| Literature DB >> 29675264 |
Ingo Lämmermann1,2, Lucia Terlecki-Zaniewicz1,2, Regina Weinmüllner1,2, Markus Schosserer2, Hanna Dellago1,2, André Dargen de Matos Branco1,2, Dominik Autheried1,2, Benjamin Sevcnikar1,2, Lisa Kleissl1,2, Irina Berlin3, Frédérique Morizot3, Francois Lejeune3, Nicola Fuzzati4, Sandra Forestier4, Alix Toribio4, Anaïs Tromeur4, Lionel Weinberg4, Juan Carlos Higareda Almaraz5,6,7,8, Marcel Scheideler5,6,7,8, Marion Rietveld9, Abdoel El Ghalbzouri9, Erwin Tschachler10, Florian Gruber1,10, Johannes Grillari1,2.
Abstract
There is increasing evidence that senescent cells are a driving force behind many age-related pathologies and that their selective elimination increases the life- and healthspan of mice. Senescent cells negatively affect their surrounding tissue by losing their cell specific functionality and by secreting a pro-tumorigenic and pro-inflammatory mixture of growth hormones, chemokines, cytokines and proteases, termed the senescence-associated secretory phenotype (SASP). Here we identified an extract from the plant Solidago virgaurea subsp. alpestris, which exhibited weak senolytic activity, delayed the acquisition of a senescent phenotype and induced a papillary phenotype with improved functionality in human dermal fibroblasts. When administered to stress-induced premature senescent fibroblasts, this extract changed their global mRNA expression profile and particularly reduced the expression of various SASP components, thereby ameliorating the negative influence on nearby cells. Thus, the investigated plant extract represents a promising possibility to block age-related loss of tissue functionality.Entities:
Year: 2018 PMID: 29675264 PMCID: PMC5895844 DOI: 10.1038/s41514-018-0023-5
Source DB: PubMed Journal: NPJ Aging Mech Dis ISSN: 2056-3973
Fig. 11201 delays the acquisition of a senescent phenotype. a HDFs were cultivated with growth medium supplemented with 1201 from day 71 (PD 32) of the replicative lifespan experiment onwards. Control cells were cultivated with normal growth medium. Microscopic pictures were taken at ×100 magnification. Scale bar, 100 µm. b Growth curve of the replicative lifespan experiment. At the end of the replicative lifespan the cell number was determined at regular intervals and population doublings were adjusted using the equation to compensate for decreasing cell density. At regular intervals during the lifespan experiment, RNA samples were prepared and the mRNA expression of c p21, d markers for the papillary and e reticular phenotype was determined with RT-qPCR. Expression levels of replicatively young (PD 11.5) control cells were set to 1. Data represent one experiment and error bars are calculated from four technical replicates
Fig. 21201 reverses the papillary to reticular transition. a HDFs were cultivated for five PDs in growth medium supplemented with 1201. Replicatively young cells (PD 10) served as a young control. Representative pictures from one experiment at ×100 magnification. Scale bar, 100 µm. Subsequent to the treatment as described in a, cells were used for b proliferation assay, c RT-qPCR of markers for the papillary/reticular phenotype and FGF7 (expression levels of untreated control cells were set to 1) and d SA-β-gal staining. e Full-thickness human skin equivalents (HSE) were constructed as described in the Methods section. The average of the epidermal thickness was calculated from at least 50 measurements per HSE and the epidermal thickness of untreated HSEs was set to 1. f Representative pictures from one experiment as described in e. Scale bar, 50 µm. Immunohistochemistry of HSEs as described in e was performed with antibodies against g filaggrin, h loricrin and i keratin 10. The white dotted line separates the epidermal from the dermal layer. Scale bar, 50 µm. For b–d, data represent the average of three experiments. For e, data represent the average of two experiments. Statistical significance for the treatment in b was calculated with a two-way ANOVA (p = 0.004) followed by a Bonferroni post hoc test. Statistical significance for the treatment in d was calculated with a one-way ANOVA (p = 0.004) followed by a Bonferroni post hoc test
