following ATG4B siRNA treatment compared to scramble siRNA control; LC3B-II accumulation resulting from ATG4B knockdown is comparable to that from treatment with bafilomycin A1. Bottom: western blot shows higher accumulation of LC3B-II in cells treated with LV-320 (120 µM for 48 hours) compared to DMSO control; addition of Baf A1 to LV-320 did not result in further accumulation of LC3B-II. Corresponding mean LC3B-II/actin values were determined using densitometry analysis; n = 3; error bars, SEM; *p < 0.05. Full-length blots are presented in Fig. S1. (c) LV-320 results in accumulation of LC3B-II and not pro-LC3B. Representative western blot shows parental JIMT-1 cells treated with scramble control siRNA (lane 1), ATG4B-siRNA (lane 2), vehicle control (lane 4), or LV-320 (75 µM; 24 h; lane 5). The control ATG4B-KO JIMT-1 cells showing the location of pro-LC3B are in lane 3. Samples were run on a 4–12% Bis-tris gradient gel. The banding pattern shown is representative of 3 independent experiments. Full-length blots are presented in Fig. S1. (d) Representative western blot shows treatment of MDA-MB-231 cells with LV-320 (120 µM for 24 h) resulted in reduced levels of GABARAP-II. Addition of bafilomycin A1 (Baf A1; 40 nM) or Wortmannin (1 µM) during the final 4 h of treatment had no effect. The GABARAP-II/actin values were determined using densitometry analysis; n = 3; error bars, SEM; *p < 0.05, Student’s t-test. Full-length blots are presented in Fig. S1.
LV-320 blocks starvation-induced autophagic flux in vitro. (a) LV-320 treatment of SKBR3, MCF7, JIMT1, and MDA-MB-231 cells results in accumulation of LC3B-II and p62 in a dose dependent manner. Corresponding mean LC3B-II/actin values were determined using densitometry analysis; error bars, SEM (n = 3). Full-length blots are presented in Fig. S1. (b) LV-320 treatment, similar to ATG4B knockdown, results in inhibition of autophagic flux in MDA-MB-231 cells. Autophagic flux assay using saturating (40 nM) concentrations of bafilomycin A1 (Baf A1) was applied for the assessment of LC3B-II accumulation. Top: The representative western blot shows higher accumulation of LC3B-II following ATG4B siRNA treatment compared to scramble siRNA control; LC3B-II accumulation resulting from ATG4B knockdown is comparable to that from treatment with bafilomycin A1. Bottom: western blot shows higher accumulation of LC3B-II in cells treated with LV-320 (120 µM for 48 hours) compared to DMSO control; addition of Baf A1 to LV-320 did not result in further accumulation of LC3B-II. Corresponding mean LC3B-II/actin values were determined using densitometry analysis; n = 3; error bars, SEM; *p < 0.05. Full-length blots are presented in Fig. S1. (c) LV-320 results in accumulation of LC3B-II and not pro-LC3B. Representative western blot shows parental JIMT-1 cells treated with scramble control siRNA (lane 1), ATG4B-siRNA (lane 2), vehicle control (lane 4), or LV-320 (75 µM; 24 h; lane 5). The control ATG4B-KO JIMT-1 cells showing the location of pro-LC3B are in lane 3. Samples were run on a 4–12% Bis-tris gradient gel. The banding pattern shown is representative of 3 independent experiments. Full-length blots are presented in Fig. S1. (d) Representative western blot shows treatment of MDA-MB-231 cells with LV-320 (120 µM for 24 h) resulted in reduced levels of GABARAP-II. Addition of bafilomycin A1 (Baf A1; 40 nM) or Wortmannin (1 µM) during the final 4 h of treatment had no effect. The GABARAP-II/actin values were determined using densitometry analysis; n = 3; error bars, SEM; *p < 0.05, Student’s t-test. Full-length blots are presented in Fig. S1.In an alternate assay to investigate the effect of LV-320 on starvation-induced autophagic flux, we used stably transfected RFP-GFP-LC3B cells. Since GFP fluorescence is quenched in acid environments, but red fluorescence is preferentially retained, autolysosomes are indicated by red puncta whereas autophagosomes are indicated by yellow puncta, or the overlap of both red and green fluorescence[56]. In starved control scramble-siRNA treated cells, abundant red puncta were detected as expected, indicating high levels of autophagic flux (Fig. 6a). Similar to the positive controls ATG4B-siRNA and the lysosomal inhibitor Baf A1, the formation of red puncta was significantly blocked in LV-320-treated cells (Fig. 6a). Together, these results indicate that LV-320 suppresses autophagic flux in vitro. To test whether LV-320 was acting like a lysosomal inhibitor, we conducted a fluorescence assay using the acidotropic dye Lysotracker Red (LTR). Relative to the vehicle control (DMSO) treated cells, the lysosomal inhibitor CQ resulted in a statistically significant decrease in LTR fluorescence intensity, but LV-320 had no significant effect (Fig. 6b). This result indicates that, unlike CQ, LV-320 does not alter lysosomal pH. To determine if LV-320 affects lysosomal degradation, we performed a DQ-BSA assay. DQ-Red BSA is a self-quenched fluorescent substrate that enters the cell through endocytosis and fluoresces upon lysosomal degradation[57]. Treatment of cells with CQ significantly reduced DQ-Red BSA fluorescence, but DMSO or LV-320 had no significant effect (Fig. 6c). Together, these results indicate that LV-320 does not act similarly to the lysosomal compound CQ.
Figure 6
LV-320 blocks starvation-induced autophagic flux in vitro and does not act like CQ. (a) LV-320 treatment, similar to ATG4B knockdown, inhibits autophagic flux. MDA-MB-231 cells stably expressing mRFP-EGFP-LC3B protein were treated with either ATG4B-siRNA or scramble-siRNA, as well as either DMSO or LV-320 (120 µM for 48 hours), with and without bafilomycin A1, under starved conditions. Decrease in red puncta (autolysosomes) relative to yellow puncta (autophagosomes) indicates decreased autophagic flux in response to treatment. Bar graphs show average ratio (mean ± SEM) of red to yellow puncta per cell, n = 3; P values are based on the one-way ANOVA with Dunnett post-test. Scale bar, 50 µm. (b) MDA-MB-231 cells were treated with DMSO (vehicle control), CQ (40 μm) or LV-320 (120 μM) for 24 hours before being stained with Lysotracker Red® (LTR) and DRAQ5. Mean levels of gray intensity were measured from the LTR channel per image, made relative to number of cells and normalized to the DMSO control. Bar graph shows mean LTR intensity per cell per treatment (mean ± SEM). At least 200 cells were analyzed per treatment in each of 2 independent experiments; P values are based on the Kruskal-Wallis test with Dunnetts post-test, *p < 0.05, ****p < 0.0001. Scale bar, 10 μm. (c) LV-320 does not inhibit lysosomal degradation. Fluorescence intensity of SKBR3 cells treated with DQ-Red BSA (10 µg/ml) in combination with either DMSO (vehicle control; dark blue), CQ (20 µM; red), LV-320 (75 µM; light blue) or LV-320 (100 µM; pink). Unstained control cells are shown in gray. Histogram is representative of 3 independent biological replicates, which are shown in the scatter plot; *p < 0.05, P values are based on one-way ANOVA with Dunnett post-test.
LV-320 blocks starvation-induced autophagic flux in vitro and does not act like CQ. (a) LV-320 treatment, similar to ATG4B knockdown, inhibits autophagic flux. MDA-MB-231 cells stably expressing mRFP-EGFP-LC3B protein were treated with either ATG4B-siRNA or scramble-siRNA, as well as either DMSO or LV-320 (120 µM for 48 hours), with and without bafilomycin A1, under starved conditions. Decrease in red puncta (autolysosomes) relative to yellow puncta (autophagosomes) indicates decreased autophagic flux in response to treatment. Bar graphs show average ratio (mean ± SEM) of red to yellow puncta per cell, n = 3; P values are based on the one-way ANOVA with Dunnett post-test. Scale bar, 50 µm. (b) MDA-MB-231 cells were treated with DMSO (vehicle control), CQ (40 μm) or LV-320 (120 μM) for 24 hours before being stained with Lysotracker Red® (LTR) and DRAQ5. Mean levels of gray intensity were measured from the LTR channel per image, made relative to number of cells and normalized to the DMSO control. Bar graph shows mean LTR intensity per cell per treatment (mean ± SEM). At least 200 cells were analyzed per treatment in each of 2 independent experiments; P values are based on the Kruskal-Wallis test with Dunnetts post-test, *p < 0.05, ****p < 0.0001. Scale bar, 10 μm. (c) LV-320 does not inhibit lysosomal degradation. Fluorescence intensity of SKBR3 cells treated with DQ-Red BSA (10 µg/ml) in combination with either DMSO (vehicle control; dark blue), CQ (20 µM; red), LV-320 (75 µM; light blue) or LV-320 (100 µM; pink). Unstained control cells are shown in gray. Histogram is representative of 3 independent biological replicates, which are shown in the scatter plot; *p < 0.05, P values are based on one-way ANOVA with Dunnett post-test.The pharmacokinetic parameters and tolerability of LV-320 were assessed in mice with an oral administration of 30, 100 and 200 mg/kg (Fig. 7a,b). LV-320 displayed a favorable pharmacokinetic profile with a good oral absorption and blood levels were dose proportional up to 100 mg/kg but somewhat less so at 200 mg/kg. The maximum concentration of 210 ± 50 µM and 280 ± 20 µM was achieved after 1 h after 100 and 200 mg/kg doses respectively (Fig. 7b).
Figure 7
LV-320 is bioavailable and affects LC3B levels in vivo. (a) Plasma levels of LV-320 in BL/6 mice (n = 3, serial samples) after oral doses of 30 or 100 mg/kg; error bars, SD (b) Plasma levels of LV-320 in BL/6 mice (n = 3, serial samples) after oral doses of 100 or 200 mg/kg; error bars, SD (c) LV-320 treatment results in accumulation of GFP-LC3 puncta in mouse liver tissues. Representative images from each treatment condition are shown in the left panel. Scale bar, 20 µm. Quantitative data are shown in the right panel. The percentage of GFP-LC3 puncta positive cells from 5 fields were calculated for each sample; and 6 samples from each treatment condition were grouped; *P < 0.01 (Student’s two-tailed t-test). (d) LV-320 treatment results in accumulation of LC3B-II in a dose-dependent manner. Corresponding mean LC3B-II/actin values (per treatment group) were determined using densitometry analysis; error bars, SEM. *p < 0.05, **p < 0.01, Student’s t-test. Full-length blots are presented in Fig. S1.
LV-320 is bioavailable and affects LC3B levels in vivo. (a) Plasma levels of LV-320 in BL/6 mice (n = 3, serial samples) after oral doses of 30 or 100 mg/kg; error bars, SD (b) Plasma levels of LV-320 in BL/6 mice (n = 3, serial samples) after oral doses of 100 or 200 mg/kg; error bars, SD (c) LV-320 treatment results in accumulation of GFP-LC3 puncta in mouse liver tissues. Representative images from each treatment condition are shown in the left panel. Scale bar, 20 µm. Quantitative data are shown in the right panel. The percentage of GFP-LC3 puncta positive cells from 5 fields were calculated for each sample; and 6 samples from each treatment condition were grouped; *P < 0.01 (Student’s two-tailed t-test). (d) LV-320 treatment results in accumulation of LC3B-II in a dose-dependent manner. Corresponding mean LC3B-II/actin values (per treatment group) were determined using densitometry analysis; error bars, SEM. *p < 0.05, **p < 0.01, Student’s t-test. Full-length blots are presented in Fig. S1.To investigate whether LV-320 affects LC3B levels in vivo, we treated GFP-LC3mice with vehicle solution or LV-320 at 100 mg/kg or 200 mg/kg dosed three times over two days, and 4 hours after the final treatment we analyzed mouse plasma and livers for drug levels and for the expression of GFP-LC3 puncta using confocal microscopy, and for LC3B protein levels on western blot. Terminal blood levels of LV-320 (4 h after last dose) were 169 ± 23 µM and liver levels were 104 ± 26 µM. We quantified the expression of GFP-LC3 puncta and found a significantly greater accumulation in LV-320 treated animals compared to controls (Fig. 7c). LC3B-II protein was also increased in LV-320-treated animals (Fig. 7d) compared to vehicle controls, similar to the effects on LC3B-II observed following LV-320 treatment of cells in vitro. The described treatment regimens did not cause significant toxicity in mice at either dose.
