Literature DB >> 29657927

Gene Expression Analysis of Two Epithelial-mesenchymal Transition-related Genes: Long Noncoding RNA-ATB and SETD8 in Gastric Cancer Tissues.

Nooshin Nourbakhsh1,2, Modjtaba Emadi-Baygi3,4, Rasoul Salehi2, Parvaneh Nikpour1,2,5.   

Abstract

BACKGROUND: Cancer is the second cause of death after cardiovascular diseases worldwide. Tumor metastasis is the main cause of death in patients with cancer; therefore, unraveling the molecular mechanisms involved in metastasis is critical. Epithelial-mesenchymal transition (EMT) is believed to promote tumor metastasis. Based on the critical roles of long noncoding RNA-ATB (lncRNA-ATB) and SETD8 genes in cancer pathogenesis and EMT, in this study, we aimed to assess expression profile and clinicopathological relevance of these two genes in human gastric cancer.
MATERIALS AND METHODS: Quantitative real-time polymerase chain reaction was performed to assess these gene expressions in gastric cancer tissues and various cell lines. The associations between these gene expressions and clinicopathological characteristics were also analyzed.
RESULTS: Insignificant downregulation of lncRNA-ATB and significant upregulation of SETD8 in cancerous versus noncancerous gastric tissues were observed. Among different examined cell lines, all displayed both genes expression. Except for a significant inverse correlation between the expression levels of lncRNA-ATB and depth of invasion (T) and a direct association between SETD8 levels and advanced tumor grades, no significant association was found with other clinicopathological characteristics.
CONCLUSION: lncRNA-ATB and SETD8 genes may play a critical role in gastric cancer progression and may serve as potential diagnostic/prognostic biomarkers in cancer patients.

Entities:  

Keywords:  Gastric cancer; SETD8; gene expression; long noncoding RNA-ATB

Year:  2018        PMID: 29657927      PMCID: PMC5887690          DOI: 10.4103/abr.abr_252_16

Source DB:  PubMed          Journal:  Adv Biomed Res        ISSN: 2277-9175


Introduction

Gastric cancer is the second most frequent cause of cancer mortality in the world.[1] It is the second and fourth most common cancer in Iranian men and women, respectively, and the first leading cause of cancer deaths in Iran.[2] Ordinary treatments have no effect on improving the survival for most Iranian patients with gastric cancer because it is being diagnosed at an advanced stages of disease.[3] Epithelial-to-mesenchymal transition (EMT) is a process by which cell's features change from epithelial to mesenchymal, and it is known as a fundamental step for initiation of tumor cell metastasis. Various signaling pathways, transcriptional factors, and posttranscriptional regulatory networks such as long noncoding RNAs (lncRNAs) can motivate EMT process.[4] lncRNAs are a heterogeneous group of ncRNAs, which are larger than 200 nucleotides, with no protein-coding duty.[3567] These molecules are engaged in a broad range of biological and pathological processes such as cancer initiation, progression,[7] and metastasis.[5] Dysregulation of various lncRNAs in gastric cancer has been previously reported.[389] A transforming growth factor-beta (TGF-β)-induced lncRNA, lncRNA-ATB (lncRNA activated by TGF-β), is a lncRNA with 2741 nucleotides in length which is expressed from ENSG00000249549 gene on 14 chromosome. IncRNA-ATB stimulates EMT through competitively binding to mir-200 family, thus insulating them away from their mRNA targets: ZEB1 and ZEB2.[1011] Dysregulation of lncRNA-ATB has been reported in several cancer types.[10111213141516] SETD8 is a protein-coding gene encoding for an enzyme functioning as methyltransferase, in which its deregulation and role in cancer initiation, progression, and EMT has been also documented.[1718] Based on the important roles of lncRNA-ATB and SETD8 genes in cancer pathogenesis, in the current study, we aimed to assess expression profile of these two genes in human gastric cancer. Furthermore, we explored the association between these two genes expression and clinicopathological parameters of human gastric cancer samples.