Fig. 31201 induces a reticular to papillary transition in reticular HDFs. a Reticular HDFs were cultivated for three PDs in growth medium supplemented with 1201. Representative pictures from one experiment after cultivation for two PDs at ×100 magnification. Scale bar, 100 µm. Subsequent to the treatment as described in a, cells were used for b proliferation assay, c RT-qPCR of markers for the papillary/reticular phenotype (expression levels of untreated control cells were set to 1) and d SA-β-gal staining. For b–d, data represent the average of three experiments. Statistical significance for the treatment in b was calculated with a two-way ANOVA (p = 0.038) followed by a Bonferroni post hoc test
Fig. 41201 attenuates the senescent phenotype in SIPS HDFs. a SIPS was induced by chronic oxidative stress and HDFs were subsequently cultivated for 4 days in growth medium supplemented with 1201. RT-qPCR of p21 (expression levels of untreated quiescent control cells (Q) were set to 1). b SA-β-gal staining of SIPS HDFs after 4, 11 and 18 days of cultivation in growth medium supplemented with 1201. Cells were treated as described in a and RNA-Seq was performed. c PCA analysis and hierarchical clustering. d Venn diagrams identifying the genes which are differential expressed in SIPS compared to Q and are regulated contrariwise by treatment of SIPS with 1201. The pie chart illustrates the identified SASP factors and their response to the treatment with 1201. e Transcript levels of all upregulated SASP factors which were regulated contrariwise by treatment with 1201, displayed as Fragments Per Kilobase of transcript per Million mapped reads (FPKM). Error bars indicate confidence intervals (95%). f Six genes were quantified with RT-qPCR from the same RNA samples which were used for RNA-Seq and correlated with the transcript levels derived from RNA-Seq. From a to f, data represent the average of three experiments. Statistical significance for the treatments in a (p < 0.001 for SIPS treatment and p = 0.088 for 1201 treatment) and b (p < 0.001) were calculated with a two-way ANOVA followed by a Bonferroni post hoc test. The p-values of e were corrected with the false discovery rate for multiple comparisons using the Benjamini–Hochberg method
Fig. 5Analysis of pathways and upstream regulators affected by 1201 treatment. a List of selected canonical pathways and b upstream regulators derived from Ingenuity pathway analysis of RNA-Seq data (for complete lists refer to Supplementary Tables S2 and S3). c Pathway enrichment analysis of genes upregulated by 1201 in both, Q and SIPS cells, and d of genes downregulated by 1201 in SIPS cells. Gene expression levels were derived from RNA-Seq data. From a to d, data represent the average of three experiments
Fig. 61201 blocks the effects of SIPS HDFs on other cells. SASP-attenuating properties of 1201 were evaluated by pre-treatment of SIPS HDFs with 1201 for 4 days and analysing the growth stimulation of HaCaT cells by either a counting K14-positive cells after co-culture with SIPS HDFs or b determining the cell number after cultivation with conditioned medium. c Representative pictures from one experiment as described in a. Scale bar, 100 µm. d Migration assay using SIPS HDF-derived conditioned medium and human PBMCs. Migratory paths are coloured in black if cells are migrating upwards, in the direction of the conditioned medium. The blue dot marks the centre of mass. e Full-thickness HSEs with SIPS HDFs were constructed as described in the Methods section and the epidermal thickness of control HSEs was set to 1. f Representative pictures from one experiment as described in e. Scale bar, 50 µm. For a, b and e, data represent the average of three experiments. For d, data represent one experiment
Sequences of RT-qPCR primers
| Gene name | Sense primer | Anti-sense primer |
|---|---|---|
|
| CGACCACTTTGTCAAGCTCA | TGTGAGGAGGGGAGATTCAG |
|
| GCATCGAGGATCTGCCAACT | CCCTTCAGCTCTTTAGGGCG |
|
| TGCCATTACTGCAAGGAGGG | TTGCAGGTGATACCCGTCAC |
|
| GTGGAGAAGTGGATCGACGG | CCCTGGATTTTCCGGCTTCT |
|
| AGAGCAGCATAAAGCCCAGT | TCTCAGTGGTCTCAGTGTGGA |
|
| GGCGGCAGACCAGCATGACAGATT | GCAGGGGGCGGCCAGGGTAT |
|
| TCATTGCCCGTCTCACCAAG | GGCACAGTCTTCCCTCTCTTC |
|
| TGGCAATCAAAGGGGTGGAA | GCCATAGGAAGAAAGTGGGCT |
|
| GAAAGTCTCTGCCGCCCTTC | ACAGATCTCCTTGGCCACAA |
|
| TCAATCCTGCATCCCCCATAG | CAGGAACAGCCACCAGTGAG |
|
| CTCTTGGCAGCCTTCCTGATTT | ACAGAGCTCTCTTCCATCAGA |
|
| ATGAACTGTGTTTGCCGCCT | GGGAATCCAGGTTGTGGTCC |