Discussion
In this study, we used a combination of molecular modeling, in silico screening and both cell-free and cell-based activity assays to identify five candidate small molecule inhibitors of ATG4B. Four of the compounds (1–4, 2–22, 3–22, 4–6) resulted in an increase in GFP-LC3 puncta, and one compound (4–28) resulted in a decrease in GFP-LC3 puncta in our primary screen. Of these, the styrylquinoline 4–28 was selected due to its “drug-like” structure. Because 4–28 has potential fluorescent quenching properties, which may have contributed to the observed GFP-LC3 puncta effects, we validated this hit with further non-fluorescence-based autophagy assays in addition to the enzymatic assays. These studies together supported the conclusion that 4–28 reduces ATG4B activity and LC3B-II recycling. However 4–28 is a member of a class of molecules (4-(4′-amino)styrylquinolines) known to be highly photochemically reactive[51] and indeed we noted its propensity for photo-isomerization and also reactivity towards nucleophiles such as the reducing agent, TCEP, used in our assay protocol to activate ATG4B. SAR studies on 4–28 revealed that the 4′-amino function could be displaced or replaced with a carbon atom without affecting activity. These studies also revealed a rather flat structure-activity relationship but that for potent activity, the styryl double bond was required and two chains, one bearing a carboxylic acid group and another a lipophilic chain, terminated with a phenyl group were optimal.Based on our SAR study to improve the stability and the potency of 4–28, compound LV-320 was identified as one of our most active ATG4B inhibitors, a compound that showed enhanced potency, excellent pharmacokinetics and was found to be well absorbed and tolerated in mice after oral dosing. LV-320 shows enzyme inhibition kinetics consistent with uncompetitive inhibition of ATG4B, consistent with its predicted binding to the allosteric site closed#2 (Fig. S9) and also inhibits its closely related family member ATG4A with similar potency but does not (significantly) inhibit the cysteine proteases caspase-3 or cathepsin B. Microscale thermophoresis experiments indicated that LV-320 binds to purified activated ATG4B in solution and molecular docking suggests it may bind at an ancillary site either near the regulatory loop or at the hinge of the N-terminal chain that covers the active site when closed and reveals the site when in the open conformation. The observation that LV-320 inhibits ATG4A with similar potency to ATG4B would be in keeping with interaction with the putative binding site given that the amino-acid sequences at these sites are largely conserved in the two enzymes (Fig. S10).Other putative inhibitors of ATG4B have been reported in the literature including some identified through design[36] and high throughput screening[37-39,52,58] but these compounds are generally either complex polyphenolic compounds[52,58] or compounds that work through irreversible alkylation of the active site cysteine[36-39]. Such structures are prone to metabolic instability and not readily optimized to impart “drug-like” properties of stability and reliable pharmacokinetic properties. In addition polyphenolic inhibitors such as aurintricarboxylic acid[36] are known to be promiscuous inhibitors that are found active in many assays and may be considered as Pan-Assay Interference (PAINS) compounds[59]. Akin has reported that NSC 185058 (N-pyridin-2-ylpyridine-2-carbothioamide), a compound initially identified through in silico screening, inhibited ATG4B activity in vitro (with an IC50 of 51 µM) as well as inhibiting activation and lipidation of LC3 in cells[40]. The compound also showed ability to inhibit tumor growth in a cancer osteosarcoma xenograft mouse model when dosed daily at 100 mg/kg. However, the authors did not report on the selectivity of NSC185058 nor its pharmacokinetic profile in these treated mice so it is difficult to fully ascribe the beneficial effects to inhibition of ATG4B. While the antitumor effects of NSC 185058 were encouraging, in our hands, we could not demonstrate significant inhibition of purified ATG4B catalytic activity in our assays with NSC 185058 at concentrations up to 200 µM (23% inhibition at 200 µM in the fluorescent peptide substrate assay[52] and maximum of 16% inhibition at 200 µM in the assay using FRET-LC3 as substrate[36] whether monitored by fluorescence or by mass spectrometry) (Fig. S11). This discrepancy may be attributed to different assay conditions, compound synthesis and/or reporter constructs used in the two studies. A recent report described several benzotropolone compounds that inhibited recombinant ATG4B and showed promising in vivo effects although the compounds were limited by metabolic stability and in vitro kinetics of inhibition and selectivity were not described[60].Nonetheless, it would be of interest to assess the combination effects of LV-320, an allosteric site inhibitor, with other compounds that target the active site of ATG4B. Kinetic analysis of the inhibition of ATG4B with LV-320 was consistent with uncompetitive inhibition which suggests it may bind to the enzyme at an allosteric site and also may bind to the enzyme-substrate complex.Several limitations and future directions for the characterization of LV-320 remain. We have thus far been unable to obtain an ATG4B-LV-320 co-crystal structure so the exact nature of LV-320 binding to ATG4B is yet to be determined. The effects of LV-320 on LC3B-II accumulation and reduced autophagic flux are consistent with studies in yeast, which showed that deconjugation of ATG8-II by ATG4 was required for the subsequent fusion step[20], but this mechanism has yet to be determined in mammalian cells. It was reported recently that LC3/GABARAP subfamilies are crucial for autophagosome-lysosome fusion and autophagic flux in mammalian cells[61]. Given the effects of LV-320 on LC3B-II and GABARAP, this is an alternate or additional mechanism consistent with the observed GFP-LC3 accumulation and suppressed autophagic flux following LV-320 treatment. Moreover, it will be valuable to investigate the possible effects of LV-320 on the levels and post-translational modifications of all six LC3/GABARAP family members. While we found that LV-320 did not significantly inhibit the cysteine proteases caspase-3 and cathepsin B, we cannot rule out the possibility of effects on other proteins, and it will be beneficial to conduct more extensive off-target screening. Lastly, LV-320 remains to be characterized in a variety of cell and tissue types, and in models of disease in vivo. Based on studies to date[31-35], we expect that context dependency will be an important consideration.In vitro, LV-320 suppressed basal and starvation-induced autophagy flux, and in vivo
LV-320 demonstrated a good PK profile and modulation of the ATG4B substrate LC3B. The effects of LV-320 on LC3B-II accumulation, but not pro-LC3B accumulation, are consistent with reduced LC3B-II delipidation and similar to other observations[22-24] and our own using ATG4B-siRNAs. Previous studies showed that LC3B-II can be delipidated by ATG4B but not by ATG4A[62] nor ATG4D[63]. ATG4C delipidation activity on LC3B-II is still unknown, but these data support a requirement for ATG4B in LC3B-II delipidation. The ATG4B knockout phenotype for LC3B is distinct, in that it results in failed conversion or “priming” of pro-LC3B, leading to pro-LC3B accumulation and the loss of detectable LC3B-II. Using a reconstituted cell-free system, Kauffman et al. showed that ATG4B priming activity is orders of magnitude faster than its delipidation activity[64]. These data are consistent with our interpretation that residual or low levels of ATG4B activity, in the case of LV-320 treatment, are still sufficient for priming or conversion of pro-LC3B to LC3-I, but insufficient or rate-limiting for efficient delipidation of LC3B-II; while unknown, this may be beneficial in a therapeutic context. It is also difficult to know if the added potency of LV-320 at ATG4A would contribute to a beneficial in vivo profile or not. Only when we have a suite of pan- and highly subtype selective-inhibitors of ATG4s will this become clear. The combined results show that LV-320 is an inhibitor of ATG4B and ATG4A that demonstrates in vitro, cellular and in vivo effects in keeping with its potency and exposure data. Thus LV-320 is expected to serve a useful role as a molecular probe to better understand the roles and the therapeutic potential of ATG4 in health and disease.
Methods
ATG4B crystal structures and small molecule databases
Code and data availability: The crystal structures of ATG4B were downloaded from the Protein DataBank (PDB) (www.rcsb.org). The NCI small molecule database and the Chembridge database were downloaded from ZINC (zinc.docking.org). We used all free form structures available (PDB entries 2CY7 and 2D1I) as inactive conformations and the structure from one ATG4B-LC3 complex (entry 2ZZP) as the active conformation. The ATG4B in 2ZZP has a single mutation Cys74Ser. A counter mutation S74C was modeled using ICM (Version 3.6, licensed from Molsoft LLC) to generate the wild type structure.
Pocket Identification, Molecular Docking and Computational Screening
A linux-based computer cluster of 1000 CPUs with ICM package installed was used to conduct the tasks. PocketFinder[45] was applied to those three crystal structures for identifying small molecule-binding pockets. For molecular docking, each binding pocket is represented by a set of maps for van der Waals (carbon-based and hydrogen-based), electrostatic, hydrogen bonding, and hydrophobic interactions. Each compound (ligand) of the database was docked to the pockets sequentially, and a score reflecting the quality of the docked complex was assigned to each compound[47]. During the docking, the compound is fully flexible, and both the intramolecular ligand energy and the ligand-receptor (pocket) interaction energy were optimized. The conformational sampling was based on the biased probability Monte Carlo procedure in the internal coordinate space[46]. Due to the nature of Monte Carlo based sampling, we repeated the database screening process five times for each pocket and retained the best score for each compound.
Fluorimetric ATG4B enzymatic assay
100 μL of immobilized TCEP in deionized water was diluted in 2.50 mL of buffer (50 mM Tris, 35 mM NaCl, pH = 8). The sample was centrifuged at 10,000 × g during 1 min. The supernatant was removed. This operation was done two more times. 50 µL of ATG4B (26.75 µM) frozen in buffer (50 mM Tris, 500 mM NaCl, pH 8) was flash thawed and diluted with 100 µL of washed immobilized TCEP. The solution was incubated on a carousel at 4 °C for 1 h. This solution was then diluted with 2.06 mL of buffer (50 mM Tris, 35 mM NaCl, 5 mM EDTA, pH 8), centrifuged at 10,000 × g during 1 min and the supernatant, containing the activated ATG4B (1 µM), was kept. A 96-well all-black plate was loaded where each well was charged with 55 µL of inhibitor at different concentrations (0 µM to 100 µM or 200 µM) in buffer/DMSO 41:3 (v/v) and 20 μL of enzyme or buffer were dispensed using a dispenser (Biotek). Plate was incubated for 30 min. A single read was done using excitation and emission wavelengths of 350/450 nm. 25 µL of peptide substrate (pim-FG-PABA-AMC)[52] (final assay concentration 100 µM) was dispensed using a dispenser (Biotek). Experiments were performed in triplicate except when it is mentioned. Fluorescent reads were performed using the Synergy 4 (Biotek) at 25 °C using excitation and emission wavelengths of 350/450 nm every 15 min for 2 h.
Enzyme kinetic analysis using fluorimetric ATG4B enzyme assay
20 µL of ATG4B (292 µM) frozen in buffer (50 mM Tris, 500 mM NaCl, pH 8) was flash thawed, diluted with 1 mL of reducing buffer (50 mM Tris buffer, 35 mM NaCl, 5 mM EDTA, 1.25 mM TCEP, pH 8) (final assay concentration of 5.73 µM) and incubated on ice for 1 h. A 96-well all-black, non-binding surface plate was loaded with 50 µL of ATG4B (final assay concentration 400 nM) and LV-320 at various concentrations (to provide final assay concentrations of 6 µM to 54 µM) in reducing buffer/DMSO 95:5 (v/v), and incubated at ambient temperature for 30 min. A separate 96-well plate was charged with solutions of fluorescent peptide substrate[52] at different concentrations (to provide final assay concentrations of 10 µM to 124.4 µM) in reducing buffer/DMSO 95:5 (v/v). A Thermo Scientific Matrix PlateMate 2 × 2 was used to transfer 50 µL from the substrate plate to the enzyme plate and mix the solutions. The plate was transferred to a Synergy 4 Fluorometer (BioTek) and fluorescence was scanned at 30 min, 120 min and 210 min, exciting at 350 nm and measuring emission at 450 nm. Experiments were performed as technical quadruplicates, with representative biological duplication. Raw fluorescence measurements were converted from RFU/s to M/s using a standard curve. Using GraphPad Prism 5 software, the mean and standard error of the replicates were analysed using a Michaelis-Menten model with Least Squares fitting to obtain Vmax and KM values for each experiment. Vmax and KM were plotted against [LV-320] to qualitatively observe any relationship between the variables.
Mass spectrometry ATG4B enzymatic assay
20 µL of immobilized TCEP (ThermoFischer # 77712) in deionized water was diluted in 500 µL of buffer (50 mM Tris, 35 mM NaCl, pH = 8). The sample was centrifuged at 10000 × g during 1 min. The supernatant was removed. This operation was done two more times. ATG4B (45 µM) frozen in buffer (50 mM Tris, 500 mM NaCl, pH 8) was flash thawed and diluted to 15 µM with buffer (50 mM Tris, 35 mM NaCl, pH 8). 15 µL of this ATG4B solution were mixed with the 20 µL rinsed immobilized TCEP solution. The solution was incubated on a carousel at 4 °C for 1 h. This solution was then diluted with 1.84 mL of buffer (50 mM Tris, 35 mM NaCl, pH 8), centrifuged at 10000 × g during 1 min and the supernatant, containing the activated ATG4B (120 nM), was kept. Kinetic determination was performed in triplicate in 1 dram HPLC vials using 350 µL glass inserts. The vials were charged with 5 µL of inhibitor at different concentrations, 63.9 µL of buffer, 20 µL of 120 nM activated ATG4B and 11.1 µL of YFP-LC3-GFP (90 µM). Every 10 min during 40 min, 1 µL was injected into a TOF LC/MS (Agilent 2610). The analysis of the m/z distribution signal resulting from the protein substrate was performed by Agilent MassHunter Workstation software elucidating proteins 20000–80000 Da between 700 m/z and 1800 m/z. Peak intensities were recorded for the parent substrate (72904 Da) and both cleaved peptides (27885 Da and 45036 Da). The amount of cleavage was determined by calculating the value of the formula A/(A + B) where A was the peak height of the 27885 Da residue and B was the peak height of the 72904 Da residue. Each experiment was assessed with a concomitant parallel negative control.
Microscale Thermophoresis
181 µL of buffer (50 mM Tris, 35 mM NaCl, 1 mM TCEP.HCl, 0.05% Tween 20, pH = 8) were added to the 10 µL-aliquot of ATG4B (191 µM). This solution was kept on fridge for 1 h at 4 °C. ATG4B was labeled using the Monolith NT.115TM Protein Labeling Kit RED NHS (NanoTemper Technologies) according to the supplied protocol. The concentration of labeled ATG4B after preparation, purification, and dilution with buffer (50 mM Tris, 35 mM NaCl, 1 mM TCEP.HCl, 0.05% Tween 20, pH = 8) was at 0.17 µM. LV-320 was dissolved in a DMSO/buffer (1/9) solution to 800 µM. Compound was titrated in 1:1 dilution with enzyme. Binding assays were performed by microscale thermophoresis with a Monolith NT.115 instrument (NanoTemper Technologies) using 16 standard capillaries with 0.17 µM protein (5% DMSO) at 20% LED power and 80% MST power. The results were analyzed with NanoTemper software to determine Kd values.
Selectivity assays
Caspase 3 Assay
Inhibition of caspase 3 was assayed using the Abcam Caspase 3 Inhibitor Drug Detection Kit (ab102491) according to the manufacturer’s protocol.
Cathepsin B Assay
The assay was performed essentially as described by Mendieta et al.[60] with Cathepsin B (human, recombinant, active - BioVision #7580-5), Substrate Z-Arg-Arg-AMC (Sigma C5429) and 1 µM Z-VAD-FMK (Adooq #A12373) as positive inhibition control.The assay was maintained at 37 °C and monitored every 2 min for 16 min at 348 nm/440 nm (excitation/emission).