Materials and Methods

Representative cancerous and noncancerous tissues

A total of 38 paired tissue specimens were tested for gene expression, of which 38 were cancerous and 38 were neighboring noncancerous samples of gastric from the same patients. In case of lncRNA-ATB gene, 37 paired samples were tested. Biological materials were provided by the Iran National Tumor Bank which is funded by the Cancer Institute of Tehran University, for Cancer Research.[192021] All patients provided written informed permission to the Iran Tumoral Bank before the participation, and all experimental procedures were accepted by the Ethics Committee of Isfahan University of Medical Sciences. The clinical staging of the cancerous specimens was done based on the seventh edition of the American Joint Committee on Cancer (AJCC) staging manual for stomach.[22]

Cell lines and cell cultivation

The human liver hepatocellular carcinoma cell line (HepG2) was cultivated in RPMI-1640 (Gibco Life Technologies, Karlsruhe, Germany), supplemented with 10% fetal calf serum, 100 U/ml penicillin, and 10 μg/ml streptomycin. The human embryonic kidney 293 cells, human pulmonary carcinoma cells (A542), human breast cancer cell (MCF7), and human umbilical vein endothelial cells (HUVECs) were cultivated in the high glucose DMEM (Gibco Life Technologies, Karlsruhe, Germany), enriched with 15% fetal calf serum, 100 U/ml penicillin, and 10 μg/ml streptomycin.

Total RNA isolation and cDNA synthesis

Total RNA was extracted from powdered gastric cancer tissues using TRIzol® Reagent (Invitrogen, Carlsbad, California, United States) as stated in manufacturer's protocol (Trizol Reagent. Catalog numbers: 15,596-026 and 15,596-018). One percent agarose gel electrophoresis was used to determine the integrity of the RNA. Nanodrop instrument (Nanolytik, Düsseldorf, Germany) was used for determining RNA concentration by measuring optical density at 260 nm. DNase treatment was performed using DNase set (Fermentas, Vilnius, Lithuania) for erasing genomic DNA. cDNA synthesis was performed using PrimeScriptTM RT reagent Kit (TaKaRa, Kusatsu, Shiga, Japan) as stated in manufacturer's protocol.

Quantitative real-time polymerase chain reaction and DNA sequencing

The expression level of lncRNA-ATB and SETD8 genes was tested by quantitative real-time reverse transcription-polymerase chain reaction (RT-PCR) in comparison to β-Glucuronidase (GUSB) as a reference gene.[23] The primers for the target genes were designed with GeneRunner software, version 4.0, and tested by basic local alignment search tool (BLAST [http://blast.ncbi.nlm.nih.gov/Blast.cgi]) for unity attachment to genome. Primers were as follows for lncRNA-ATB forward: ACGTCTTGTGCTTGGATCCTA, for lncRNA-ATB reverse: CGCAAATACAGACAGGTCACC, with an amplicon size of 227 bp for lncRNA-ATB, primers for SETD8 forward: CGAGCTGCAGTCTGAAGAAAG and for SETD8 reverse: TTTCTTGGCGTCGGTGATC with an amplicon size of 184 bp for SETD8. Real-time PCR was done with RealQ Plus ×2 Master Mix, green (high ROX) (AMPLIQON, Odense M, Denmark) by an Applied Biosystems StepOnePlus™ instrument. The PCR amplification conditions included of first denaturation at 95°C for 10 min, 40 cycles of denaturation at 95°C for 15 s, annealing at 61°C for lncRNA-ATB and SETD8 and at 60°C for GUSB genes for 60 s, then extension for 15 s at 72°C. Moreover, to be ensured that the actual genes of interest (lncRNA-ATB and SETD8) are getting specifically amplified, the PCR products of some samples were sequenced with an Applied Biosystems 3730XL sequencer (Macrogen, Seoul, South Korea).

Statistical gene expression analysis

The ΔCt method (Ct of gene of interest-Ct of housekeeping gene) was used to quantify the relative levels of gene expression. All experiments were done at least two or three times and expressed as means ± standard error of mean. To determine normal distribution of samples, Kolmogorov–Smirnov test was performed. Student's t-test, analysis of variance, and Chi-square were done to examine statistical significance. SPSS software, version 16.0, was used for statistical analyses and P < 0.05 was considered statistically significant.

Results

Optimization of real time-polymerase chain reaction

Prior to the quantitative analysis, optimization procedures were done to achieve a specific amplicon for lncRNA-ATB and SETD8 genes in both conventional and real-time RT-PCR reactions on cancerous gastric tissue specimens. As it was demonstrated in previous studies that both lncRNA-ATB and SETD8 are expressed in MCF-7 breast cancer cell line,[1118] we applied the cDNA of MCF-7 cell line for optimization procedures. Agarose gel electrophoresis of the amplified product of lncRNA-ATB and SETD8 demonstrated a specific band with the expected sizes for both genes. In addition, in real time process, unique melting curves without primer dimers for each of the examined genes confirmed the specificity of amplicons (data not shown). BLAST of the results of PCR product sequencing against human transcripts showed 100% identity with corresponding transcripts.