ATG4A Assay
ATG4A (10 µM final) was reduced for 1 hour at 4 °C in assay buffer (50 mM Tris pH 8, 35 mM NaCl, 5 mM EDTA, 1.25 mM TCEP). Enzyme and inhibitor were preincubated for 30 min at room temperature in assay buffer (5% DMSO final). Fluorescent peptide substrate[52] (100 µM final) was added to initiate the reaction. The assay (100 µL total volume in 96 well plate, Corning 3650) was maintained at room temperature and monitored every 15 minutes for 2 h at 350 nm/450 nm (excitation/emission).
Synthesis of analogs
Synthesis of analogs and compound characterization data are provided in the Supplemental Experimental Procedures.
Reagents
Anti-LC3B (#ab48394, Abcam), anti-β-actin (#ab6276, Abcam), anti-ATG4B (#A2981, Sigma), anti-p62 (#P0067, Sigma), anti-GABARAP (#ab109364, Abcam), anti-vinculin (#ab129002, Abcam), goat anti-mouse IgG–horseradish peroxidase (HRP), and goat anti-rabbit IgG–HRP (Santa Cruz Biotechnology) antibodies were used in immunoblotting. Wortmannin (Sigma-Aldrich) was used to block autophagosome formation and bafilomycin A1 (Sigma-Aldrich) was used for autophagy flux assays.
Cell lines and culture conditions
MDA-MB-231, MCF7, and SKBR3 cells (American Type Culture Collection, ATCC), authenticated by isoenzyme and short tandem repeat (STR) analyses), as well as JIMT1 cells (German Collection of Microorganisms and Cell Culture (Deutsche Sammlung von Mikroorganismen und Zellkulturen GmbH), DSMZ; authenticated by STR analyses) were maintained in Gibco DMEM (Life Technologies) supplemented with 10% fetal bovine serum (FBS) and confirmed to be mycoplasma negative. SKBR3 cells (ATCC) stably transfected with hrGFP-LC3B[65] or MDA-MB-231 cells stably transfected with mRFP-eGFP-LC3B were grown in DMEM supplemented with 10% FBS, 20 mM HEPES, and 1X non-essential amino acids (Gibco) with Geneticin (G418). All cells were maintained at 37 °C with 5% CO2 and 95% humidity.
siRNA transfection
For western blot analysis, cells were plated in 6-well plates. For the experiments involving fluorescence microscopy, cells were plated in 8-well chamber slides. The following day, cells were transfected with 75 pmol of either ATG4B siRNA (Fig. S12) or a scramble medium GC siRNA negative control (Invitrogen) using Lipofectamine RNAiMAXTM (Invitrogen) as per manufacturer’s recommendations. Seventy-two hours after the transfection, cells were harvested. For the assessment of autophagic flux, bafilomycin A1 (40 nM) was added to the respective wells five hours before harvesting the cells. For the experiments involving starvation, five hours before harvesting, the medium in respective wells was replaced with Earl’s Balanced Salt Solution (EBSS).
ATG4B KO cell line
Single-guide RNA (sgRNA) sequences targeting ATG4B were selected from the GeCKO V2 library (Addgene) (ATG4B-1: TCCTGTCGATGAATGCGTTG) and ligated into pSpCas9(BB)-2A-GFP (PX458) (Addgene). JIMT-1 cells were transfected with the resultant CRISPR plasmid. Monoclonal cell lines were established by FACS sorting GFP-positive cells into single-cell culture 48 hours after transfection and verified with western blotting.
Confocal microscopy
SKBR3 cells stably transfected with hrGFP-LC3B or MDA-MB-231 cells stably transfected with mRFP-eGFP-LC3B were used for monitoring autophagy.For each experiment, media was replenished every day after initial plating and before treatment. At the end of the experiment the cells were fixed in 4% PFA for 20 minutes and then rinsed with PBS. Cells were then mounted using SlowFade Gold Antifade with DAPI (Invitrogen). For Lysotracker Red®(LTR) experiments, parental MDA-MB-231 cells were incubated with 50 µM of LTR for 5 min in the dark CO2 incubator, rinsed with PBS and fixed with 4% PFA for 20 min. Fixed cells were incubated in DRAQ5 (1:500) in PBS and 100 µg/mL RNaseA for 10 minutes at room temperature before being mounted with SlowFade Gold Antifade (Invitrogen). Leica TCS SP8 inverted confocal microscope with a Leica HC PL APO 63x/1.40 oil objective and LAS AF software (Leica) were used for imaging the cells. For each treatment, the number of green, red and yellow (i.e. red/green overlap where applicable) puncta per cell were determined for at least 100 cells. Puncta counting was performed using the OpenCV Python package; a contours discovery algorithm[66] was applied to images pre-processed by filtering colors and applying a Gaussian filter and adaptive threshold. LTR fluorescent intensity was measured by the mean gray value from the unadjusted images taken with the same microscope settings of the LTR channel and subtracting the mean background using Image J 1.45 s (https://imagej.nih.gov/ij/) with cells counted by DRAQ5 positive nuclei.
DQ-BSA Assay for Lysosomal Activity
A DQ-BSA assay was used to determine lysosomal degradative activity as described[57]. SKBR3 cells were incubated overnight in 10 µg/ml DQ-Red BSA (Thermo Fisher D12051) along with either DMSO (0.5%), 20 µM CQ, 75 µM LV-320 or 100 µM LV-320. All samples contained equal concentration of DMSO (0.5%) in regular growth media (Gibco DMEM + 10% FBS + 20 mM HEPES + 1X NEAA). Cells were analyzed 24 h later for DQ-Red BSA fluorescence using a Fortessa (BD Biosciences) flow cytometer, using Sytox Green (Thermo Fisher S7020) to exclude dead cells. Data were analyzed using FlowJo software.
High Content Screening assay
High-throughput fluorescence microscopy was performed at room-temperature on the InCell Analyzer 1000 (GE Healthcare) using the 20X objective to view Hoescht 33342 nuclear stain, ethidium homodimer (EthD1) viability stain and GFP-LC3 puncta in SKBR3-hrGFP-LC3B cells. Thirty min prior to imaging, cells were incubated at 37 °C with 4 µM Hoechst 33342 (Invitrogen) and 0.5 µM EthD1 (Invitrogen). Image analysis was performed using InCell Developer Toolbox (Ver. 1.6, GE Healthcare). Individual cells were identified with segmentation of nuclei based on Hoechst 33342 staining. Cell borders were determined by defining a radius around the nucleus. Cells were classified as “dead” if the defined cell overlapped by at least 50% with the EthD1 signal. The number of GFP-LC3 puncta within each live cell was then counted, as well as the number of live cells with at least 5 puncta. Puncta were defined as GFP positive structures of at least 1 pixel with a form factor (estimate of circularity) of at least 0.4.
Protein extraction and western blot analysis
Frozen cell pellets were lysed using RIPA lysis buffer (Santa-Cruz, ref: SC24948) plus complete protease inhibitor cocktail (Roche, ref: 11836153001). The amount of proteins in cell lysates was determined by BCA protein assay (Thermo Scientific, ref: 23225), and 10 µg of protein were loaded on 10% NuPAGE Bis-Tris gel (Invitrogen) for separation and transferred to PVDF membrane (BioRad). BOLT and NUPAGE Bis-Tris 4–12% gradient gels (Invitrogen) were used for separation of pro-LC3B and LC3B-II. Membranes were blocked in 2% milk and incubated in primary antibodies overnight at 4 °C. Primary antibodies were diluted in 2% milk and included: p62 (1:1000; Sigma, ref: P0067), LC3B (1:1000; Abcam, ref: ab48394), GABARAP (1:1000; Abcam, ref: ab109364), beta-actin (1:10000; Abcam, ref: ab6276), and vinculin (1:1000; Abcam, ref: ab129002). Membranes were then washed with 1X PBS-T (0.1%), incubated in HRP-conjugated secondary antibodies and detected using Bio-Rad Clarity Western ECL substrate and the electronic Bio-Rad ChemiDoc MP System. Densitometry was performed using Image Lab software (Bio-Rad), and the relative levels of LC3B-II were determined by first normalizing to the actin loading controls then to the DMSO controls.
Animal studies
Animal protocols were reviewed and approved by the Institutional Animal Care Committee (IACC) at the University of British Columbia (Vancouver, BC, Canada) and at Simon Fraser University before conducting experiments. The care, housing, and use of animals were performed in accordance with the Canadian Council on Animal Care Guidelines.
Pharmacokinetic assay
LV-320 was dissolved in DMSO/Kolliphore/EtOH/methylcellulose/ammonia/water 6.67:1.33:5:1:0.09:85.91 to give a concentration of 10 mg/mL. Three BL/6 female mice (age 12 weeks) were administered LV-320 at appropriate concentration in vehicle at 5 ml/kg per os. Blood samples (approximately 50 µL) were collected at predetermined intervals. Blood samples were placed into tubes containing sodium heparin and centrifuged at 10000 × g for 14 min to obtain the plasma samples. Concentrations of LV-320 in plasma were determined (non-blinded) using HPLC analysis after a 1:1 dilution with CH3CN and centrifugation at 14000 × g for 5 min.
In vivo autophagy assay
GFP–LC3mice were kindly provided by Dr. Mizushima (Tokyo Medical and Dental University, Japan)[67]. The animals (females, 9–14 weeks) were allocated into three groups (n = 6 per group with equivalent average body weights) to receive a treatment with vehicle solution or LV-320 at the dose of 100 mg/kg or 200 mg/kg twice a day, for a total of 3 doses. The treatment was given by oral gavage. Four hours after the last dose the mice were terminated, blood samples were collected and the livers were harvested for the analysis.
Assessment of GFP–LC3 puncta in vivo
After treatment, mouse liver tissues were collected and fixed with 4% paraformaldehyde dissolved in 0.1 M Na-phosphate buffer (pH 7.4) for 4 h, incubated overnight with 15% sucrose/PBS, and 30% sucrose/PBS for 4 h. Tissues were then embedded in OCT compound (Tissue-Tek) and stored at −80 °C. Liver OCT blocks were sectioned into 6 μm slides and countered stained with DAPI-containing mounting medium. Five randomly selected fields from each sample were examined (scorer was blinded) under 40x oil lens of the confocal microscope. Z-stack images were taken from each field with fixed settings at the laser power and exposure time for all samples. Green for GFP-LC3 and blue for nucleus (DAPI). The percentage of GFP-LC3 puncta positive cells from 5 fields were calculated for each sample; and 6 samples from each treatment condition were grouped for statistical analysis. Six animals per treatment group were used based on results in previous studies validating this method as a way to quantify GFP-LC3 puncta[67].
Statistical analyses
For statistical analyses, a one-way ANOVA with a Dunnett’s post test was performed using GraphPad Prism version 7.0 for Windows (GraphPad Software, San Diego California USA, www.graphpad.com) unless stated otherwise. Differences between means were considered significant if the resulting p-value was less than 0.05.
Data availability
The datasets generated during and/or analysed during the current study are available from the corresponding authors on reasonable request.
Authors: Katharina Rothe; Hanyang Lin; Kevin B L Lin; Amy Leung; Hui Mi Wang; Mehrnoush Malekesmaeili; Ryan R Brinkman; Donna L Forrest; Sharon M Gorski; Xiaoyan Jiang Journal: Blood Date: 2014-04-22 Impact factor: 22.113
Authors: Tianzhi Huang; Chung Kwon Kim; Angel A Alvarez; Rajendra P Pangeni; Xuechao Wan; Xiao Song; Taiping Shi; Yongyong Yang; Namratha Sastry; Craig M Horbinski; Songjian Lu; Roger Stupp; John A Kessler; Ryo Nishikawa; Ichiro Nakano; Erik P Sulman; Xinghua Lu; Charles David James; Xiao-Ming Yin; Bo Hu; Shi-Yuan Cheng Journal: Cancer Cell Date: 2017-12-11 Impact factor: 31.743
Authors: Svetlana Bortnik; Courtney Choutka; Hugo M Horlings; Samuel Leung; Jennifer H Baker; Chandra Lebovitz; Wieslawa H Dragowska; Nancy E Go; Marcel B Bally; Andrew I Minchinton; Karen A Gelmon; Sharon M Gorski Journal: Oncotarget Date: 2016-10-11
Authors: Daniel J Klionsky; Amal Kamal Abdel-Aziz; Sara Abdelfatah; Mahmoud Abdellatif; Asghar Abdoli; Steffen Abel; Hagai Abeliovich; Marie H Abildgaard; Yakubu Princely Abudu; Abraham Acevedo-Arozena; Iannis E Adamopoulos; Khosrow Adeli; Timon E Adolph; Annagrazia Adornetto; Elma Aflaki; Galila Agam; Anupam Agarwal; Bharat B Aggarwal; Maria Agnello; Patrizia Agostinis; Javed N Agrewala; Alexander Agrotis; Patricia V Aguilar; S Tariq Ahmad; Zubair M Ahmed; Ulises Ahumada-Castro; Sonja Aits; Shu Aizawa; Yunus Akkoc; Tonia Akoumianaki; Hafize Aysin Akpinar; Ahmed M Al-Abd; Lina Al-Akra; Abeer Al-Gharaibeh; Moulay A Alaoui-Jamali; Simon Alberti; Elísabet Alcocer-Gómez; Cristiano Alessandri; Muhammad Ali; M Abdul Alim Al-Bari; Saeb Aliwaini; Javad Alizadeh; Eugènia Almacellas; Alexandru Almasan; Alicia Alonso; Guillermo D Alonso; Nihal Altan-Bonnet; Dario C Altieri; Élida M C Álvarez; Sara Alves; Cristine Alves da Costa; Mazen M Alzaharna; Marialaura Amadio; Consuelo Amantini; Cristina Amaral; Susanna Ambrosio; Amal O Amer; Veena Ammanathan; Zhenyi An; Stig U Andersen; Shaida A Andrabi; Magaiver Andrade-Silva; Allen M Andres; Sabrina Angelini; David Ann; Uche C Anozie; Mohammad Y Ansari; Pedro Antas; Adam Antebi; Zuriñe Antón; Tahira Anwar; Lionel Apetoh; Nadezda Apostolova; Toshiyuki Araki; Yasuhiro Araki; Kohei Arasaki; Wagner L Araújo; Jun Araya; Catherine Arden; Maria-Angeles Arévalo; Sandro Arguelles; Esperanza Arias; Jyothi Arikkath; Hirokazu Arimoto; Aileen R Ariosa; Darius Armstrong-James; Laetitia Arnauné-Pelloquin; Angeles Aroca; Daniela S Arroyo; Ivica Arsov; Rubén Artero; Dalia Maria Lucia Asaro; Michael Aschner; Milad Ashrafizadeh; Osnat Ashur-Fabian; Atanas G Atanasov; Alicia K Au; Patrick Auberger; Holger W Auner; Laure Aurelian; Riccardo Autelli; Laura Avagliano; Yenniffer Ávalos; Sanja Aveic; Célia Alexandra Aveleira; Tamar Avin-Wittenberg; Yucel Aydin; Scott Ayton; Srinivas Ayyadevara; Maria Azzopardi; Misuzu Baba; Jonathan M Backer; Steven K Backues; Dong-Hun Bae; Ok-Nam Bae; Soo Han Bae; Eric H Baehrecke; Ahruem Baek; Seung-Hoon Baek; Sung Hee Baek; Giacinto Bagetta; Agnieszka Bagniewska-Zadworna; Hua Bai; Jie Bai; Xiyuan Bai; Yidong Bai; Nandadulal Bairagi; Shounak Baksi; Teresa Balbi; Cosima T Baldari; Walter Balduini; Andrea Ballabio; Maria Ballester; Salma Balazadeh; Rena Balzan; Rina Bandopadhyay; Sreeparna Banerjee; Sulagna Banerjee; Ágnes Bánréti; Yan Bao; Mauricio S Baptista; Alessandra Baracca; Cristiana Barbati; Ariadna Bargiela; Daniela Barilà; Peter G Barlow; Sami J Barmada; Esther Barreiro; George E Barreto; Jiri Bartek; Bonnie Bartel; Alberto Bartolome; Gaurav R Barve; Suresh H Basagoudanavar; Diane C Bassham; Robert C Bast; Alakananda Basu; Henri Batoko; Isabella Batten; Etienne E Baulieu; Bradley L Baumgarner; Jagadeesh Bayry; Rupert Beale; Isabelle Beau; Florian Beaumatin; Luiz R G Bechara; George R Beck; Michael F Beers; Jakob Begun; Christian Behrends; Georg M N Behrens; Roberto Bei; Eloy Bejarano; Shai Bel; Christian Behl; Amine Belaid; Naïma Belgareh-Touzé; Cristina Bellarosa; Francesca Belleudi; Melissa Belló Pérez; Raquel Bello-Morales; Jackeline Soares de Oliveira Beltran; Sebastián Beltran; Doris Mangiaracina Benbrook; Mykolas Bendorius; Bruno A Benitez; Irene Benito-Cuesta; Julien Bensalem; Martin W Berchtold; Sabina Berezowska; Daniele Bergamaschi; Matteo Bergami; Andreas Bergmann; Laura Berliocchi; Clarisse Berlioz-Torrent; Amélie Bernard; Lionel Berthoux; Cagri G Besirli; Sebastien Besteiro; Virginie M Betin; Rudi Beyaert; Jelena S Bezbradica; Kiran Bhaskar; Ingrid Bhatia-Kissova; Resham Bhattacharya; Sujoy Bhattacharya; Shalmoli Bhattacharyya; Md Shenuarin Bhuiyan; Sujit Kumar Bhutia; Lanrong Bi; Xiaolin Bi; Trevor J Biden; Krikor Bijian; Viktor A Billes; Nadine Binart; Claudia Bincoletto; Asa B Birgisdottir; Geir Bjorkoy; Gonzalo Blanco; Ana Blas-Garcia; Janusz Blasiak; Robert Blomgran; Klas Blomgren; Janice S Blum; Emilio Boada-Romero; Mirta Boban; Kathleen Boesze-Battaglia; Philippe Boeuf; Barry Boland; Pascale Bomont; Paolo Bonaldo; Srinivasa Reddy Bonam; Laura Bonfili; Juan S Bonifacino; Brian A Boone; Martin D Bootman; Matteo Bordi; Christoph Borner; Beat C Bornhauser; Gautam Borthakur; Jürgen Bosch; Santanu Bose; Luis M Botana; Juan Botas; Chantal M Boulanger; Michael E Boulton; Mathieu Bourdenx; Benjamin Bourgeois; Nollaig M Bourke; Guilhem Bousquet; Patricia Boya; Peter V Bozhkov; Luiz H M Bozi; Tolga O Bozkurt; Doug E Brackney; Christian H Brandts; Ralf J Braun; Gerhard H Braus; Roberto Bravo-Sagua; José M Bravo-San Pedro; Patrick Brest; Marie-Agnès Bringer; Alfredo Briones-Herrera; V Courtney Broaddus; Peter Brodersen; Jeffrey L Brodsky; Steven L Brody; Paola G Bronson; Jeff M Bronstein; Carolyn N Brown; Rhoderick E Brown; Patricia C Brum; John H Brumell; Nicola Brunetti-Pierri; Daniele Bruno; Robert J Bryson-Richardson; Cecilia Bucci; Carmen Buchrieser; Marta Bueno; Laura Elisa Buitrago-Molina; Simone Buraschi; Shilpa Buch; J Ross Buchan; Erin M Buckingham; Hikmet Budak; Mauricio Budini; Geert Bultynck; Florin Burada; Joseph R Burgoyne; M Isabel Burón; Victor Bustos; Sabrina Büttner; Elena Butturini; Aaron Byrd; Isabel Cabas; Sandra Cabrera-Benitez; Ken Cadwell; Jingjing Cai; Lu Cai; Qian Cai; Montserrat Cairó; Jose A Calbet; Guy A Caldwell; Kim A Caldwell; Jarrod A Call; Riccardo Calvani; Ana C Calvo; Miguel Calvo-Rubio Barrera; Niels Os Camara; Jacques H Camonis; Nadine Camougrand; Michelangelo Campanella; Edward M Campbell; François-Xavier Campbell-Valois; Silvia Campello; Ilaria Campesi; Juliane C Campos; Olivier Camuzard; Jorge Cancino; Danilo Candido de Almeida; Laura Canesi; Isabella Caniggia; Barbara Canonico; Carles Cantí; Bin Cao; Michele Caraglia; Beatriz Caramés; Evie H Carchman; Elena Cardenal-Muñoz; Cesar Cardenas; Luis Cardenas; Sandra M Cardoso; Jennifer S Carew; Georges F Carle; Gillian Carleton; Silvia Carloni; Didac Carmona-Gutierrez; Leticia A Carneiro; Oliana Carnevali; Julian M Carosi; Serena Carra; Alice Carrier; Lucie Carrier; Bernadette Carroll; A Brent Carter; Andreia Neves Carvalho; Magali Casanova; Caty Casas; Josefina Casas; Chiara Cassioli; Eliseo F Castillo; Karen Castillo; Sonia Castillo-Lluva; Francesca Castoldi; Marco Castori; Ariel F Castro; Margarida Castro-Caldas; Javier Castro-Hernandez; Susana Castro-Obregon; Sergio D Catz; Claudia Cavadas; Federica Cavaliere; Gabriella Cavallini; Maria Cavinato; Maria L Cayuela; Paula Cebollada Rica; Valentina Cecarini; Francesco Cecconi; Marzanna Cechowska-Pasko; Simone Cenci; Victòria Ceperuelo-Mallafré; João J Cerqueira; Janete M Cerutti; Davide Cervia; Vildan Bozok Cetintas; Silvia Cetrullo; Han-Jung Chae; Andrei S Chagin; Chee-Yin Chai; Gopal Chakrabarti; Oishee Chakrabarti; Tapas Chakraborty; Trinad Chakraborty; Mounia Chami; Georgios Chamilos; David W Chan; Edmond Y W Chan; Edward D Chan; H Y Edwin Chan; Helen H Chan; Hung Chan; Matthew T V Chan; Yau Sang Chan; Partha K Chandra; Chih-Peng Chang; Chunmei Chang; Hao-Chun Chang; Kai Chang; Jie Chao; Tracey Chapman; Nicolas Charlet-Berguerand; Samrat Chatterjee; Shail K Chaube; Anu Chaudhary; Santosh Chauhan; Edward Chaum; Frédéric Checler; Michael E Cheetham; Chang-Shi Chen; Guang-Chao Chen; Jian-Fu Chen; Liam L Chen; Leilei Chen; Lin Chen; Mingliang Chen; Mu-Kuan Chen; Ning Chen; Quan Chen; Ruey-Hwa Chen; Shi Chen; Wei Chen; Weiqiang Chen; Xin-Ming Chen; Xiong-Wen Chen; Xu Chen; Yan Chen; Ye-Guang Chen; Yingyu Chen; Yongqiang Chen; Yu-Jen Chen; Yue-Qin Chen; Zhefan Stephen Chen; Zhi Chen; Zhi-Hua Chen; Zhijian J Chen; Zhixiang Chen; Hanhua Cheng; Jun Cheng; Shi-Yuan Cheng; Wei Cheng; Xiaodong Cheng; Xiu-Tang Cheng; Yiyun Cheng; Zhiyong Cheng; Zhong Chen; Heesun Cheong; Jit Kong Cheong; Boris V Chernyak; Sara Cherry; Chi Fai Randy Cheung; Chun Hei Antonio Cheung; King-Ho Cheung; Eric Chevet; Richard J Chi; Alan Kwok Shing Chiang; Ferdinando Chiaradonna; Roberto Chiarelli; Mario Chiariello; Nathalia Chica; Susanna Chiocca; Mario Chiong; Shih-Hwa Chiou; Abhilash I Chiramel; Valerio Chiurchiù; Dong-Hyung Cho; Seong-Kyu Choe; Augustine M K Choi; Mary E Choi; Kamalika Roy Choudhury; Norman S Chow; Charleen T Chu; Jason P Chua; John Jia En Chua; Hyewon Chung; Kin Pan Chung; Seockhoon Chung; So-Hyang Chung; Yuen-Li Chung; Valentina Cianfanelli; Iwona A Ciechomska; Mariana Cifuentes; Laura Cinque; Sebahattin Cirak; Mara Cirone; Michael J Clague; Robert Clarke; Emilio Clementi; Eliana M Coccia; Patrice Codogno; Ehud Cohen; Mickael M Cohen; Tania Colasanti; Fiorella Colasuonno; Robert A Colbert; Anna Colell; Miodrag Čolić; Nuria S Coll; Mark O Collins; María I Colombo; Daniel A Colón-Ramos; Lydie Combaret; Sergio Comincini; Márcia R Cominetti; Antonella Consiglio; Andrea Conte; Fabrizio Conti; Viorica Raluca Contu; Mark R Cookson; Kevin M Coombs; Isabelle Coppens; Maria Tiziana Corasaniti; Dale P Corkery; Nils Cordes; Katia Cortese; Maria do Carmo Costa; Sarah Costantino; Paola Costelli; Ana Coto-Montes; Peter J Crack; Jose L Crespo; Alfredo Criollo; Valeria