Expression of long noncoding RNA-ATB and SETD8 genes in various cultivated cells, human cancerous, and noncancerous gastric specimens

According to RT-PCR results, five of five examined cell lines displayed lncRNA-ATB and SETD8 expressions [Figure 1]. To determine the expression levels of lncRNA-ATB and SETD8 genes in human gastric tissues, cDNAs were synthesized for all specimens and real-time PCR was performed using specific primers for lncRNA-ATB, SETD8, and GUSB genes. Relative expression of target genes was detected by subtracting its Ct value to that of the GUSB gene. The results of real-time qRT-PCR experiments demonstrated that while the relative expression of lncRNA-ATB gene was high in some examined tumor tissues, its expression was low in some others. Figure 2 shows the relative mean expression of lncRNA-ATB gene in cancerous and noncancerous gastric tissue samples. As expected from the results, statistical analyses failed to show any significant difference between the lncRNA-ATB gene expression of cancerous specimens and that of the noncancerous ones. Relative quantitation of the expression levels of SETD8 in gastric adenocarcinomas showed that the relative levels of its transcripts were significantly increased (P = 0.018) in cancerous tissues compared with adjacent noncancerous tissues: 0.88 ± 0.66 versus 2.78 ± 0.59, respectively, as shown in Figure 3.
Figure 1

Expression of long noncoding RNA-ATB, SETD8, and β-Glucuronidase transcripts in various cell lines. Electrophoresis of long noncoding RNA-ATB, SETD8, and β-Glucuronidase polymerase chain reaction products on the agarose gel showed a unique band with expected sizes for each gene for all cell lines

Figure 2

Expression level of long noncoding RNA-ATB in gastric cancerous and adjacent noncancerous specimens (n = 37). A smaller ΔCt value demonstrates higher expression. Data are expressed as means ± standard error of mean. Error bars represent standard error of mean

Figure 3

Expression level of SETD8 in gastric cancerous and adjacent noncancerous specimens (n = 38). A smaller ΔCt value demonstrates higher expression. Data are expressed as means ± standard error of mean. *Value that is statistically significant. Error bars represent standard error of mean

Expression of long noncoding RNA-ATB, SETD8, and β-Glucuronidase transcripts in various cell lines. Electrophoresis of long noncoding RNA-ATB, SETD8, and β-Glucuronidase polymerase chain reaction products on the agarose gel showed a unique band with expected sizes for each gene for all cell lines Expression level of long noncoding RNA-ATB in gastric cancerous and adjacent noncancerous specimens (n = 37). A smaller ΔCt value demonstrates higher expression. Data are expressed as means ± standard error of mean. Error bars represent standard error of mean Expression level of SETD8 in gastric cancerous and adjacent noncancerous specimens (n = 38). A smaller ΔCt value demonstrates higher expression. Data are expressed as means ± standard error of mean. *Value that is statistically significant. Error bars represent standard error of mean

Association between long noncoding RNA-ATB and SETD8 expression and clinicopathological characters in gastric cancer

To examine the clinical consequences of the lncRNA-ATB and SETD8 expressions, the correlation between clinicopathological status of gastric cancerous specimens and levels of lncRNA-ATB and SETD8 expression was calculated. Except for a significant inverse correlation between the expression levels of lncRNA-ATB and depth of invasion (T) (P = 0.0002), no significant association was found with other clinicopathological characteristics for both examined genes (data not shown). As in other previous studies in which lncRNA expression in cancerous tissues was classified as high or low according to the median value of lncRNA expression, gastric cancer patients were further divided into two groups based on the median value of relative gene expression in cancer tissues. The correlations between the lncRNA-ATB and SETD8 expression levels and the clinicopathological characters of gastric cancer patients are summarized in Tables 1 and 2. The results suggested a relationship between high SETD8 level and advanced tumor grades (P = 0.01). Overall, no significant association was observed between lncRNA-ATB and SETD8 expression level and any other clinicopathological factors.
Table 1

Relationship between long noncoding RNA-ATB expression levels (as divided into two groups based on the median of ΔCt) and clinicopathological characters of cancerous gastric samples

Table 2

Relationship between SETD8 expression levels (as divided into two groups based on the median of ΔCt) and clinicopathological characters of cancerous gastric samples

Relationship between long noncoding RNA-ATB expression levels (as divided into two groups based on the median of ΔCt) and clinicopathological characters of cancerous gastric samples Relationship between SETD8 expression levels (as divided into two groups based on the median of ΔCt) and clinicopathological characters of cancerous gastric samples

Discussion

In the current study, we examined the lncRNA-ATB gene expression profile in various cultivated cells and a series of cancerous and noncancerous gastric tissue specimens. Real-time qRT-PCR showed that lncRNA-ATB was expressed in all examined cell lines. In gastric tissue samples, cancerous tissues had relatively lower lncRNA-ATB expression levels than noncancerous ones, although the difference was not statistically significant. We also revealed that lncRNA-ATB levels were inversely associated with depth of invasion (T). A previous report by Saito et al.,[14] in patients with gastric cancer, showed that high level of lncRNA-ATB expression was associated with vascular invasion, lower survival rates, and poorer prognosis. They also reported lncRNA-ATB expression levels in all eight examined GC lines. A critical difference between the Saito's study and our own is that they only collected cancerous tissue samples, and not any noncancerous gastric tissues. Yuan et al.[11] discovered the lncRNA-ATB gene and measured its expression level in a set of hepatocellular carcinoma (HCC) tissues. Their result showed that lncRNA-ATB transcript level is higher in the HCC tissues compared to the paired adjacent noncancerous hepatic tissues. There was also a direct correlation between lncRNA-ATB levels and the metastasis-related clinicopathological characteristics of HCC samples. They also assessed the gene expression in SMMC-7721 hepatoma cells, the normal liver cell line QSG-7701, breast cancer cell line MCF7, and colorectal cancer cell line SW480. All cells had basic levels of lncRNA-ATB expression before treatment with TGF-β and showed a significant increase in its levels after TGF-β treatments, further confirming that lncRNA-ATB is regulated by TGF-β. lncRNA-ATB expression has also been evaluated in patients with colorectal cancer. Its high expression levels was associated with greater tumor size, depth of tumor invasion (T), lymphatic invasion, vascular invasion, lymph node metastasis, hematogenous metastasis, and poorer outcomes.[12] In a recent report, high lncRNA-ATB expression level was documented in trastuzumab-resistant SKBR-3 cells and breast cancer tissues. Trastuzumab resistance and invasion-metastasis cascade in breast cancer is mediated by sponging role of lncRNA-ATB for miR-200c and thus increasing ZEB1 and ZNF-217 and then inducing EMT.[15] The first study which reported downregulation of lncRNA-ATB in tumoral tissues was published on 2015.[13] A set of pancreatic cancerous and adjacent noncancerous pancreatic tissues were included in the study and the results showed that lncRNA-ATB transcript level was significantly lower in pancreatic cancerous tissues compared with the paired adjacent noncancerous tissues. Their results also showed that lncRNA-ATB expression levels were significantly and inversely correlated with lymphatic metastasis, neural invasion, and clinical stage. However, lncRNA-ATB expression did not correlate with other clinicopathological characteristics. lncRNA-ATB expression in colon cancer tissues was reported to be significantly higher than matched adjacent mucosa. There was also a direct association between levels of lncRNA-ATB and pN and AJCC stages. Overall survival and disease-free survival in cases with both high lncRNA-ATB expression and low E-cadherin expression were also significantly lower than patients with low lncRNA-ATB levels. Evaluation of expression of lncRNA-ATB in three high-invasive colon cancer cells and three low-invasive colon cancer cells showed higher expression levels in metastatic cell lines.[16] Taken together, our result on gastric cancer is more consistent with the previously published report by Qu et al.[13] who reported a remarkably downregulated levels of lncRNA-ATB in pancreatic tissues. As Qu et al. commented, these findings revealed that lncRNA-ATB might act as an oncogene or cancer suppressor in a tissue-dependent manner.[13] The histone methyltransferase (HMTs) family of proteins consists of enzymes that methylate lysine or arginine residues on histone tails as well as other proteins. The role of many HMTs in tumorigenesis and progression of human cancers have been documented.[24] As a member of HMTs, SETD8 has a well-defined role in the TP53 pathway, thus regulating cell proliferation and genome stability.[25] SETD8 monomethylates protein P53 at lysine 382 and represses its proapoptotic and cell cycle arrest functions.[25] The role of SETD8 in promoting EMT and metastasis has been well documented.[18] Expression analysis of SETD8 in a set of breast tissues revealed a positive correlation between higher SETD8 levels and metastatic capacity of breast cancer tissues.[18] In a study by Takawa et al.,[17] overexpression of SETD8 in numerous types of cancers including bladder cancer, non-small cell lung carcinoma, small cell lung carcinoma, chronic myelogenous leukemia, HCC, and pancreatic cancer has been reported. In the current study, we observed a significantly higher expression of SETD8 in gastric cancer tissues compared to noncancerous ones. Our data are in agreement with the proliferation-promoting role of SETD8 in other cancer types.[1718] An association between SETD8 expression levels and higher tumor grades was observed in our study. In the same vein, SETD8 expression level has been correlated with the grade of malignancy in bladder cancer.[17] Several studies have assessed the cancer-predisposing functions of a microRNA binding site within 3’UTR of SETD8 (rs16917496).[2627282930] It was shown in HCC and non-small cell lung cancer that the SETD8 CC genotype is correlated with reduced SET8 protein levels and longer survival.[2931]