Crippa; Riccardo Cristofani; Tamas Csizmadia; Antonio Cuadrado; Bing Cui; Jun Cui; Yixian Cui; Yong Cui; Emmanuel Culetto; Andrea C Cumino; Andrey V Cybulsky; Mark J Czaja; Stanislaw J Czuczwar; Stefania D'Adamo; Marcello D'Amelio; Daniela D'Arcangelo; Andrew C D'Lugos; Gabriella D'Orazi; James A da Silva; Hormos Salimi Dafsari; Ruben K Dagda; Yasin Dagdas; Maria Daglia; Xiaoxia Dai; Yun Dai; Yuyuan Dai; Jessica Dal Col; Paul Dalhaimer; Luisa Dalla Valle; Tobias Dallenga; Guillaume Dalmasso; Markus Damme; Ilaria Dando; Nico P Dantuma; April L Darling; Hiranmoy Das; Srinivasan Dasarathy; Santosh K Dasari; Srikanta Dash; Oliver Daumke; Adrian N Dauphinee; Jeffrey S Davies; Valeria A Dávila; Roger J Davis; Tanja Davis; Sharadha Dayalan Naidu; Francesca De Amicis; Karolien De Bosscher; Francesca De Felice; Lucia De Franceschi; Chiara De Leonibus; Mayara G de Mattos Barbosa; Guido R Y De Meyer; Angelo De Milito; Cosimo De Nunzio; Clara De Palma; Mauro De Santi; Claudio De Virgilio; Daniela De Zio; Jayanta Debnath; Brian J DeBosch; Jean-Paul Decuypere; Mark A Deehan; Gianluca Deflorian; James DeGregori; Benjamin Dehay; Gabriel Del Rio; Joe R Delaney; Lea M D Delbridge; Elizabeth Delorme-Axford; M Victoria Delpino; Francesca Demarchi; Vilma Dembitz; Nicholas D Demers; Hongbin Deng; Zhiqiang Deng; Joern Dengjel; Paul Dent; Donna Denton; Melvin L DePamphilis; Channing J Der; Vojo Deretic; Albert Descoteaux; Laura Devis; Sushil Devkota; Olivier Devuyst; Grant Dewson; Mahendiran Dharmasivam; Rohan Dhiman; Diego di Bernardo; Manlio Di Cristina; Fabio Di Domenico; Pietro Di Fazio; Alessio Di Fonzo; Giovanni Di Guardo; Gianni M Di Guglielmo; Luca Di Leo; Chiara Di Malta; Alessia Di Nardo; Martina Di Rienzo; Federica Di Sano; George Diallinas; Jiajie Diao; Guillermo Diaz-Araya; Inés Díaz-Laviada; Jared M Dickinson; Marc Diederich; Mélanie Dieudé; Ivan Dikic; Shiping Ding; Wen-Xing Ding; Luciana Dini; Jelena Dinić; Miroslav Dinic; Albena T Dinkova-Kostova; Marc S Dionne; Jörg H W Distler; Abhinav Diwan; Ian M C Dixon; Mojgan Djavaheri-Mergny; Ina Dobrinski; Oxana Dobrovinskaya; Radek Dobrowolski; Renwick C J Dobson; Jelena Đokić; Serap Dokmeci Emre; Massimo Donadelli; Bo Dong; Xiaonan Dong; Zhiwu Dong; Gerald W Dorn Ii; Volker Dotsch; Huan Dou; Juan Dou; Moataz Dowaidar; Sami Dridi; Liat Drucker; Ailian Du; Caigan Du; Guangwei Du; Hai-Ning Du; Li-Lin Du; André du Toit; Shao-Bin Duan; Xiaoqiong Duan; Sónia P Duarte; Anna Dubrovska; Elaine A Dunlop; Nicolas Dupont; Raúl V Durán; Bilikere S Dwarakanath; Sergey A Dyshlovoy; Darius Ebrahimi-Fakhari; Leopold Eckhart; Charles L Edelstein; Thomas Efferth; Eftekhar Eftekharpour; Ludwig Eichinger; Nabil Eid; Tobias Eisenberg; N Tony Eissa; Sanaa Eissa; Miriam Ejarque; Abdeljabar El Andaloussi; Nazira El-Hage; Shahenda El-Naggar; Anna Maria Eleuteri; Eman S El-Shafey; Mohamed Elgendy; Aristides G Eliopoulos; María M Elizalde; Philip M Elks; Hans-Peter Elsasser; Eslam S Elsherbiny; Brooke M Emerling; N C Tolga Emre; Christina H Eng; Nikolai Engedal; Anna-Mart Engelbrecht; Agnete S T Engelsen; Jorrit M Enserink; Ricardo Escalante; Audrey Esclatine; Mafalda Escobar-Henriques; Eeva-Liisa Eskelinen; Lucile Espert; Makandjou-Ola Eusebio; Gemma Fabrias; Cinzia Fabrizi; Antonio Facchiano; Francesco Facchiano; Bengt Fadeel; Claudio Fader; Alex C Faesen; W Douglas Fairlie; Alberto Falcó; Bjorn H Falkenburger; Daping Fan; Jie Fan; Yanbo Fan; Evandro F Fang; Yanshan Fang; Yognqi Fang; Manolis Fanto; Tamar Farfel-Becker; Mathias Faure; Gholamreza Fazeli; Anthony O Fedele; Arthur M Feldman; Du Feng; Jiachun Feng; Lifeng Feng; Yibin Feng; Yuchen Feng; Wei Feng; Thais Fenz Araujo; Thomas A Ferguson; Álvaro F Fernández; Jose C Fernandez-Checa; Sonia Fernández-Veledo; Alisdair R Fernie; Anthony W Ferrante; Alessandra Ferraresi; Merari F Ferrari; Julio C B Ferreira; Susan Ferro-Novick; Antonio Figueras; Riccardo Filadi; Nicoletta Filigheddu; Eduardo Filippi-Chiela; Giuseppe Filomeni; Gian Maria Fimia; Vittorio Fineschi; Francesca Finetti; Steven Finkbeiner; Edward A Fisher; Paul B Fisher; Flavio Flamigni; Steven J Fliesler; Trude H Flo; Ida Florance; Oliver Florey; Tullio Florio; Erika Fodor; Carlo Follo; Edward A Fon; Antonella Forlino; Francesco Fornai; Paola Fortini; Anna Fracassi; Alessandro Fraldi; Brunella Franco; Rodrigo Franco; Flavia Franconi; Lisa B Frankel; Scott L Friedman; Leopold F Fröhlich; Gema Frühbeck; Jose M Fuentes; Yukio Fujiki; Naonobu Fujita; Yuuki Fujiwara; Mitsunori Fukuda; Simone Fulda; Luc Furic; Norihiko Furuya; Carmela Fusco; Michaela U Gack; Lidia Gaffke; Sehamuddin Galadari; Alessia Galasso; Maria F Galindo; Sachith Gallolu Kankanamalage; Lorenzo Galluzzi; Vincent Galy; Noor Gammoh; Boyi Gan; Ian G Ganley; Feng Gao; Hui Gao; Minghui Gao; Ping Gao; Shou-Jiang Gao; Wentao Gao; Xiaobo Gao; Ana Garcera; Maria Noé Garcia; Verónica E Garcia; Francisco García-Del Portillo; Vega Garcia-Escudero; Aracely Garcia-Garcia; Marina Garcia-Macia; Diana García-Moreno; Carmen Garcia-Ruiz; Patricia García-Sanz; Abhishek D Garg; Ricardo Gargini; Tina Garofalo; Robert F Garry; Nils C Gassen; Damian Gatica; Liang Ge; Wanzhong Ge; Ruth Geiss-Friedlander; Cecilia Gelfi; Pascal Genschik; Ian E Gentle; Valeria Gerbino; Christoph Gerhardt; Kyla Germain; Marc Germain; David A Gewirtz; Elham Ghasemipour Afshar; Saeid Ghavami; Alessandra Ghigo; Manosij Ghosh; Georgios Giamas; Claudia Giampietri; Alexandra Giatromanolaki; Gary E Gibson; Spencer B Gibson; Vanessa Ginet; Edward Giniger; Carlotta Giorgi; Henrique Girao; Stephen E Girardin; Mridhula Giridharan; Sandy Giuliano; Cecilia Giulivi; Sylvie Giuriato; Julien Giustiniani; Alexander Gluschko; Veit Goder; Alexander Goginashvili; Jakub Golab; David C Goldstone; Anna Golebiewska; Luciana R Gomes; Rodrigo Gomez; Rubén Gómez-Sánchez; Maria Catalina Gomez-Puerto; Raquel Gomez-Sintes; Qingqiu Gong; Felix M Goni; Javier González-Gallego; Tomas Gonzalez-Hernandez; Rosa A Gonzalez-Polo; Jose A Gonzalez-Reyes; Patricia González-Rodríguez; Ing Swie Goping; Marina S Gorbatyuk; Nikolai V Gorbunov; Kıvanç Görgülü; Roxana M Gorojod; Sharon M Gorski; Sandro Goruppi; Cecilia Gotor; Roberta A Gottlieb; Illana Gozes; Devrim Gozuacik; Martin Graef; Markus H Gräler; Veronica Granatiero; Daniel Grasso; Joshua P Gray; Douglas R Green; Alexander Greenhough; Stephen L Gregory; Edward F Griffin; Mark W Grinstaff; Frederic Gros; Charles Grose; Angelina S Gross; Florian Gruber; Paolo Grumati; Tilman Grune; Xueyan Gu; Jun-Lin Guan; Carlos M Guardia; Kishore Guda; Flora Guerra; Consuelo Guerri; Prasun Guha; Carlos Guillén; Shashi Gujar; Anna Gukovskaya; Ilya Gukovsky; Jan Gunst; Andreas Günther; Anyonya R Guntur; Chuanyong Guo; Chun Guo; Hongqing Guo; Lian-Wang Guo; Ming Guo; Pawan Gupta; Shashi Kumar Gupta; Swapnil Gupta; Veer Bala Gupta; Vivek Gupta; Asa B Gustafsson; David D Gutterman; Ranjitha H B; Annakaisa Haapasalo; James E Haber; Aleksandra Hać; Shinji Hadano; Anders J Hafrén; Mansour Haidar; Belinda S Hall; Gunnel Halldén; Anne Hamacher-Brady; Andrea Hamann; Maho Hamasaki; Weidong Han; Malene Hansen; Phyllis I Hanson; Zijian Hao; Masaru Harada; Ljubica Harhaji-Trajkovic; Nirmala Hariharan; Nigil Haroon; James Harris; Takafumi Hasegawa; Noor Hasima Nagoor; Jeffrey A Haspel; Volker Haucke; Wayne D Hawkins; Bruce A Hay; Cole M Haynes; Soren B Hayrabedyan; Thomas S Hays; Congcong He; Qin He; Rong-Rong He; You-Wen He; Yu-Ying He; Yasser Heakal; Alexander M Heberle; J Fielding Hejtmancik; Gudmundur Vignir Helgason; Vanessa Henkel; Marc Herb; Alexander Hergovich; Anna Herman-Antosiewicz; Agustín Hernández; Carlos Hernandez; Sergio Hernandez-Diaz; Virginia Hernandez-Gea; Amaury Herpin; Judit Herreros; Javier H Hervás; Daniel Hesselson; Claudio Hetz; Volker T Heussler; Yujiro Higuchi; Sabine Hilfiker; Joseph A Hill; William S Hlavacek; Emmanuel A Ho; Idy H T Ho; Philip Wing-Lok Ho; Shu-Leong Ho; Wan Yun Ho; G Aaron Hobbs; Mark Hochstrasser; Peter H M Hoet; Daniel Hofius; Paul Hofman; Annika Höhn; Carina I Holmberg; Jose R Hombrebueno; Chang-Won Hong Yi-Ren Hong; Lora V Hooper; Thorsten Hoppe; Rastislav Horos; Yujin Hoshida; I-Lun Hsin; Hsin-Yun Hsu; Bing Hu; Dong Hu; Li-Fang Hu; Ming Chang Hu; Ronggui Hu; Wei Hu; Yu-Chen Hu; Zhuo-Wei Hu; Fang Hua; Jinlian Hua; Yingqi Hua; Chongmin Huan; Canhua Huang; Chuanshu Huang; Chuanxin Huang; Chunling Huang; Haishan Huang; Kun Huang; Michael L H Huang; Rui Huang; Shan Huang; Tianzhi Huang; Xing Huang; Yuxiang Jack Huang; Tobias B Huber; Virginie Hubert; Christian A Hubner; Stephanie M Hughes; William E Hughes; Magali Humbert; Gerhard Hummer; James H Hurley; Sabah Hussain; Salik Hussain; Patrick J Hussey; Martina Hutabarat; Hui-Yun Hwang; Seungmin Hwang; Antonio Ieni; Fumiyo Ikeda; Yusuke Imagawa; Yuzuru Imai; Carol Imbriano; Masaya Imoto; Denise M Inman; Ken Inoki; Juan Iovanna; Renato V Iozzo; Giuseppe Ippolito; Javier E Irazoqui; Pablo Iribarren; Mohd Ishaq; Makoto Ishikawa; Nestor Ishimwe; Ciro Isidoro; Nahed Ismail; Shohreh Issazadeh-Navikas; Eisuke Itakura; Daisuke Ito; Davor Ivankovic; Saška Ivanova; Anand Krishnan V Iyer; José M Izquierdo; Masanori Izumi; Marja Jäättelä; Majid Sakhi Jabir; William T Jackson; Nadia Jacobo-Herrera; Anne-Claire Jacomin; Elise Jacquin; Pooja Jadiya; Hartmut Jaeschke; Chinnaswamy Jagannath; Arjen J Jakobi; Johan Jakobsson; Bassam Janji; Pidder Jansen-Dürr; Patric J Jansson; Jonathan Jantsch; Sławomir Januszewski; Alagie Jassey; Steve Jean; Hélène Jeltsch-David; Pavla Jendelova; Andreas Jenny; Thomas E Jensen; Niels Jessen; Jenna L Jewell; Jing Ji; Lijun Jia; Rui Jia; Liwen Jiang; Qing Jiang; Richeng Jiang; Teng Jiang; Xuejun Jiang; Yu Jiang; Maria Jimenez-Sanchez; Eun-Jung Jin; Fengyan Jin; Hongchuan Jin; Li Jin; Luqi Jin; Meiyan Jin; Si Jin; Eun-Kyeong Jo; Carine Joffre; Terje Johansen; Gail V W Johnson; Simon A Johnston; Eija Jokitalo; Mohit Kumar Jolly; Leo A B Joosten; Joaquin