Conclusion

We investigated the clinicopathological relevance of two EMT-related genes: lncRNA-ATB and SETD8 in a series of gastric cancer tissues. Our study demonstrated that lncRNA-ATB expression was partly decreased in gastric cancer and inversely correlated with the depth of invasion (T). We further showed that SETD8 level was augmented in gastric cancerous tissues and this elevation was associated with higher tumor grades. These data showed that lncRNA-ATB and SETD8 genes may play a critical role in gastric cancer progression and may serve as potential diagnostic/prognostic biomarkers in cancer patients. However, further studies are needed to reveal the molecular mechanisms of lncRNA-ATB and SETD8 in gastric cancer pathogenesis.

Financial support and sponsorship

This original article was derived from master thesis of NN and was supported in part by a research grant number 393464 from Isfahan University of Medical Sciences, Isfahan, Iran.

Conflicts of interest

There are no conflicts of interest.
  31 in total

1.  A long noncoding RNA activated by TGF-β promotes the invasion-metastasis cascade in hepatocellular carcinoma.

Authors:  Ji-hang Yuan; Fu Yang; Fang Wang; Jin-zhao Ma; Ying-jun Guo; Qi-fei Tao; Feng Liu; Wei Pan; Tian-tian Wang; Chuan-chuan Zhou; Shao-bing Wang; Yu-zhao Wang; Yuan Yang; Ning Yang; Wei-ping Zhou; Guang-shun Yang; Shu-han Sun
Journal:  Cancer Cell       Date:  2014-04-24       Impact factor: 31.743

2.  Analysis of long non-coding RNA expression profiles in gastric cancer.

Authors:  Wei-Jun Cao; Hai-Lu Wu; Bang-Shun He; Yu-Shu Zhang; Zhen-Yu Zhang
Journal:  World J Gastroenterol       Date:  2013-06-21       Impact factor: 5.742

3.  Downregulation of lncRNA-ATB correlates with clinical progression and unfavorable prognosis in pancreatic cancer.

Authors:  Shibin Qu; Xisheng Yang; Wenjie Song; Wei Sun; Xiaolei Li; Jianlin Wang; Yue Zhong; Runze Shang; Bai Ruan; Zhuochao Zhang; Xuan Zhang; Haimin Li
Journal:  Tumour Biol       Date:  2015-10-19

4.  MSI2 expression is decreased in grade II of gastric carcinoma.

Authors:  Modjtaba Emadi-Baygi; Parvaneh Nikpour; Faezeh Mohammad-Hashem; Mohamad Reza Maracy; Shaghayegh Haghjooy-Javanmard
Journal:  Pathol Res Pract       Date:  2013-08-06       Impact factor: 3.250

5.  A long noncoding RNA, lncRNA-ATB, is involved in the progression and prognosis of colorectal cancer.

Authors:  Tomohiro Iguchi; Ryutaro Uchi; Sho Nambara; Tomoko Saito; Hisateru Komatsu; Hidenari Hirata; Masami Ueda; Shotaro Sakimura; Yuki Takano; Jyunji Kurashige; Yoshiaki Shinden; Hidetoshi Eguchi; Keishi Sugimachi; Yoshihiko Maehara; Koshi Mimori
Journal:  Anticancer Res       Date:  2015-03       Impact factor: 2.480