Jordan; Bertrand Joseph; Dianwen Ju; Jeong-Sun Ju; Jingfang Ju; Esmeralda Juárez; Delphine Judith; Gábor Juhász; Youngsoo Jun; Chang Hwa Jung; Sung-Chul Jung; Yong Keun Jung; Heinz Jungbluth; Johannes Jungverdorben; Steffen Just; Kai Kaarniranta; Allen Kaasik; Tomohiro Kabuta; Daniel Kaganovich; Alon Kahana; Renate Kain; Shinjo Kajimura; Maria Kalamvoki; Manjula Kalia; Danuta S Kalinowski; Nina Kaludercic; Ioanna Kalvari; Joanna Kaminska; Vitaliy O Kaminskyy; Hiromitsu Kanamori; Keizo Kanasaki; Chanhee Kang; Rui Kang; Sang Sun Kang; Senthilvelrajan Kaniyappan; Tomotake Kanki; Thirumala-Devi Kanneganti; Anumantha G Kanthasamy; Arthi Kanthasamy; Marc Kantorow; Orsolya Kapuy; Michalis V Karamouzis; Md Razaul Karim; Parimal Karmakar; Rajesh G Katare; Masaru Kato; Stefan H E Kaufmann; Anu Kauppinen; Gur P Kaushal; Susmita Kaushik; Kiyoshi Kawasaki; Kemal Kazan; Po-Yuan Ke; Damien J Keating; Ursula Keber; John H Kehrl; Kate E Keller; Christian W Keller; Jongsook Kim Kemper; Candia M Kenific; Oliver Kepp; Stephanie Kermorgant; Andreas Kern; Robin Ketteler; Tom G Keulers; Boris Khalfin; Hany Khalil; Bilon Khambu; Shahid Y Khan; Vinoth Kumar Megraj Khandelwal; Rekha Khandia; Widuri Kho; Noopur V Khobrekar; Sataree Khuansuwan; Mukhran Khundadze; Samuel A Killackey; Dasol Kim; Deok Ryong Kim; Do-Hyung Kim; Dong-Eun Kim; Eun Young Kim; Eun-Kyoung Kim; Hak-Rim Kim; Hee-Sik Kim; Jeong Hun Kim; Jin Kyung Kim; Jin-Hoi Kim; Joungmok Kim; Ju Hwan Kim; Keun Il Kim; Peter K Kim; Seong-Jun Kim; Scot R Kimball; Adi Kimchi; Alec C Kimmelman; Tomonori Kimura; Matthew A King; Kerri J Kinghorn; Conan G Kinsey; Vladimir Kirkin; Lorrie A Kirshenbaum; Sergey L Kiselev; Shuji Kishi; Katsuhiko Kitamoto; Yasushi Kitaoka; Kaio Kitazato; Richard N Kitsis; Josef T Kittler; Ole Kjaerulff; Peter S Klein; Thomas Klopstock; Jochen Klucken; Helene Knævelsrud; Roland L Knorr; Ben C B Ko; Fred Ko; Jiunn-Liang Ko; Hotaka Kobayashi; Satoru Kobayashi; Ina Koch; Jan C Koch; Ulrich Koenig; Donat Kögel; Young Ho Koh; Masato Koike; Sepp D Kohlwein; Nur M Kocaturk; Masaaki Komatsu; Jeannette König; Toru Kono; Benjamin T Kopp; Tamas Korcsmaros; Gözde Korkmaz; Viktor I Korolchuk; Mónica Suárez Korsnes; Ali Koskela; Janaiah Kota; Yaichiro Kotake; Monica L Kotler; Yanjun Kou; Michael I Koukourakis; Evangelos Koustas; Attila L Kovacs; Tibor Kovács; Daisuke Koya; Tomohiro Kozako; Claudine Kraft; Dimitri Krainc; Helmut Krämer; Anna D Krasnodembskaya; Carole Kretz-Remy; Guido Kroemer; Nicholas T Ktistakis; Kazuyuki Kuchitsu; Sabine Kuenen; Lars Kuerschner; Thomas Kukar; Ajay Kumar; Ashok Kumar; Deepak Kumar; Dhiraj Kumar; Sharad Kumar; Shinji Kume; Caroline Kumsta; Chanakya N Kundu; Mondira Kundu; Ajaikumar B Kunnumakkara; Lukasz Kurgan; Tatiana G Kutateladze; Ozlem Kutlu; SeongAe Kwak; Ho Jeong Kwon; Taeg Kyu Kwon; Yong Tae Kwon; Irene Kyrmizi; Albert La Spada; Patrick Labonté; Sylvain Ladoire; Ilaria Laface; Frank Lafont; Diane C Lagace; Vikramjit Lahiri; Zhibing Lai; Angela S Laird; Aparna Lakkaraju; Trond Lamark; Sheng-Hui Lan; Ane Landajuela; Darius J R Lane; Jon D Lane; Charles H Lang; Carsten Lange; Ülo Langel; Rupert Langer; Pierre Lapaquette; Jocelyn Laporte; Nicholas F LaRusso; Isabel Lastres-Becker; Wilson Chun Yu Lau; Gordon W Laurie; Sergio Lavandero; Betty Yuen Kwan Law; Helen Ka-Wai Law; Rob Layfield; Weidong Le; Herve Le Stunff; Alexandre Y Leary; Jean-Jacques Lebrun; Lionel Y W Leck; Jean-Philippe Leduc-Gaudet; Changwook Lee; Chung-Pei Lee; Da-Hye Lee; Edward B Lee; Erinna F Lee; Gyun Min Lee; He-Jin Lee; Heung Kyu Lee; Jae Man Lee; Jason S Lee; Jin-A Lee; Joo-Yong Lee; Jun Hee Lee; Michael Lee; Min Goo Lee; Min Jae Lee; Myung-Shik Lee; Sang Yoon Lee; Seung-Jae Lee; Stella Y Lee; Sung Bae Lee; Won Hee Lee; Ying-Ray Lee; Yong-Ho Lee; Youngil Lee; Christophe Lefebvre; Renaud Legouis; Yu L Lei; Yuchen Lei; Sergey Leikin; Gerd Leitinger; Leticia Lemus; Shuilong Leng; Olivia Lenoir; Guido Lenz; Heinz Josef Lenz; Paola Lenzi; Yolanda León; Andréia M Leopoldino; Christoph Leschczyk; Stina Leskelä; Elisabeth Letellier; Chi-Ting Leung; Po Sing Leung; Jeremy S Leventhal; Beth Levine; Patrick A Lewis; Klaus Ley; Bin Li; Da-Qiang Li; Jianming Li; Jing Li; Jiong Li; Ke Li; Liwu Li; Mei Li; Min Li; Min Li; Ming Li; Mingchuan Li; Pin-Lan Li; Ming-Qing Li; Qing Li; Sheng Li; Tiangang Li; Wei Li; Wenming Li; Xue Li; Yi-Ping Li; Yuan Li; Zhiqiang Li; Zhiyong Li; Zhiyuan Li; Jiqin Lian; Chengyu Liang; Qiangrong Liang; Weicheng Liang; Yongheng Liang; YongTian Liang; Guanghong Liao; Lujian Liao; Mingzhi Liao; Yung-Feng Liao; Mariangela Librizzi; Pearl P Y Lie; Mary A Lilly; Hyunjung J Lim; Thania R R Lima; Federica Limana; Chao Lin; Chih-Wen Lin; Dar-Shong Lin; Fu-Cheng Lin; Jiandie D Lin; Kurt M Lin; Kwang-Huei Lin; Liang-Tzung Lin; Pei-Hui Lin; Qiong Lin; Shaofeng Lin; Su-Ju Lin; Wenyu Lin; Xueying Lin; Yao-Xin Lin; Yee-Shin Lin; Rafael Linden; Paula Lindner; Shuo-Chien Ling; Paul Lingor; Amelia K Linnemann; Yih-Cherng Liou; Marta M Lipinski; Saška Lipovšek; Vitor A Lira; Natalia Lisiak; Paloma B Liton; Chao Liu; Ching-Hsuan Liu; Chun-Feng Liu; Cui Hua Liu; Fang Liu; Hao Liu; Hsiao-Sheng Liu; Hua-Feng Liu; Huifang Liu; Jia Liu; Jing Liu; Julia Liu; Leyuan Liu; Longhua Liu; Meilian Liu; Qin Liu; Wei Liu; Wende Liu; Xiao-Hong Liu; Xiaodong Liu; Xingguo Liu; Xu Liu; Xuedong Liu; Yanfen Liu; Yang Liu; Yang Liu; Yueyang Liu; Yule Liu; J Andrew Livingston; Gerard Lizard; Jose M Lizcano; Senka Ljubojevic-Holzer; Matilde E LLeonart; David Llobet-Navàs; Alicia Llorente; Chih Hung Lo; Damián Lobato-Márquez; Qi Long; Yun Chau Long; Ben Loos; Julia A Loos; Manuela G López; Guillermo López-Doménech; José Antonio López-Guerrero; Ana T López-Jiménez; Óscar López-Pérez; Israel López-Valero; Magdalena J Lorenowicz; Mar Lorente; Peter Lorincz; Laura Lossi; Sophie Lotersztajn; Penny E Lovat; Jonathan F Lovell; Alenka Lovy; Péter Lőw; Guang Lu; Haocheng Lu; Jia-Hong Lu; Jin-Jian Lu; Mengji Lu; Shuyan Lu; Alessandro Luciani; John M Lucocq; Paula Ludovico; Micah A Luftig; Morten Luhr; Diego Luis-Ravelo; Julian J Lum; Liany Luna-Dulcey; Anders H Lund; Viktor K Lund; Jan D Lünemann; Patrick Lüningschrör; Honglin Luo; Rongcan Luo; Shouqing Luo; Zhi Luo; Claudio Luparello; Bernhard Lüscher; Luan Luu; Alex Lyakhovich; Konstantin G Lyamzaev; Alf Håkon Lystad; Lyubomyr Lytvynchuk; Alvin C Ma; Changle Ma; Mengxiao Ma; Ning-Fang Ma; Quan-Hong Ma; Xinliang Ma; Yueyun Ma; Zhenyi Ma; Ormond A MacDougald; Fernando Macian; Gustavo C MacIntosh; Jeffrey P MacKeigan; Kay F Macleod; Sandra Maday; Frank Madeo; Muniswamy Madesh; Tobias Madl; Julio Madrigal-Matute; Akiko Maeda; Yasuhiro Maejima; Marta Magarinos; Poornima Mahavadi; Emiliano Maiani; Kenneth Maiese; Panchanan Maiti; Maria Chiara Maiuri; Barbara Majello; Michael B Major; Elena Makareeva; Fayaz Malik; Karthik Mallilankaraman; Walter Malorni; Alina Maloyan; Najiba Mammadova; Gene Chi Wai Man; Federico Manai; Joseph D Mancias; Eva-Maria Mandelkow; Michael A Mandell; Angelo A Manfredi; Masoud H Manjili; Ravi Manjithaya; Patricio Manque; Bella B Manshian; Raquel Manzano; Claudia Manzoni; Kai Mao; Cinzia Marchese; Sandrine Marchetti; Anna Maria Marconi; Fabrizio Marcucci; Stefania Mardente; Olga A Mareninova; Marta Margeta; Muriel Mari; Sara Marinelli; Oliviero Marinelli; Guillermo Mariño; Sofia Mariotto; Richard S Marshall; Mark R Marten; Sascha Martens; Alexandre P J Martin; Katie R Martin; Sara Martin; Shaun Martin; Adrián Martín-Segura; Miguel A Martín-Acebes; Inmaculada Martin-Burriel; Marcos Martin-Rincon; Paloma Martin-Sanz; José A Martina; Wim Martinet; Aitor Martinez; Ana Martinez; Jennifer Martinez; Moises Martinez Velazquez; Nuria Martinez-Lopez; Marta Martinez-Vicente; Daniel O Martins; Joilson O Martins; Waleska K Martins; Tania Martins-Marques; Emanuele Marzetti; Shashank Masaldan; Celine Masclaux-Daubresse; Douglas G Mashek; Valentina Massa; Lourdes Massieu; Glenn R Masson; Laura Masuelli; Anatoliy I Masyuk; Tetyana V Masyuk; Paola Matarrese; Ander Matheu; Satoaki Matoba; Sachiko Matsuzaki; Pamela Mattar; Alessandro Matte; Domenico Mattoscio; José L Mauriz; Mario Mauthe; Caroline Mauvezin; Emanual Maverakis; Paola Maycotte; Johanna Mayer; Gianluigi Mazzoccoli; Cristina Mazzoni; Joseph R Mazzulli; Nami McCarty; Christine McDonald; Mitchell R McGill; Sharon L McKenna; BethAnn McLaughlin; Fionn McLoughlin; Mark A McNiven; Thomas G McWilliams; Fatima Mechta-Grigoriou; Tania Catarina Medeiros; Diego L Medina; Lynn A Megeney; Klara Megyeri; Maryam Mehrpour; Jawahar L Mehta; Alfred J Meijer; Annemarie H Meijer; Jakob Mejlvang; Alicia Meléndez; Annette Melk; Gonen Memisoglu; Alexandrina F Mendes; Delong Meng; Fei Meng; Tian Meng; Rubem Menna-Barreto; Manoj B Menon; Carol Mercer; Anne E Mercier; Jean-Louis Mergny; Adalberto Merighi; Seth D Merkley; Giuseppe Merla; Volker Meske; Ana Cecilia Mestre; Shree Padma Metur; Christian Meyer; Hemmo Meyer; Wenyi Mi; Jeanne Mialet-Perez; Junying Miao; Lucia Micale; Yasuo Miki; Enrico Milan; Małgorzata Milczarek; Dana L Miller; Samuel I Miller; Silke Miller; Steven W Millward; Ira Milosevic; Elena A Minina; Hamed Mirzaei; Hamid Reza Mirzaei; Mehdi Mirzaei; Amit Mishra; Nandita Mishra; Paras Kumar Mishra; Maja Misirkic Marjanovic; Roberta Misasi; Amit Misra; Gabriella Misso; Claire Mitchell; Geraldine Mitou; Tetsuji Miura; Shigeki Miyamoto; Makoto Miyazaki; Mitsunori Miyazaki; Taiga Miyazaki; Keisuke Miyazawa; Noboru Mizushima; Trine H Mogensen; Baharia Mograbi; Reza Mohammadinejad; Yasir Mohamud; Abhishek Mohanty; Sipra Mohapatra; Torsten Möhlmann; Asif Mohmmed; Anna Moles; Kelle H Moley; Maurizio Molinari; Vincenzo Mollace; Andreas Buch Møller; Bertrand Mollereau; Faustino Mollinedo; Costanza Montagna; Mervyn J Monteiro; Andrea Montella; L Ruth Montes; Barbara Montico; Vinod K Mony; Giacomo Monzio Compagnoni; Michael N Moore; Mohammad A Moosavi; Ana L Mora; Marina