6.  Modulation of p53 function by SET8-mediated methylation at lysine 382.

Authors:  Xiaobing Shi; Ioulia Kachirskaia; Hiroshi Yamaguchi; Lisandra E West; Hong Wen; Evelyn W Wang; Sucharita Dutta; Ettore Appella; Or Gozani
Journal:  Mol Cell       Date:  2007-08-17       Impact factor: 17.970

7.  A new Lnc in metastasis: long noncoding RNA mediates the prometastatic functions of TGF-β.

Authors:  Wenyang Li; Yibin Kang
Journal:  Cancer Cell       Date:  2014-05-12       Impact factor: 31.743

Review 8.  The non-coding transcriptome as a dynamic regulator of cancer metastasis.

Authors:  Francesco Crea; Pier Luc Clermont; Abhijit Parolia; Yuzhuo Wang; Cheryl D Helgason
Journal:  Cancer Metastasis Rev       Date:  2014-03       Impact factor: 9.264

Review 9.  Noncoding RNAs in cancer and cancer stem cells.

Authors:  Tianzhi Huang; Angel Alvarez; Bo Hu; Shi-Yuan Cheng
Journal:  Chin J Cancer       Date:  2013-11

10.  Genetic variation in a microRNA-502 minding site in SET8 gene confers clinical outcome of non-small cell lung cancer in a Chinese population.

Authors:  Jiali Xu; Zhiqiang Yin; Wen Gao; Lingxiang Liu; Yongmei Yin; Ping Liu; Yongqian Shu
Journal:  PLoS One       Date:  2013-10-11       Impact factor: 3.240

View more
  7 in total

Review 1.  The function of LncRNA-ATB in cancer.

Authors:  Amir Anbiyaiee; Mohammad Ramazii; Siamak Soltani Bajestani; Seyed Mohammadmahdi Meybodi; Mona Keivan; Seyed Esmaeil Khoshnam; Maryam Farzaneh
Journal:  Clin Transl Oncol       Date:  2022-05-21       Impact factor: 3.405

2.  Evaluation of Muc1 Gene Expression at The Time of Implantation in Diabetic Rat Models Treated with Insulin, Metformin and Pioglitazone in The Normal Cycle and Ovulation Induction Cycle.

Authors:  Ronak Zarei; Parvaneh Nikpour; Bahman Rashidi; Nahid Eskandari; Roshanak Aboutorabi
Journal:  Int J Fertil Steril       Date:  2020-10-12

3.  Evaluation of vascular endothelial growth factor A and leukemia inhibitory factor expressions at the time of implantation in diabetic rats following treatment with Metformin and Pioglitazone.

Authors:  Ronak Zarei; Roshanak Aboutorabi; Bahman Rashidi; Nahid Eskandari; Parvaneh Nikpour
Journal:  Int J Reprod Biomed       Date:  2020-09-20

4.  Uncovering the stability status of the reputed reference genes in breast and hepatic cancer cell lines.

Authors:  Gilar Gorji-Bahri; Niloofar Moradtabrizi; Atieh Hashemi
Journal:  PLoS One       Date:  2021-11-09       Impact factor: 3.240

5.  The association between rs16917496 T/C polymorphism of SET8 gene and cancer risk in Asian populations: a meta-analysis.

Authors:  Hui-Xia Wei; Guo-Xiang Tian; Ju-Kun Song; Lian-Jie Yang; Yu-Pei Wang
Journal:  Biosci Rep       Date:  2018-11-13       Impact factor: 3.840

6.  Evaluation of Diabetes Effects on the Expression of Leukemia Inhibitory Factor and Vascular Endothelial Growth Factor A Genes and Proteins at the Time of Endometrial Receptivity after Superovulation in Rat Model.

Authors:  Ronak Zarei; Parvaneh Nikpour; Bahman Rashidi; Nahid Eskandari; Roshanak Aboutorabi
Journal:  Adv Biomed Res       Date:  2019-11-27

7.  The prognostic value of long noncoding RNA activated by TGF-β in digestive system cancers: A meta-analysis.

Authors:  Houyu Duan; Xiang Ding; Hesheng Luo
Journal:  Medicine (Baltimore)       Date:  2020-07-24       Impact factor: 1.817

  7 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.