Mora; David Morales-Alamo; Rosario Moratalla; Paula I Moreira; Elena Morelli; Sandra Moreno; Daniel Moreno-Blas; Viviana Moresi; Benjamin Morga; Alwena H Morgan; Fabrice Morin; Hideaki Morishita; Orson L Moritz; Mariko Moriyama; Yuji Moriyasu; Manuela Morleo; Eugenia Morselli; Jose F Moruno-Manchon; Jorge Moscat; Serge Mostowy; Elisa Motori; Andrea Felinto Moura; Naima Moustaid-Moussa; Maria Mrakovcic; Gabriel Muciño-Hernández; Anupam Mukherjee; Subhadip Mukhopadhyay; Jean M Mulcahy Levy; Victoriano Mulero; Sylviane Muller; Christian Münch; Ashok Munjal; Pura Munoz-Canoves; Teresa Muñoz-Galdeano; Christian Münz; Tomokazu Murakawa; Claudia Muratori; Brona M Murphy; J Patrick Murphy; Aditya Murthy; Timo T Myöhänen; Indira U Mysorekar; Jennifer Mytych; Seyed Mohammad Nabavi; Massimo Nabissi; Péter Nagy; Jihoon Nah; Aimable Nahimana; Ichiro Nakagawa; Ken Nakamura; Hitoshi Nakatogawa; Shyam S Nandi; Meera Nanjundan; Monica Nanni; Gennaro Napolitano; Roberta Nardacci; Masashi Narita; Melissa Nassif; Ilana Nathan; Manabu Natsumeda; Ryno J Naude; Christin Naumann; Olaia Naveiras; Fatemeh Navid; Steffan T Nawrocki; Taras Y Nazarko; Francesca Nazio; Florentina Negoita; Thomas Neill; Amanda L Neisch; Luca M Neri; Mihai G Netea; Patrick Neubert; Thomas P Neufeld; Dietbert Neumann; Albert Neutzner; Phillip T Newton; Paul A Ney; Ioannis P Nezis; Charlene C W Ng; Tzi Bun Ng; Hang T T Nguyen; Long T Nguyen; Hong-Min Ni; Clíona Ní Cheallaigh; Zhenhong Ni; M Celeste Nicolao; Francesco Nicoli; Manuel Nieto-Diaz; Per Nilsson; Shunbin Ning; Rituraj Niranjan; Hiroshi Nishimune; Mireia Niso-Santano; Ralph A Nixon; Annalisa Nobili; Clevio Nobrega; Takeshi Noda; Uxía Nogueira-Recalde; Trevor M Nolan; Ivan Nombela; Ivana Novak; Beatriz Novoa; Takashi Nozawa; Nobuyuki Nukina; Carmen Nussbaum-Krammer; Jesper Nylandsted; Tracey R O'Donovan; Seónadh M O'Leary; Eyleen J O'Rourke; Mary P O'Sullivan; Timothy E O'Sullivan; Salvatore Oddo; Ina Oehme; Michinaga Ogawa; Eric Ogier-Denis; Margret H Ogmundsdottir; Besim Ogretmen; Goo Taeg Oh; Seon-Hee Oh; Young J Oh; Takashi Ohama; Yohei Ohashi; Masaki Ohmuraya; Vasileios Oikonomou; Rani Ojha; Koji Okamoto; Hitoshi Okazawa; Masahide Oku; Sara Oliván; Jorge M A Oliveira; Michael Ollmann; James A Olzmann; Shakib Omari; M Bishr Omary; Gizem Önal; Martin Ondrej; Sang-Bing Ong; Sang-Ging Ong; Anna Onnis; Juan A Orellana; Sara Orellana-Muñoz; Maria Del Mar Ortega-Villaizan; Xilma R Ortiz-Gonzalez; Elena Ortona; Heinz D Osiewacz; Abdel-Hamid K Osman; Rosario Osta; Marisa S Otegui; Kinya Otsu; Christiane Ott; Luisa Ottobrini; Jing-Hsiung James Ou; Tiago F Outeiro; Inger Oynebraten; Melek Ozturk; Gilles Pagès; Susanta Pahari; Marta Pajares; Utpal B Pajvani; Rituraj Pal; Simona Paladino; Nicolas Pallet; Michela Palmieri; Giuseppe Palmisano; Camilla Palumbo; Francesco Pampaloni; Lifeng Pan; Qingjun Pan; Wenliang Pan; Xin Pan; Ganna Panasyuk; Rahul Pandey; Udai B Pandey; Vrajesh Pandya; Francesco Paneni; Shirley Y Pang; Elisa Panzarini; Daniela L Papademetrio; Elena Papaleo; Daniel Papinski; Diana Papp; Eun Chan Park; Hwan Tae Park; Ji-Man Park; Jong-In Park; Joon Tae Park; Junsoo Park; Sang Chul Park; Sang-Youel Park; Abraham H Parola; Jan B Parys; Adrien Pasquier; Benoit Pasquier; João F Passos; Nunzia Pastore; Hemal H Patel; Daniel Patschan; Sophie Pattingre; Gustavo Pedraza-Alva; Jose Pedraza-Chaverri; Zully Pedrozo; Gang Pei; Jianming Pei; Hadas Peled-Zehavi; Joaquín M Pellegrini; Joffrey Pelletier; Miguel A Peñalva; Di Peng; Ying Peng; Fabio Penna; Maria Pennuto; Francesca Pentimalli; Cláudia Mf Pereira; Gustavo J S Pereira; Lilian C Pereira; Luis Pereira de Almeida; Nirma D Perera; Ángel Pérez-Lara; Ana B Perez-Oliva; María Esther Pérez-Pérez; Palsamy Periyasamy; Andras Perl; Cristiana Perrotta; Ida Perrotta; Richard G Pestell; Morten Petersen; Irina Petrache; Goran Petrovski; Thorsten Pfirrmann; Astrid S Pfister; Jennifer A Philips; Huifeng Pi; Anna Picca; Alicia M Pickrell; Sandy Picot; Giovanna M Pierantoni; Marina Pierdominici; Philippe Pierre; Valérie Pierrefite-Carle; Karolina Pierzynowska; Federico Pietrocola; Miroslawa Pietruczuk; Claudio Pignata; Felipe X Pimentel-Muiños; Mario Pinar; Roberta O Pinheiro; Ronit Pinkas-Kramarski; Paolo Pinton; Karolina Pircs; Sujan Piya; Paola Pizzo; Theo S Plantinga; Harald W Platta; Ainhoa Plaza-Zabala; Markus Plomann; Egor Y Plotnikov; Helene Plun-Favreau; Ryszard Pluta; Roger Pocock; Stefanie Pöggeler; Christian Pohl; Marc Poirot; Angelo Poletti; Marisa Ponpuak; Hana Popelka; Blagovesta Popova; Helena Porta; Soledad Porte Alcon; Eliana Portilla-Fernandez; Martin Post; Malia B Potts; Joanna Poulton; Ted Powers; Veena Prahlad; Tomasz K Prajsnar; Domenico Praticò; Rosaria Prencipe; Muriel Priault; Tassula Proikas-Cezanne; Vasilis J Promponas; Christopher G Proud; Rosa Puertollano; Luigi Puglielli; Thomas Pulinilkunnil; Deepika Puri; Rajat Puri; Julien Puyal; Xiaopeng Qi; Yongmei Qi; Wenbin Qian; Lei Qiang; Yu Qiu; Joe Quadrilatero; Jorge Quarleri; Nina Raben; Hannah Rabinowich; Debora Ragona; Michael J Ragusa; Nader Rahimi; Marveh Rahmati; Valeria Raia; Nuno Raimundo; Namakkal-Soorappan Rajasekaran; Sriganesh Ramachandra Rao; Abdelhaq Rami; Ignacio Ramírez-Pardo; David B Ramsden; Felix Randow; Pundi N Rangarajan; Danilo Ranieri; Hai Rao; Lang Rao; Rekha Rao; Sumit Rathore; J Arjuna Ratnayaka; Edward A Ratovitski; Palaniyandi Ravanan; Gloria Ravegnini; Swapan K Ray; Babak Razani; Vito Rebecca; Fulvio Reggiori; Anne Régnier-Vigouroux; Andreas S Reichert; David Reigada; Jan H Reiling; Theo Rein; Siegfried Reipert; Rokeya Sultana Rekha; Hongmei Ren; Jun Ren; Weichao Ren; Tristan Renault; Giorgia Renga; Karen Reue; Kim Rewitz; Bruna Ribeiro de Andrade Ramos; S Amer Riazuddin; Teresa M Ribeiro-Rodrigues; Jean-Ehrland Ricci; Romeo Ricci; Victoria Riccio; Des R Richardson; Yasuko Rikihisa; Makarand V Risbud; Ruth M Risueño; Konstantinos Ritis; Salvatore Rizza; Rosario Rizzuto; Helen C Roberts; Luke D Roberts; Katherine J Robinson; Maria Carmela Roccheri; Stephane Rocchi; George G Rodney; Tiago Rodrigues; Vagner Ramon Rodrigues Silva; Amaia Rodriguez; Ruth Rodriguez-Barrueco; Nieves Rodriguez-Henche; Humberto Rodriguez-Rocha; Jeroen Roelofs; Robert S Rogers; Vladimir V Rogov; Ana I Rojo; Krzysztof Rolka; Vanina Romanello; Luigina Romani; Alessandra Romano; Patricia S Romano; David Romeo-Guitart; Luis C Romero; Montserrat Romero; Joseph C Roney; Christopher Rongo; Sante Roperto; Mathias T Rosenfeldt; Philip Rosenstiel; Anne G Rosenwald; Kevin A Roth; Lynn Roth; Steven Roth; Kasper M A Rouschop; Benoit D Roussel; Sophie Roux; Patrizia Rovere-Querini; Ajit Roy; Aurore Rozieres; Diego Ruano; David C Rubinsztein; Maria P Rubtsova; Klaus Ruckdeschel; Christoph Ruckenstuhl; Emil Rudolf; Rüdiger Rudolf; Alessandra Ruggieri; Avnika Ashok Ruparelia; Paola Rusmini; Ryan R Russell; Gian Luigi Russo; Maria Russo; Rossella Russo; Oxana O Ryabaya; Kevin M Ryan; Kwon-Yul Ryu; Maria Sabater-Arcis; Ulka Sachdev; Michael Sacher; Carsten Sachse; Abhishek Sadhu; Junichi Sadoshima; Nathaniel Safren; Paul Saftig; Antonia P Sagona; Gaurav Sahay; Amirhossein Sahebkar; Mustafa Sahin; Ozgur Sahin; Sumit Sahni; Nayuta Saito; Shigeru Saito; Tsunenori Saito; Ryohei Sakai; Yasuyoshi Sakai; Jun-Ichi Sakamaki; Kalle Saksela; Gloria Salazar; Anna Salazar-Degracia; Ghasem H Salekdeh; Ashok K Saluja; Belém Sampaio-Marques; Maria Cecilia Sanchez; Jose A Sanchez-Alcazar; Victoria Sanchez-Vera; Vanessa Sancho-Shimizu; J Thomas Sanderson; Marco Sandri; Stefano Santaguida; Laura Santambrogio; Magda M Santana; Giorgio Santoni; Alberto Sanz; Pascual Sanz; Shweta Saran; Marco Sardiello; Timothy J Sargeant; Apurva Sarin; Chinmoy Sarkar; Sovan Sarkar; Maria-Rosa Sarrias; Surajit Sarkar; Dipanka Tanu Sarmah; Jaakko Sarparanta; Aishwarya Sathyanarayan; Ranganayaki Sathyanarayanan; K Matthew Scaglione; Francesca Scatozza; Liliana Schaefer; Zachary T Schafer; Ulrich E Schaible; Anthony H V Schapira; Michael Scharl; Hermann M Schatzl; Catherine H Schein; Wiep Scheper; David Scheuring; Maria Vittoria Schiaffino; Monica Schiappacassi; Rainer Schindl; Uwe Schlattner; Oliver Schmidt; Roland Schmitt; Stephen D Schmidt; Ingo Schmitz; Eran Schmukler; Anja Schneider; Bianca E Schneider; Romana Schober; Alejandra C Schoijet; Micah B Schott; Michael Schramm; Bernd Schröder; Kai Schuh; Christoph Schüller; Ryan J Schulze; Lea Schürmanns; Jens C Schwamborn; Melanie Schwarten; Filippo Scialo; Sebastiano Sciarretta; Melanie J Scott; Kathleen W Scotto; A Ivana Scovassi; Andrea Scrima; Aurora Scrivo; David Sebastian; Salwa Sebti; Simon Sedej; Laura Segatori; Nava Segev; Per O Seglen; Iban Seiliez; Ekihiro Seki; Scott B Selleck; Frank W Sellke; Joshua T Selsby; Michael Sendtner; Serif Senturk; Elena Seranova; Consolato Sergi; Ruth Serra-Moreno; Hiromi Sesaki; Carmine Settembre; Subba Rao Gangi Setty; Gianluca Sgarbi; Ou Sha; John J Shacka; Javeed A Shah; Dantong Shang; Changshun Shao; Feng Shao; Soroush Sharbati; Lisa M Sharkey; Dipali Sharma; Gaurav Sharma; Kulbhushan Sharma; Pawan Sharma; Surendra Sharma; Han-Ming Shen; Hongtao Shen; Jiangang Shen; Ming Shen; Weili Shen; Zheni Shen; Rui Sheng; Zhi Sheng; Zu-Hang Sheng; Jianjian Shi; Xiaobing Shi; Ying-Hong Shi; Kahori Shiba-Fukushima; Jeng-Jer Shieh; Yohta Shimada; Shigeomi Shimizu; Makoto Shimozawa; Takahiro Shintani; Christopher J Shoemaker; Shahla Shojaei; Ikuo Shoji; Bhupendra V Shravage; Viji Shridhar; Chih-Wen Shu; Hong-Bing Shu; Ke Shui; Arvind K Shukla; Timothy E Shutt; Valentina Sica; Aleem Siddiqui; Amanda Sierra; Virginia Sierra-Torre; Santiago Signorelli; Payel Sil; Bruno J de Andrade Silva; Johnatas D Silva; Eduardo Silva-Pavez; Sandrine Silvente-Poirot; Rachel E Simmonds; Anna Katharina Simon; Hans-Uwe Simon; Matias Simons; Anurag Singh; Lalit P Singh; Rajat Singh; Shivendra V Singh; Shrawan K Singh; Sudha B Singh; Sunaina Singh; Surinder Pal Singh; Debasish Sinha; Rohit Anthony Sinha; Sangita Sinha; Agnieszka Sirko; Kapil Sirohi; Efthimios L Sivridis; Panagiotis Skendros; Aleksandra Skirycz; Iva Slaninová; Soraya S Smaili; Andrei Smertenko; Matthew D Smith; Stefaan J Soenen; Eun Jung Sohn; Sophia P M Sok; Giancarlo Solaini; Thierry Soldati; Scott A Soleimanpour; Rosa M Soler; Alexei Solovchenko; Jason A Somarelli; Avinash Sonawane; Fuyong Song; Hyun Kyu Song; Ju-Xian Song; Kunhua Song; Zhiyin Song; Leandro R Soria; Maurizio Sorice; Alexander A Soukas; Sandra-Fausia Soukup; Diana Sousa; Nadia Sousa; Paul A Spagnuolo; Stephen A Spector; M M Srinivas Bharath; Daret St Clair; Venturina Stagni; Leopoldo Staiano; Clint A Stalnecker; Metodi V Stankov; Peter B Stathopulos; Katja Stefan; Sven Marcel Stefan; Leonidas Stefanis; Joan S Steffan; Alexander Steinkasserer; Harald Stenmark; Jared Sterneckert; Craig Stevens; Veronika Stoka; Stephan Storch; Björn Stork; Flavie Strappazzon; Anne Marie Strohecker; Dwayne G Stupack; Huanxing Su; Ling-Yan Su; Longxiang Su; Ana M Suarez-Fontes; Carlos S Subauste; Selvakumar Subbian; Paula V Subirada; Ganapasam Sudhandiran; Carolyn M Sue; Xinbing Sui; Corey Summers; Guangchao Sun; Jun Sun; Kang Sun; Meng-Xiang Sun; Qiming Sun; Yi Sun; Zhongjie Sun; Karen K S Sunahara; Eva Sundberg; Katalin Susztak; Peter Sutovsky; Hidekazu Suzuki; Gary Sweeney; J David Symons; Stephen Cho Wing Sze; Nathaniel J Szewczyk; Anna Tabęcka-Łonczynska; Claudio Tabolacci; Frank Tacke; Heinrich Taegtmeyer; Marco Tafani; Mitsuo Tagaya; Haoran Tai; Stephen W G Tait; Yoshinori Takahashi; Szabolcs Takats; Priti Talwar; Chit Tam; Shing Yau Tam; Davide Tampellini; Atsushi Tamura; Chong Teik Tan; Eng-King Tan; Ya-Qin Tan; Masaki Tanaka; Motomasa Tanaka; Daolin Tang; Jingfeng Tang; Tie-Shan Tang; Isei Tanida; Zhipeng Tao; Mohammed Taouis; Lars Tatenhorst; Nektarios Tavernarakis; Allen Taylor; Gregory A Taylor; Joan M Taylor; Elena Tchetina; Andrew R Tee; Irmgard Tegeder; David Teis; Natercia Teixeira; Fatima Teixeira-Clerc; Kumsal A Tekirdag; Tewin Tencomnao; Sandra Tenreiro; Alexei V Tepikin; Pilar S Testillano; Gianluca Tettamanti; Pierre-Louis Tharaux; Kathrin Thedieck; Arvind A Thekkinghat; Stefano Thellung; Josephine W Thinwa; V P Thirumalaikumar; Sufi Mary Thomas; Paul G Thomes; Andrew Thorburn; Lipi Thukral; Thomas Thum; Michael Thumm; Ling Tian; Ales Tichy; Andreas Till; Vincent Timmerman; Vladimir I Titorenko; Sokol V Todi; Krassimira Todorova; Janne M Toivonen; Luana Tomaipitinca; Dhanendra Tomar; Cristina Tomas-Zapico; Sergej Tomić; Benjamin Chun-Kit Tong; Chao Tong; Xin Tong; Sharon A Tooze; Maria L Torgersen; Satoru Torii; Liliana Torres-López; Alicia Torriglia; Christina G Towers; Roberto Towns; Shinya Toyokuni; Vladimir Trajkovic; Donatella Tramontano; Quynh-Giao Tran; Leonardo H Travassos; Charles B Trelford; Shirley Tremel; Ioannis P Trougakos; Betty P Tsao; Mario P Tschan; Hung-Fat Tse; Tak Fu Tse; Hitoshi Tsugawa; Andrey S Tsvetkov; David A Tumbarello; Yasin Tumtas; María J Tuñón; Sandra Turcotte; Boris Turk; Vito Turk; Bradley J Turner; Richard I Tuxworth; Jessica K Tyler; Elena V Tyutereva; Yasuo Uchiyama; Aslihan Ugun-Klusek; Holm H Uhlig; Marzena Ułamek-Kozioł; Ilya V Ulasov; Midori Umekawa; Christian Ungermann; Rei Unno; Sylvie Urbe; Elisabet Uribe-Carretero; Suayib Üstün; Vladimir N Uversky; Thomas Vaccari; Maria I Vaccaro; Björn F Vahsen; Helin Vakifahmetoglu-Norberg; Rut Valdor; Maria J Valente; Ayelén Valko; Richard B Vallee; Angela M Valverde; Greet Van den Berghe; Stijn van der Veen; Luc Van Kaer; Jorg van Loosdregt; Sjoerd J L van Wijk; Wim Vandenberghe; Ilse Vanhorebeek; Marcos A Vannier-Santos; Nicola Vannini; M Cristina Vanrell; Chiara Vantaggiato; Gabriele Varano; Isabel Varela-Nieto; Máté Varga; M Helena Vasconcelos; Somya Vats; Demetrios G Vavvas; Ignacio Vega-Naredo; Silvia Vega-Rubin-de-Celis; Guillermo Velasco; Ariadna P Velázquez; Tibor Vellai; Edo Vellenga; Francesca Velotti; Mireille Verdier; Panayotis Verginis; Isabelle Vergne; Paul Verkade; Manish Verma; Patrik Verstreken; Tim Vervliet; Jörg Vervoorts; Alexandre T Vessoni; Victor M Victor; Michel Vidal; Chiara Vidoni; Otilia V Vieira; Richard D Vierstra; Sonia Viganó; Helena Vihinen; Vinoy Vijayan; Miquel Vila; Marçal Vilar; José M Villalba; Antonio Villalobo; Beatriz Villarejo-Zori; Francesc Villarroya; Joan Villarroya; Olivier Vincent; Cecile Vindis; Christophe Viret; Maria Teresa Viscomi; Dora Visnjic; Ilio Vitale; David J Vocadlo; Olga V Voitsekhovskaja; Cinzia Volonté; Mattia Volta; Marta Vomero; Clarissa Von Haefen; Marc A Vooijs; Wolfgang Voos; Ljubica Vucicevic; Richard Wade-Martins; Satoshi Waguri; Kenrick A Waite; Shuji Wakatsuki; David W Walker; Mark J Walker; Simon A Walker; Jochen Walter; Francisco G Wandosell; Bo Wang; Chao-Yung Wang; Chen Wang; Chenran Wang; Chenwei Wang; Cun-Yu Wang; Dong Wang; Fangyang Wang; Feng Wang; Fengming Wang; Guansong Wang; Han Wang; Hao Wang; Hexiang Wang; Hong-Gang Wang; Jianrong Wang; Jigang Wang; Jiou Wang; Jundong Wang; Kui Wang; Lianrong Wang; Liming Wang; Maggie Haitian Wang; Meiqing Wang; Nanbu Wang; Pengwei Wang; Peipei Wang; Ping Wang; Ping Wang; Qing Jun Wang; Qing Wang; Qing Kenneth Wang; Qiong A Wang; Wen-Tao Wang; Wuyang Wang; Xinnan Wang; Xuejun Wang; Yan Wang; Yanchang Wang; Yanzhuang Wang; Yen-Yun Wang; Yihua Wang; Yipeng Wang; Yu Wang; Yuqi Wang; Zhe Wang; Zhenyu Wang; Zhouguang Wang; Gary Warnes; Verena Warnsmann; Hirotaka Watada; Eizo Watanabe; Maxinne Watchon; Anna Wawrzyńska; Timothy E Weaver; Grzegorz Wegrzyn; Ann M Wehman; Huafeng Wei; Lei Wei; Taotao Wei; Yongjie Wei; Oliver H Weiergräber; Conrad C Weihl; Günther Weindl; Ralf Weiskirchen; Alan Wells; Runxia H Wen; Xin Wen; Antonia Werner; Beatrice Weykopf; Sally P Wheatley; J Lindsay Whitton; Alexander J Whitworth; Katarzyna Wiktorska; Manon E Wildenberg; Tom Wileman; Simon Wilkinson; Dieter Willbold; Brett Williams; Robin S B Williams; Roger L Williams; Peter R Williamson; Richard A Wilson; Beate Winner; Nathaniel J Winsor; Steven S Witkin; Harald Wodrich; Ute Woehlbier; Thomas Wollert; Esther Wong; Jack Ho Wong; Richard W Wong; Vincent Kam Wai Wong; W Wei-Lynn Wong; An-Guo Wu; Chengbiao Wu; Jian Wu; Junfang Wu; Kenneth K Wu; Min Wu; Shan-Ying Wu; Shengzhou Wu; Shu-Yan Wu; Shufang Wu; William K K Wu; Xiaohong Wu; Xiaoqing Wu; Yao-Wen Wu; Yihua Wu; Ramnik J Xavier; Hongguang Xia; Lixin Xia; Zhengyuan Xia; Ge Xiang; Jin Xiang; Mingliang Xiang; Wei Xiang; Bin Xiao; Guozhi Xiao; Hengyi Xiao; Hong-Tao Xiao; Jian Xiao; Lan Xiao; Shi Xiao; Yin Xiao; Baoming Xie; Chuan-Ming Xie; Min Xie; Yuxiang Xie; Zhiping Xie; Zhonglin Xie; Maria Xilouri; Congfeng Xu; En Xu; Haoxing Xu; Jing Xu; JinRong Xu; Liang Xu; Wen Wen Xu; Xiulong Xu; Yu Xue; Sokhna M S Yakhine-Diop; Masamitsu Yamaguchi; Osamu Yamaguchi; Ai Yamamoto; Shunhei Yamashina; Shengmin Yan; Shian-Jang Yan; Zhen Yan; Yasuo Yanagi; Chuanbin Yang; Dun-Sheng Yang; Huan Yang; Huang-Tian Yang; Hui Yang; Jin-Ming Yang; Jing Yang; Jingyu Yang; Ling Yang; Liu Yang; Ming Yang; Pei-Ming Yang; Qian Yang; Seungwon Yang; Shu Yang; Shun-Fa Yang; Wannian Yang; Wei Yuan Yang; Xiaoyong Yang; Xuesong Yang; Yi Yang; Ying Yang; Honghong Yao; Shenggen Yao; Xiaoqiang Yao; Yong-Gang Yao; Yong-Ming Yao; Takahiro Yasui; Meysam Yazdankhah; Paul M Yen; Cong Yi; Xiao-Ming Yin; Yanhai Yin; Zhangyuan Yin; Ziyi Yin; Meidan Ying; Zheng Ying; Calvin K Yip; Stephanie Pei Tung Yiu; Young H Yoo; Kiyotsugu Yoshida; Saori R Yoshii; Tamotsu Yoshimori; Bahman Yousefi; Boxuan Yu; Haiyang Yu; Jun Yu; Jun Yu; Li Yu; Ming-Lung Yu; Seong-Woon Yu; Victor C Yu; W Haung Yu; Zhengping Yu; Zhou Yu; Junying Yuan; Ling-Qing Yuan; Shilin Yuan; Shyng-Shiou F Yuan; Yanggang Yuan; Zengqiang Yuan; Jianbo Yue; Zhenyu Yue; Jeanho Yun; Raymond L Yung; David N Zacks; Gabriele Zaffagnini; Vanessa O Zambelli; Isabella Zanella; Qun S Zang; Sara Zanivan; Silvia Zappavigna; Pilar Zaragoza; Konstantinos S Zarbalis; Amir Zarebkohan; Amira Zarrouk; Scott O Zeitlin; Jialiu Zeng; Ju-Deng Zeng; Eva Žerovnik; Lixuan Zhan; Bin Zhang; Donna D Zhang; Hanlin Zhang; Hong Zhang; Hong Zhang; Honghe Zhang; Huafeng Zhang; Huaye Zhang; Hui Zhang; Hui-Ling Zhang; Jianbin Zhang; Jianhua Zhang; Jing-Pu Zhang; Kalin Y B Zhang; Leshuai W Zhang; Lin Zhang; Lisheng Zhang; Lu Zhang; Luoying Zhang; Menghuan Zhang; Peng Zhang; Sheng Zhang; Wei Zhang; Xiangnan Zhang; Xiao-Wei Zhang; Xiaolei Zhang; Xiaoyan Zhang; Xin Zhang; Xinxin Zhang; Xu Dong Zhang; Yang Zhang; Yanjin Zhang; Yi Zhang; Ying-Dong Zhang; Yingmei Zhang; Yuan-Yuan Zhang; Yuchen Zhang; Zhe Zhang; Zhengguang Zhang; Zhibing Zhang; Zhihai Zhang; Zhiyong Zhang; Zili Zhang; Haobin Zhao; Lei Zhao; Shuang Zhao; Tongbiao Zhao; Xiao-Fan Zhao; Ying Zhao; Yongchao Zhao; Yongliang Zhao; Yuting Zhao; Guoping Zheng; Kai Zheng; Ling Zheng; Shizhong Zheng; Xi-Long Zheng; Yi Zheng; Zu-Guo Zheng; Boris Zhivotovsky; Qing Zhong; Ao Zhou; Ben Zhou; Cefan Zhou; Gang Zhou; Hao Zhou; Hong Zhou; Hongbo Zhou; Jie Zhou; Jing Zhou; Jing Zhou; Jiyong Zhou; Kailiang Zhou; Rongjia Zhou; Xu-Jie Zhou; Yanshuang Zhou; Yinghong Zhou; Yubin Zhou; Zheng-Yu Zhou; Zhou Zhou; Binglin Zhu; Changlian Zhu; Guo-Qing Zhu; Haining Zhu; Hongxin Zhu; Hua Zhu; Wei-Guo Zhu; Yanping Zhu; Yushan Zhu; Haixia Zhuang; Xiaohong Zhuang; Katarzyna Zientara-Rytter; Christine M Zimmermann; Elena Ziviani; Teresa Zoladek; Wei-Xing Zong; Dmitry B Zorov; Antonio Zorzano; Weiping Zou; Zhen Zou; Zhengzhi Zou; Steven Zuryn; Werner Zwerschke; Beate Brand-Saberi; X Charlie Dong; Chandra Shekar Kenchappa; Zuguo Li; Yong Lin; Shigeru Oshima; Yueguang Rong; Judith C Sluimer; Christina L Stallings; Chun-Kit Tong Journal: Autophagy Date: 2021-02-08 Impact factor: 13.391
Authors: Mohd Farhan; Marta Silva; Shuai Li; Fengxia Yan; Jiankang Fang; Tangming Peng; Jim Hu; Ming-Sound Tsao; Peter Little; Wenhua Zheng Journal: Med Res Rev Date: 2020-05-31 Impact factor: 12.944